Gene encoding MET1 methyltransferase and its application in inducing aphid-resistant cucumber breeding

Abstract

The present invention belongs to the technical field of functional genes and plant gene breeding, and discloses a gene encoding MET1 methyltransferase and its application in inducing cucumber aphid resistance breeding. The present invention has found that the gene CsMET1 encoding cucumber DNA methyltransferase is involved in aphid stress response. Through research, it is found that the RNAi transgenic plants of CsMET1 show rich trait variation. Non-selective settlement experiments and simple life tables also show that CsMET1-RNAi gene silenced plants have a richer range of variation than their wild-type traits, indicating that the CsMET1 gene is involved in the response regulation of cucumber aphid stress. It is conducive to the breeding of cucumber insect-resistant germplasm resources, breeding superior materials, and providing new ideas for genetic breeding; and enriching the aphid stress gene pool, providing a new direction for aphid resistance genetic engineering.

Description

Technical Field

[0001] The invention belongs to the technical field of functional genes and plant gene breeding, and particularly relates to a gene encoding MET1 methyltransferase and application thereof in inducing cucumber aphid-resistant breeding. Background Art

[0002] Cucumber is an annual herbaceous plant of the genus Cucurbitaceae. It is an important economic crop and occupies an important industrial position in China and the world.

[0003] Aphids are one of the top ten pests in the world. Cucumber aphid pests have always affected the yield and quality of cucumbers, causing annual yield losses of about 10%-40%, and virus-carrying aphids can even reduce yields by more than 80%. In recent years, with global warming and rising temperatures, aphid pests have become increasingly severe, and the industry is facing serious losses. At present, chemical spraying is still the main prevention and control measure, which will cause environmental pollution and other problems, reducing product quality. Therefore, the use of molecular breeding to genetically enhance and induce aphid resistance is particularly important in cucumber production, and it also has positive significance for green environmental protection and sustainable development. At the same time, epigenetic breeding is a new genetic breeding method. Many studies have shown that the formation, regulation, and stable inheritance of plant-induced resistance are closely related to epigenetic factors including DNA methylation. Using epigenetic breeding methods, exploring major effect genes and clarifying new mechanisms of aphid resistance provide a strong theoretical basis for the creation of new germplasm, and provide new ideas for the selection of cucumber insect-resistant germplasm resources, the selection of superior materials, and the genetic breeding of insect-resistant horticultural crops.

[0004] DNA methylation plays an important regulatory role in organisms and is often associated with gene silencing. Under biotic stress conditions, some genes may need to be silenced to cope with environmental changes, and the activity of DNA methyltransferases may play a role in this process, inducing stress resistance in organisms. DNA methyltransferases may be involved in the adaptive response of organisms to stress. Under biotic stress, epigenetic regulation may help offspring adapt to similar environmental pressures. DNA methyltransferase MET1 reintroduces stress-induced DNA methylation into target gene loci in each new generation, and DNA methylation affects the genes themselves and regulates trait formation. However, there are few studies on the regulation of genes encoding cucumber DNA methyltransferases. Summary of the invention

[0005] The present invention provides a breeding method and application of a gene encoding MET1 methyltransferase to induce cucumber aphid resistance traits, wherein the CsMET1 gene is involved in the response regulation of cucumber aphid stress. The method is beneficial to the breeding of cucumber insect-resistant germplasm resources and superior materials, providing new ideas for genetic breeding, enriching the aphid stress gene pool, and providing a new direction for aphid resistance gene engineering.

[0006] The technical solution provided by the present invention is as follows:

[0007] A MET1 methyltransferase, the amino acid sequence of the protein is shown in SEQ ID NO.2.

[0008] The present invention also provides a gene encoding MET1 methyltransferase, the gene encoding the above protein, and the nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0009] The present invention also provides an expression box, a recombinant vector, a recombinant microorganism or a transgenic cell line containing the gene.

[0010] The present invention also provides application of the above protein or gene in inducing stress resistance of cucumber aphids.

[0011] Furthermore, the inducing cucumber aphid stress resistance is to improve cucumber aphid stress resistance.

[0012] Furthermore, the expression level of the gene encoding the MET1 methyltransferase is down-regulated in cucumber plants to screen transgenic cucumbers showing high aphid resistance compared with the wild type.

[0013] Furthermore, the amplification primers are shown in SEQ ID NOs. 3 to 6.

[0014] Furthermore, the identification primers are shown in SEQ ID NOs. 7-8.

[0015] Furthermore, a specific band of 435 bp appeared in the gel electrophoresis diagram, indicating that transgenic plants with down-regulated expression of the gene encoding MET1 methyltransferase were obtained.

[0016] The present invention also provides a method for breeding cucumbers to improve their resistance to aphid stress, which includes reducing the expression level of the gene encoding the MET1 methyltransferase and screening transgenic cucumbers with high aphid resistance traits compared with the wild type.

[0017] The gene CsMET1 encoding MET1 methyltransferase is an important methyltransferase encoding gene in cucumber, and the CsMET1 protein has the same functional domain as its Arabidopsis thaliana and tomato homologous proteins.

[0018] The present invention also provides the use of the CsMET1 gene in inducing cucumber aphid stress. After the cucumber is inoculated with insects, the CsMET1 gene is significantly upregulated, and obviously responds to the cucumber aphid stress.

[0019] The present invention also provides an application of RNAi transgenic CsMET1 to induce insect resistance in cucumbers, including:

[0020] a. Changed the insect resistance of cucumber;

[0021] b. It was established that aphid resistance is associated with methylation.

[0022] The present invention also provides a verification method for changing the insect resistance of cucumber by RNAi transgenic CsMET1, comprising the following steps:

[0023] S1. Identification of transgenic lines;

[0024] S2, fluorescence quantitative PCR detection of the relative expression of CsMET1 RNAi transgene;

[0025] S3, non-selective colonization experiment was used;

[0026] S4, life table parameter verification;

[0027] In step S1, the DNA extraction of cucumber samples in the one-leaf-one-heart period is specifically as follows: 0.1 g of plant tissue of the cotyledon of the cucumber is taken, ground into powder, extracted with SDS buffer, 12000g, centrifuged at room temperature for 5 min, and supernatant is obtained; an equal volume of isopropanol is added to the supernatant, mixed, 2000g, centrifuged at room temperature for 5 min, and the waste liquid is discarded; 300ul of 70% anhydrous ethanol is added, shaken for washing, 2000g, centrifuged at room temperature for 5 min, and the waste liquid is discarded; inverted on filter paper until dry, 50ul of ddH2O is added to obtain a DNA solution.

[0028] The fluorescent quantitative PCR in step S2 is specifically divided into: first, extracting RNA from wild-type and CsMET1 RNAi transgenic plants; and second, quantifying the gene expression level.

[0029] The specific steps of inoculating aphids at the cucumber seedling stage in steps S3 and S4 are as follows: sowing the transgenic cucumbers, cultivating them at room temperature, and screening them by non-selective colonization experiment when they grow to one leaf and one heart; and also performing life table parameter experiments.

[0030] Beneficial Effects

[0031] The present invention provides a breeding method and application of a gene encoding MET1 methyltransferase to induce cucumber aphid resistance traits. The present invention studies and finds that the gene encoding DNA methyltransferase CsMET1 participates in induction to improve the ability of cucumber to cope with aphid stress. Wild-type and transgenic plants respond to aphid stress in the same environment, and it is found that the transgenic plants show 80% high attraction to aphids and 20% low attraction compared with the wild-type; and 75% show high-level reproduction and 25% show extremely low-level reproduction, indicating that after the DNA methyltransferase gene CsMET1 is silenced, the aphid resistance of the cucumber plant presents a wider range of trait variation, which is more conducive to screening out plants with better aphid resistance; CsMET1 RNAi transgenic plants obviously show new aphid resistance trait variation in the selection of cucumber aphid resistance materials, proving that CsMET1 gene induction is involved in the response mechanism of cucumber aphid stress. In terms of genetic breeding, we selected and bred aphid-resistant cucumber germplasm resources and superior materials to solve the problem of aphid pests in production, obtain high-yield and high-quality cucumbers, and at the same time provide new ideas and directions for molecular genetic breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 Comparison of the MET1 protein structures of cucumber, Arabidopsis, and tomato;

[0033] Figure 2 The expression changes of CsMET1 gene before and after aphid inoculation;

[0034] Figure 3 Gel electrophoresis diagram for identification of CsMET1 transgenic lines;

[0035] Figure 4 is the relative expression level of RNAi transgene of CsMET1;

[0036] Figure 5 The number of aphids settled in wild type and transgenic plants at 2h; 9930 is the wild type, Mr-1 is the line 1 of CsMET1 RNAi transgenic plant, and Mr-2 is the line 2 of CsMET1 RNAi transgenic plant;

[0037] Figure 6 Life table parameters for wild type and transgenic. DETAILED DESCRIPTION

[0038] The technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention; it is obvious that the described embodiments are only part of the embodiments of the present invention, rather than all the embodiments, and all other embodiments obtained by ordinary technicians in this field based on the embodiments of the present invention without making creative work are within the scope of protection of the present invention.

[0039] Example 1

[0040] See also Figure 1 The CsMET1 gene is an important methyltransferase encoding gene in cucumber. The CsMET1 protein has the same functional domain as its Arabidopsis and tomato homologous proteins.

[0041] Using hmmer to construct a hidden Markov model to search for homologous genes and combining it with the protein multiple sequence homology alignment (BLASP) method, CsMET1 (coding gene ID CsC17_3G001070) was identified. The full length of CsMET1 protein is 1550aa, and it has the same functional domain as its Arabidopsis and tomato homologous proteins. Figure 1 Comparison of the MET1 protein structures of cucumber, Arabidopsis, and tomato.

[0042] Example 2

[0043] Aphid inoculation treatment: Use cucumber seedlings, and when the plants grow to one leaf and one heart, inoculate 40 adult aphids on the first true leaf, and cover it with a special nylon net to prevent other aphids from getting on and reduce experimental errors; use liquid nitrogen to take samples before aphids feed and after 6h, 24h, 72h, and 120h of feeding, and place them in a -80℃ refrigerator or directly extract RNA for reverse transcription and perform fluorescence quantification.

[0044] Fluorescence quantitative technology:

[0045] Fluorescence quantitative PCR technology was used to explore the expression level of CsMET1 gene before and after inoculation. Based on the exon region of CsMET1 gene, the forward primer 5'-AGATGAGAAGGTTCGGTTGTC-3' (SEQ ID NO.3) and the reverse primer 5'-TGTGCCTCTTAGCTGTATTGG-3' (SEQ ID NO.4) of fluorescence quantitative PCR primers were designed. Based on the Actin gene, the internal reference primers forward primer 5'-GCTGGATTCTGGTGATGGTG-3' (SEQ ID NO.5) and reverse primer 5'-AGCAAGGTCCAAACGGAGAA-3' (SEQ ID NO.6) were designed. Using SYBR Premix Ex Taq (Takara) and fluorescence quantitative PCR instrument q225 (Cool Bo Company), according to the manufacturer's instructions for PCR system and program, fluorescence quantitative PCR was performed to obtain the number of cycles that reached the fluorescence threshold, and the relative expression level of CsMET1 gene before and after inoculation was calculated. The results are shown in the figure. Figure 2 As shown, the expression level of CsMET1 gene was significantly increased at 6h, 24h, and 72h after inoculation compared with that before inoculation, indicating that CsMET1 gene strongly responded to aphid stress.

[0046] Embodiment 3:

[0047] 1. Genetically modified cucumber cultivation:

[0048] The specific reagents and kits for this experiment can be purchased through conventional channels for scientific research.

[0049] i. Design primers and construct vectors: Design primers and amplify the target gene and vector sequences;

[0050] PCR procedure:

[0051]

[0052] 4℃ storage temperature,

[0053] ii. Product purification: Purify the PCR product in the previous step using the DC301 kit;

[0054] iii. Recombinant vector: system (10ul) is as follows

[0055] PCR product 4ul

[0056] Vector 2ul

[0057] Recombinant enzyme 1ul

[0058] Reconstitution buffer 2ul

[0059] H2O 1ul,

[0060] iv. Run the PCR program in a PCR instrument at 37°C for 30 min, then place on ice or store at 4°C;

[0061] v. Transform competent E. coli DH5ɑ using the common kit Novozyme C502;

[0062] vi. Colony PCR

[0063] PCR reaction (20ul) system:

[0064] PCR Mix 10ul

[0065] Primer upstream 1ul

[0066] 1ul downstream of primer

[0067] Bacterial liquid 5ul

[0068] H2O 3ul;

[0069] PCR procedure:

[0070]

[0071] Store at 4℃, perform gel electrophoresis, and select the bacterial solution with the correct band for testing;

[0072] vii. Plasmid extraction and Agrobacterium transformation

[0073] The above bacterial solution with the correct sequencing results was used to extract the plasmid using the kit DP103;

[0074] The above plasmids were introduced into Agrobacterium using the kit GV3101;

[0075] Pick a single clone and send the bacterial solution for testing. If the sequencing result is correct, perform transformation;

[0076] viii. Genetic transformation

[0077] Infection: Use 2-day-old cucumber cotyledons as the material, place them in a culture dish containing 50 ml of Agrobacterium suspension, and leave them at room temperature for 30 minutes for infection.

[0078] Co-cultivation: Place the infected explants in co-culture medium at 23°C in the dark for 3 days.

[0079] Screening of resistant buds: After co-cultivation, transfer to rest medium and culture under light at 25°C for 7 days; place on screening medium with corresponding resistance, screen and culture for 6 weeks to induce resistant buds;

[0080] Rooting: Transfer the resistant buds to the corresponding resistance elongation medium and culture them in the light for 3-6 weeks at 25℃ and 500Lux until rooting.

[0081] 2. Identification of transgenic genes:

[0082] Using the CsMET1 RNAi transgenic vector tag forward primer 5'-AGAGTCGTCACGGATATCAAGGG-3' (SEQ ID NO.7) and reverse primer 5'-GCTGCCACCCATGCTCTCAAGGG-3' (SEQ ID NO.8), the transgenic CsMET1_RNAi-1 (Mr-1) and CsMET1_RNAi-2 (Mr-2) strains were sampled and DNA was extracted for identification. Figure 3 Shown: Gel electrophoresis diagram of CsMET1 transgenic strain identification, the band is around 435bp, indicating the presence of the vector in the transgenic strain.

[0083] Identification system (20ul):

[0084] PCR buffer 10ul

[0085] H2O 7ul

[0086] Upstream primer F (10uM) 1ul

[0087] Downstream primer R (10uM) 1ul

[0088] DNA 1ul

[0089] Reaction procedure:

[0090]

[0091] Using the same fluorescence quantitative technology, RNA Easy Fast Plant Tissue RNA Rapid Extraction Kit (DP452) was used to extract RNA from the two transgenic lines, and the HiScript IIQ RT SuperMix for qPCR (+gDNAwiper) kit was used to reverse transcribe it into cDNA. Fluorescence quantitative analysis verified that the CsMET1 gene level was reduced. The results are as follows: Figure 4 Shown: The relative expression level of the RNAi transgene of CsMET1, indicating that the CsMET1 gene in the transgenic line was silenced.

[0092] Embodiment 4:

[0093] Non-selective colonization experimental techniques:

[0094] A non-selective colonization experiment was designed. The specific operation steps were as follows: Place a wet paper towel on the transgenic cucumber seeds received from the seed breeding in a germination tray, put the seeds in, and place in a 28°C biochemical incubator in the dark; culture overnight until the seeds germinate and then sow them, then cultivate them under the conditions of 12000 Lux, 26°C, 16 h, darkness, 22°C, 8 h, and 60% humidity, and select plants with consistent growth for the experiment when they grow to one leaf and one heart.

[0095] First, a 0.5 cm thick sponge is stuck on the petiole of the true leaf. A transparent plastic cup made of PP is used to cut the bottom of the cup to match the size of the sponge, and the upper part of the plastic cup is covered with a 200-mesh insect-proof mesh gauze; 10 2-3 year old wingless nymphs are placed in the middle of the cup wall, and the number of aphids settling on the leaves is observed and recorded for 2 hours, and repeated 12 times. After that, the Mr-2 strain was verified for the second time, and a total of 45 tests were conducted on the two strains. The calculation was performed using the function TTEST, and the results were considered significantly different when p<0.05. According to the statistical range definition, the number of wild-type aphids settling (heads) is 4 to 8, indicating that the transgenic cucumber plants have enhanced aphid resistance, that is, the number of 4 or less results reached 14 times, and the extreme value (3 or less) reached 9 times. The results are as follows Figure 5 As shown, compared with the wild type, 80% of the transgenic cucumber plants showed high attraction when the number of aphids settled in the wild type reached 4 to 8 or more, while the transgenic cucumber plants showed low attraction to aphids at 3 or less, accounting for 20%. This once again proves that CsMET1 gene silencing has the effect of inducing and increasing aphid stress.

[0096] Embodiment 4:

[0097] A life table parameter experiment was designed for one of the transgenic lines, Mr-2, to verify its aphid resistance. The specific steps were as follows: the wild-type and transgenic cucumbers were germinated and sown, and cultivated under conditions of 12000 Lux, 26°C, 16 h of light, 22°C, 8 h of darkness, and 60% humidity. When they grew to one leaf and one heart, plants with consistent growth were selected for the experiment; a transparent sheet of PP material was cut into a circle with a radius of 9 cm on the stem of the plant, and it was surrounded on the stem. A single newly produced 1-year-old wingless aphid nymph was inoculated on the true leaf, and the outer edge of the seedling pot was covered with a 200-mesh nylon net until the aphid completed its entire life cycle. The life span (days), life cycle T (days), and number of aphids produced (heads) on the plants were recorded and observed every day, and the net value-added rate (R0) and weekly growth rate were calculated and compared. Intrinsic growth rate (r m ). Calculation formula: Net proliferation rate: R0 = ∑l x m X , intrinsic growth rate: r m =(lnR0) / T, weekly growth rate: A = e rm , x is the survival time of aphids in days, l x represents the survival rate on day x, m X represents the average litter size on day x. The number of biological replicates was 28. Figure 6 As shown: life table parameters of wild-type and transgenic plants, compared with the wild-type, 4 transgenic lines had significantly shortened aphid lifespan and 7 had significantly shortened aphid life cycle, so the life cycle was about 14%, significantly reducing aphid lifespan and fecundity; R0, r m Although there was no significant difference, it was found that after silencing the CsMET1 level, due to the influence of methylation rearrangement, cucumber strains with significantly enhanced aphid resistance were screened out in terms of aphid reproduction, life cycle, and aphid lifespan.

[0098] SEQ ID NO.1

[0099] atggcgaaga agactaggag ccaattaatg gctacatcga acgatctaga aaagtcggacacaaaaaatg ttaaagcagt

[0100] caaaccaaag caaaagagaa ataggttgga aaatggtgaa caggttgttg gtgtcaggaaaatgccaaag cgtgctgcct

[0101] cctgctcaga tttcaaggtc aaaactattc aattaccaga gaaatcttct gtgattgaatgcaaaaggga ggtgacagtg gaagatgaga

[0102] tagctgcggt cgggttgacg acgttggggc aggatgattc tcggccaaat aggactaactgaattc atttcatgac gaggatgga

[0103] agccacaggc tgttgaaatg ttagaagtaa acgatttgtt catttcaggt gttatcttgccttttgaaga catctcggat aaagagaaga

[0104] ataagggtgt taggtgtgaa ggatttggac ggattgagtc ttggacaata tctggttatgaagatggctc accaactata tggatctcca

[0105] ccgatgttgc tgattatgat tgtgttaggc ctgcagctgg atacaaaaag ctatataatatcttctatga aaaagccaat gcctgtgtgg

[0106] aggtctacaa gaaattggca aggagttctg gtgggtatcc aggtttgaca ttggaggaattgcttggtgg aggtagcgc tccttgaaca

[0107] gtagtagaaa ttttcctgct gggatgtctg tcaaagattt tatcattttg cagggggagtttatatata tcaacttatt ggtttagatg

[0108] atacatccaa gaaaaatgac caagttttca cagacttgcc tgtgctttgt gccctaagggatgaaagcag aaaacaaggg aacttgctac

[0109] cgaatgcagg catatttgat gggttcacaa atcttggttt gaagattaaa gatggagagcaactcaatcc tcccaatata cttggatctg

[0110] gagatgagga agatgaggat ttgaaattgg ctaagttgct ccaagaagag gagtattggcgatctgcaaa gcaaagaaaa

[0111] actcagcgtt ctacgacttc atcaaacaag ttctacatca aaatcaatga ggatgaaattgcaaatgact atcctctgcc tgccttttac

[0112] aaaactacta aagatgaaat ggatgaatat gttatctttg atggggatat ggatgtatgtgatcctgatg accttcctcg aagcatgctt

[0113] cataactggt ccctttacaa ctctgattct cggcttattt ccttagaact tcttccaatgaaaccttgtg atgacattga tgtgacaata

[0114] tatgggtcgg ggatcatgac tgctgatgat ggaagtggtt tctgtcttga tgctgataccagtcagtcat gttcgtctca aatgcagaac

[0115] acagatggga tcccaattta tttgagtgct ataaaggagt ggatgattga gttcggatcttcaatggtgt tcatatcaat tcgcactgac

[0116] atggcctggt accggttggg aaagccatcc aagcagtatg ctccatggta tcaaacagtactaaaaactg cgaggcttgc aatatgcatt

[0117] attatgttac tgaaggagca gagtcgtgcc tcaaactt ctttgcagt tattattaaaaaatttctg aatttgataa gaacaatcct

[0118] gcttatatct cttccatccc gtcggttgtt gagagatatg tggtgtaca tggacagataatactgcaaa ccttttctga atatccagat

[0119] gatatgatcc ggaagtgtgc ctttatact gggctgtg ataaatgga ggaaggcatcataccaagt ggttggtaag gagaaggct

[0120] gttctaaagc aggaggcaaa tatgaatcca agagcctcaa tgaacctgt aacttcaagaaggctgc ctgctactac aactagattg

[0121] aaaacagga tttggggaga attttactca aattattcgc cagagactt gaagcggcggaataatg aaaaaaaga agatgaacca

[0122] gagaagagg aggaggttga agacgagaa tcagagagg tgagaga agatggtcaagtggattga aaactaaga

[0123] atcaaagcct gttgtaaagc ctgcgaaggc aaagctttct gaggaata aataatgggatggtaaatg gtaggcaaaa

[0124] caagtgaagg ctatcctctt tacaacaag ccattgtcca tggagattg gttgctgtggtggttgt gtctgtagaa acagataatg

[0125] tacatgactt gcctgccata tatctgtgg agtacatgta tgaaaaatcc aatggaagaaaaatggttca cggtaggctg ctagttagag

[0126] gattggagac tgttttaggc aatgctgcca aggagcgaga ggttttctt accaatgatgtctggaatt tgagttgaac gaatcagag

[0127] aagcagtggt tgtagagagt tgcatgaggc cttgggata tcagcaccgc aaggctaatgccaagaagga taaggctgag

[0128] gaggaaagg cagaggagag gaacataga ggactgccta tggagtttta ttgtaaagcttgtattggc ccgaaaagg tgctttcttt

[0129] tgtcttccaa agagaccat ggggctggga accggatt gccattctg taaactaaggaaacccaaa gagaggatac

[0130] catgaaattg cattctctt tgacaagctt tacatacagg ggaactgact attctgttaatgatgtgtt tacttagctc ctcatcattt

[0131] tggaaccgat gaaagaggca tcgagacatt caaggggtt agaatgtag tcctcaatgcttgttgtt tgtcaattgc tgggaattga

[0132] atcacccaag ggttcaaac aaccttgtcc ggtgtcaacc atggttcaag ttaggattttttagacca gaggacattt cagtagaaaa

[0133] ggcatactgc tcagatatta gagaactgta ctacagtgat gaacaacca tgaagcctgtttctgctata gaaggaagt gtgaagtacg

[0134] aaaaaagcag gatatcccag tgcaactg tcctgctatc ttgatcaca tctcttttgcgaacctc tatgatccag agaagggagc

[0135] tatcaaaag ttgccagcta gtgtgaaact aagttcccct tccgaaggc aattagtgatgctgcacaa agaaagaaa aaggaaagtg

[0136] taaagaagga gaattatac ctgatgaaaa tgagacaaa aagatttgc cccttgaaatcgttgct actctggata tatttgctgg

[0137] ctgtggtggc ttatctgagg gtctgcagca agcaggcgtt tcagttacca aatgggccattgaatatgaa gagcctgcgg gtgaagcatt

[0138] tagtctcaat catccagagg cattgacatt tgtgaataat tgcaatgtga tcctaagggctgtcatgaaa gcatgtggtg atgcagatga

[0139] ttgtatatca acttctgaag ccattgaact cgcagaaaaa cttgatgaca aggagatcaataatctgcct cgtccaggac aagttgagtt

[0140] catcaatggt ggacctcctt gtcagggtttt ctctggaatg aatcgtttta atcagagtacttggagtag gtccaatgtg agatgattt

[0141] ggcgttctta tcctttgctg aatactttcg tccaaagtat tttcttgg agaacgtgaggaattttgtt tcgtttaata aagggcaaac

[0142] tttcgcctt actttagctt cacttcttga gatggggtat caggtaaaat ttggtattctagaggctggg gcatatggaa tctctcaatc

[0143] tagaaaacgt gccttcatat gggcagcgtc tcctgaggaa attctaccag aatggccagagccaatgcat gtctttggta gcccggagct

[0144] aaagatttca ttgtctgata atactcgata tgctgctgtt cctagtacag cgggaggtgcaccgtttcgt ccaattactg tcagagatac

[0145] aattggagat ctaccagctg ttggaaatgg ggcttctgtg ataacgatgg agtacaagagcgaaccggca tcttggttcc agaagaagat

[0146] tcgaggagat gttcttgttt tgaatgatca tatatcaaaa gaaatgaacg aactaaatctttagatgt caaagaattc caaaacgcc

[0147] aggtgctgat tggcgcgatc ttccagatga gaaggttcgg ttgtcaaatg gacaaatgcatgacttgata ccctggtgcc tgcccaatac

[0148] agctaagagg cacaaccaat ggaaaggctt gttggccgg ttggaatggg aagggaacttccccacttca attactgacc ctcaaccaat

[0149] gggcaaggtc ggaatgtgtt tccaccccga gcaggatagg atacttaccg tccgtgaatgtgctcgatct caaggattcc cagatagcta

[0150] caaatttgct ggtaatattc aacacaaaca caggcaaatt gggaatgctg ttcctcctccattggcatat gctttgggga ggaaactcag

[0151] ggaagcaata gagatgaaaa gctccaaatc agtgttgagt tga

[0152] SEQ ID NO.2

[0153]

Claims

1. Use of an agent for down-regulating the expression of a gene encoding MET1 methyltransferase in screening cucumbers resistant to aphid stress, characterized in that: The amino acid sequence of the MET1 methyltransferase is shown in SEQ ID NO.2; The expression level of the gene encoding MET1 methyltransferase was down-regulated in cucumber plants, and transgenic cucumbers with high aphid resistance compared with the wild type were screened.

2. The use according to claim 1, characterized in that: The forward primer sequence of the fluorescent quantitative PCR primer designed based on the exon region of the MET1 methyltransferase gene is shown in SEQ ID NO.3, and the reverse primer sequence is shown in SEQ ID NO.4; the forward primer sequence of the internal reference primer is shown in SEQ ID NO.5, and the reverse primer sequence is shown in SEQ ID NO.

6.

3. A method for cultivating cucumbers resistant to aphid stress, characterized in that: The expression level of a gene encoding MET1 methyltransferase is reduced in cucumber plants, and transgenic cucumbers showing high aphid resistance compared with wild type are screened. The amino acid sequence of the MET1 methyltransferase is shown in SEQ ID NO.2.

Images