Gene editing plasmid, kit, method and application of Bacillus subtilis

Abstract

The present application relates to the technical field of Bacillus subtilis, and specifically to a gene editing plasmid, a kit, a method and an application of Bacillus subtilis. The gene editing plasmid has an increased homology arm that is homologous to the upstream and downstream of the lacA gene of Bacillus subtilis, which can significantly improve the editing efficiency of the gene editing plasmid at the lacA site, improve the positive clones obtained by screening, provide great help for the construction of engineering strains of Bacillus subtilis and improve the construction efficiency of these engineering strains.

Description

Technical Field

[0001] The present application relates to the technical field of Bacillus subtilis, and specifically to a gene editing plasmid, a kit, a method and an application of Bacillus subtilis. Background Art

[0002] Bacillus subtilis is a representative species of Gram-positive bacteria and has played an irreplaceable role in both basic and applied microbial research. In the field of basic research, the bacterium is able to carry out various types of multicellular differentiation behaviors such as the formation of spores and biofilms, providing a golden research system for people to deeply understand the differentiation and development of bacterial cells. In the field of practical application, Bacillus subtilis is used as a microbial cell factory to produce chemicals, enzymes, secondary metabolites, etc. due to its clear genetic metabolic background, simple gene operating system, and strong protein secretion ability. It has a wide range of applications in industry, agriculture, and medicine.

[0003] Commonly used editing sites in Bacillus subtilis include amyE (encoding α-amylase) and lacA (encoding β-galactosidase), and the corresponding gene editing plasmids include pDG1730 and pAX01 plasmids. In the prior art, the lacA editing site has high editing activity and can be used as an editing site for introducing various exogenous genes (e.g., lacZ, encoding β-galactosidase in Escherichia coli K12 MG1655) into the chromosomal genome of Bacillus subtilis. Since lacA itself carries the background activity of β-galactosidase, fusing the promoter with the lacZ reporter gene and then editing it into the lacA site can destroy the open reading frame of lacA and avoid the interference of lacA with the detection of the lacZ reporter gene. Summary of the invention

[0004] The inventors of the present application provide a gene editing plasmid of Bacillus subtilis. The gene editing plasmid has an increased homology arm that is homologous to the upstream and downstream of the lacA gene of Bacillus subtilis, which can significantly improve the editing efficiency of the gene editing plasmid at the lacA site, improve the positive clones obtained by screening, provide great help for the construction of engineering strains of Bacillus subtilis and improve the construction efficiency of these engineering strains.

[0005] In the first aspect, the embodiment discloses a gene editing plasmid of Bacillus subtilis. The gene editing plasmid has a first homology arm homologous to the upstream sequence of the lacA gene of Bacillus subtilis, a second homology arm homologous to the downstream sequence of the lacA gene of Bacillus subtilis, a first resistance gene between the first homology arm and the second homology arm, a restriction site between the first resistance gene and the second homology arm, and a second resistance gene and a replication initiation region located downstream of the second homology arm. The length of the first homology arm is selected from any length of 600 to 1500 bp. The length of the second homology arm is selected from any length of 600 to 1500 bp. The lacA gene number is Gene ID: 936313. The restriction site is used to be cut by a restriction endonuclease to insert a reporter gene and / or an exogenous gene.

[0006] In a second aspect, the embodiments disclose a gene editing kit for Bacillus subtilis, which includes the gene editing plasmid described in the first aspect.

[0007] In the third aspect, the embodiment discloses a gene editing method for Bacillus subtilis. The gene editing method comprises: transferring the gene editing plasmid described in the first aspect into Bacillus subtilis; and harvesting positive transformants edited by the exogenous gene to the lacA gene site.

[0008] In the fourth aspect, a method for constructing a gene editing plasmid of Bacillus subtilis. The gene editing plasmid has: a first homology arm homologous to the upstream sequence of the lacA gene of Bacillus subtilis; a second homology arm homologous to the downstream sequence of the lacA gene of Bacillus subtilis; a first resistance gene located between the first homology arm and the second homology arm; an enzyme cutting site located between the first resistance gene and the second homology arm, the enzyme cutting site is used to be cut by a restriction endonuclease to insert a reporter gene and / or an exogenous gene; and a second resistance gene and a replication initiation region located downstream of the second homology arm; wherein the length of the first homology arm is selected from any length in the range of 600 to 1500 bp, the length of the second homology arm is selected from any length in the range of 600 to 1500 bp, and the lacA gene number is Gene ID: 936313. The exogenous gene region is used to introduce exogenous genes into the lacA gene site of the Bacillus subtilis. The construction method comprises: obtaining a basic plasmid, wherein the basic plasmid has a first homology arm of 500 bp, a second homology arm of 500 bp, a first resistance gene located between the first homology arm and the second homology arm, xyIR, and a second resistance gene and a replication initiation region located downstream of the second homology arm; and replacing the first homology arm of 500 bp with a first homology arm of 600 to 1500 bp and / or replacing the second homology arm of 500 bp with a second homology arm of 600 to 1500 bp.

[0009] In the fifth aspect, the embodiments disclose the use of the gene editing plasmid described in the first aspect or the gene editing kit described in the second aspect in constructing an engineered strain of Bacillus subtilis. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] Figure 1 The present invention provides a schematic diagram of the principle of gene editing at the lacA site of the Bacillus subtilis genome by homologous recombination.

[0011] Figure 2 The lacA site of the Bacillus subtilis genome (A), the schematic diagram of the pAX01 plasmid structure (B), and the schematic diagram of the pZDlacA plasmid structure (C) provided in the examples.

[0012] Figure 3 Schematic diagram of the construction process of the gene editing plasmid pZDlacA provided in the example. Figure 3 A is a schematic diagram of the structure of the original vector pAX01. Figure 3 B is a schematic diagram of the structure of the intermediate plasmid pAX01-PilvA-lacZ. Figure 3 C is a schematic diagram of the structure of the gene editing plasmid pZDlacA.

[0013] Figure 4 Colony plate images of various transformants provided in the Examples. Figure 4 A is a colony image of Bacillus subtilis 168 transformed with pAX01-PargC-lacZ and pZDlacA-PargC, respectively. Figure 4 B is the colony image of Bacillus subtilis 168 transformed with pAX01-PacsA-lacZ and pZDlacA-PacsA, respectively. Figure 4 C is the colony image of Bacillus subtilis 168 transformed with pAX01-PilvB-lacZ and pZDlacA-PilvB, respectively. Figure 4 D is the colony image of Bacillus subtilis 168 transformed with pAX01-PbcaP-lacZ and pZDlacA-PbcaP, respectively. Figure 4 E is the colony image of Bacillus subtilis 168 transformed with pAX01-PilvA-lacZ and pZDlacA, respectively. Figure 4 F is the colony image of Bacillus subtilis 168 transformed with pAX01-PsrfAA-lacZ and pZDlacA-PsrfAA, respectively.

[0014] Figure 5 This is a schematic diagram of the PCR verification method for the colony or genome of each transformant provided in the embodiment, wherein the primer pairs required for amplification are P1 / P2, P3 / P4, and P5 / P6.

[0015] Figure 6 The colony PCR verification results of each transformant provided in the examples. Figure 6 A is the electrophoresis diagram of Bacillus subtilis 168 transformed with pAX01-PargC-lacZ. Figure 6 B is the electrophoresis diagram of Bacillus subtilis 168 transformed with pAX01-PacsA-lacZ. Figure 6 C is the electrophoresis diagram of Bacillus subtilis 168 transformed with pAX01-PilvB-lacZ. Figure 6 D is the electrophoresis diagram of Bacillus subtilis 168 transformed with pAX01-PbcaP-lacZ.

[0016] Figure 7 The colony PCR verification results of each transformant provided in the examples. Figure 7 A is the electrophoresis diagram of Bacillus subtilis 168 transformed with pZDlacA-PargC. Figure 7 B is the electrophoresis diagram of Bacillus subtilis 168 transformed with pZDlacA-PacsA. Figure 7 C is the electrophoresis diagram of Bacillus subtilis 168 transformed with pZDlacA-PilvB. Figure 7 D is the electrophoresis diagram of Bacillus subtilis 168 transformed with pZDlacA-PbcaP.

[0017] Figure 8 Provided as an example is a genome verification electrophoresis diagram of Bacillus subtilis 168 transformed with pAX01-PilvB-lacZ.

[0018] Fig. 9 The PCR verification results of the genome of each transformant provided in the examples were transformed into Bacillus subtilis 168. Fig. 9 A is the electrophoresis diagram of Bacillus subtilis 168 transformed with pZDlacA-PargC. Fig. 9 B is the electrophoresis diagram of Bacillus subtilis 168 transformed with pZDlacA-PacsA. Fig. 9 C is the electrophoresis diagram of Bacillus subtilis 168 transformed with pZDlacA-PilvB. Fig. 9 D is the electrophoresis diagram of Bacillus subtilis 168 transformed with pZDlacA-PbcaP.

[0019] Fig.10 The promoter transcription activities of each transformant provided in the examples in nutrient broth medium (LB), glucose casein hydrolysate medium (Glucose+cAA) and glucose medium (Glucose). Fig.10 A is the lacZ transcription activity initiated by PargC. Fig.10B is the lacZ transcription activity initiated by PacsA. Fig.10 C is the transcriptional activity of lacZ initiated by PilvB. Fig.10 D is the transcriptional activity of the PbcaP promoter. Fig.10 E is the transcriptional activity of lacZ initiated by PilvA. Fig.10 F represents the transcriptional activity of lacZ initiated by PsrfAA. DETAILED DESCRIPTION

[0020] In order to make the purpose, technical scheme and advantages of the present application clearer, the present application is further described in detail below in conjunction with the examples. It should be understood that the specific embodiments described herein are only used to explain the present application and are not intended to limit the present application. The reagents not described separately in detail in the present application are all conventional reagents and can be obtained from commercial channels; the methods not described in detail are all conventional experimental methods and can be obtained from the prior art.

[0021] Unlike autonomously replicating plasmids, plasmids that are gene-edited by homologous recombination methods cannot be replicated in the target strain, but the target gene fragment is edited to a specific position of the bacterial chromosome through homologous recombination double exchange. The inventors of the present application have found that by extending the homologous arms of a class of gene-editing plasmids with Bacillus subtilis lacA homologous arms, DNA fragments up to 6kb can be edited into the lacA site of the Bacillus subtilis chromosome, and the number of transformants and the editing positive rate (85% to 100%) can be greatly improved. The gene editing plasmid can significantly improve the editing efficiency of the gene editing plasmid at the lacA site, improve the positive clones obtained by screening, provide great help for the construction of engineering strains of Bacillus subtilis and improve the construction efficiency of these engineering strains.

[0022] The embodiment discloses a gene editing plasmid of Bacillus subtilis. The gene editing plasmid has a first homology arm homologous to the upstream sequence of the lacA gene of Bacillus subtilis, a second homology arm homologous to the downstream sequence of the lacA gene of Bacillus subtilis, a first resistance gene between the first homology arm and the second homology arm, a restriction site between the first resistance gene and the second homology arm, and a second resistance gene and a replication initiation region downstream of the second homology arm. The length of the first homology arm is selected from any length of 600 to 1500 bp. The length of the second homology arm is selected from any length of 600 to 1500 bp. The lacA gene is numbered as Gene ID: 936313. The restriction site is used to be cut by a restriction endonuclease to insert a reporter gene and / or an exogenous gene.

[0023] In some embodiments, the length of the first homology arm is selected from 700bp, 800bp, 900bp, 1000bp, 1100bp, 1200bp, 1300bp, 1400bp, 1500bp. In some embodiments, the length of the second homology arm is selected from 700bp, 800bp, 900bp, 1000bp, 1100bp, 1200bp, 1300bp, 1400bp, 1500bp.

[0024] In some embodiments, the restriction enzyme cleavage site is selected from at least one of BamHI, BcuI, NotI, SacI, SacII, SmaI, ClaI, and XhoI.

[0025] In some embodiments, the first resistance gene and the second resistance gene are independently selected from one of the encoding genes of ampicillin, tetracycline, chloramphenicol, streptomycin, hygromycin, spectinomycin, kanamycin, blasticidin, geneticin, hygromycin, mycophenolic acid, puromycin, bleomycin or neomycin.

[0026] In some embodiments, the reporter gene is selected from lacA, lacZ, β-glucuronidase gene, firefly luciferase gene, marine coelenteron luciferase gene, secreted alkaline phosphatase gene, human growth hormone gene, green fluorescent protein encoding gene, blue fluorescent protein encoding gene, yellow fluorescent protein encoding gene, orange fluorescent protein encoding gene, red fluorescent protein encoding gene, far-red fluorescent protein encoding gene or switchable fluorescent protein encoding gene; optionally, the reporter gene is selected from at least one of lacA, lacZ, chloramphenicol acetyltransferase gene, β-glucuronidase gene and green fluorescent protein gene.

[0027] In some embodiments, the gene editing plasmid further has a promoter for initiating expression of the reporter gene. In some embodiments, the promoter is selected from at least one of PargC, PacsA, PilvB, PbcaP, PilvA, and PsrfAA.

[0028] To briefly illustrate the editing efficiency of the gene editing plasmid provided in the embodiments of the present application, the present application introduces a reporter gene lacZ between the first homologous arm and the second homologous arm, and detects the transcription and expression efficiency of lacZ at the lacA site of Bacillus subtilis to detect the editing efficiency of the gene editing plasmid.

[0029] Intermediate plasmid

[0030] like Figure 1As shown, the original plasmid is pAX01 (reference J Bacteriol. 2001, 183 (8): 2696-9.), and some embodiments insert the reporter gene lacZ into the BamHI restriction site between the lacA' region (the upstream homologous arm of the lacA gene, shown in SEQ ID NO. 1) and the 'lacA region (the downstream homologous arm of the lacA gene, shown in SEQ ID NO. 2) of pAX01, thereby constructing the plasmid pAX01-lacZ (the construction process is shown in Science Advance. 2023, 9 (39): eadg9733, the lacZ gene of Escherichia coli MG1655 is located at the BamHI site of pAX01).

[0031] like Figure 1 As described, some embodiments insert a variety of different promoters with a promoter function into pAX01-lacZ to activate the lacZ gene. These promoters include PilvA (SEQ ID NO.3), PargC (SEQ ID NO.6), PacsA (SEQ ID NO.9), PilvB (SEQ ID NO.12), PbcaP (SEQ ID NO.15), and PsrfAA (SEQ ID NO.18). PilvA is the promoter of the gene encoding threonine dehydratase, a key enzyme in the isoleucine metabolic pathway. PargC is the promoter of the gene encoding N-acetyl-γ-glutamyl-phosphate reductase in arginine biosynthesis. AcsA is the promoter of the gene encoding acetyl-CoA synthetase in acetate utilization. PilvB is the promoter of the gene encoding acetolactate synthase in branched-chain amino acid biosynthesis. PbcaP is the promoter of the gene encoding the amino acid transporter in the absorption of ammonia by branched-chain amino acids. PsrfAA is the promoter of the gene encoding the surfactin synthase operon.

[0032] Taking pAX01-PilvA-lacZ (pAX01-lacZ with PilvA inserted) as an example, the construction process of the intermediate plasmid includes:

[0033] 1. PCR

[0034] In one embodiment, the genome of Bacillus subtilis 168 (BGSC Bacillus Collection Center, USA) is used as a template, and the primer pair PilvA-XhoI-F:ACGTC CTCGAG caattggctccttttggttc, SEQ ID NO.4, the underline is the XhoI restriction site; PilvA-BcuI-R: ATATC ACTAGTTTGGACCATTTGTCATgtacagattcctttcttg, underlined for BcuI restriction site, SEQ ID NO.5; PCR amplification of PilvA to obtain PilvA fragment. The PCR reaction system contains 20 μL 1.1×S4 Fidelity PCRmix (Cat. No.-Specification: SF212-5×1.125mL, Beijing Genes and Biotech), 1 μL 10 μM PilvA-F, 1 μL 10 μM PilvA-R, 2 μL template and the remainder of double distilled water. The PCR amplification system includes: pre-denaturation at 98°C for 3min, denaturation at 98°C for 15s, annealing at 60°C for 15s, extension at 72°C for 10-15s / kb, and final extension at 72°C for 3min. After PCR is completed, DNA electrophoresis is performed for verification, and DNA is recovered to obtain PilvA fragment after verification is correct.

[0035] 2. Enzyme Digestion and Ligation

[0036] The PilvA fragment and plasmid pAX01-lacZ were digested separately and digested in a water bath at 37°C for 1 hour. The PilvA fragment digestion reaction system contained 10μL PilvA, 3μL FastDigest Greenbuffer (Cat. No.-Specification: B72-5×1ml, Thermo Scientific), 1μL FastDigestXhoI (Cat. No.-Specification: FD0694-400 reactions, Thermo Scientific), 1μL FastDigest BcuI (Cat. No.-Specification: FD1254-50 reactions, ThermoScientific) and the balance of double distilled water in 30μL. The pAX01-lacZ digestion reaction system contained 5μL pAX01-lacZ, 3μL FastDigest Greenbuffer, 1μL FastDigestXhoI, 1μL FastDigest BcuI and the balance of double distilled water in 30μL.

[0037] The digested product was verified by DNA electrophoresis, and after verification, DNA gel recovery was performed to obtain the digested PilvA fragment and the digested plasmid pAX01-lacZ.

[0038] The digested PilvA fragment was ligated with the digested plasmid pAX01-lacZ using T4 ligase for 2 hours. The ligation reaction system contained 6.5 μL PilvA, 1 μL FastDigest XhoI, 2 μL pAX01-lacZ, 1 μL T4 buffer (Cat. No. - Specification: B69-1.5mL, Thermo Scientific), 0.5 μL T4 ligase (Cat. No. - Specification: EL0011-1,000 units, Thermo Scientific) and the balance double distilled water in 10 μL.

[0039] 3. Transformation and screening

[0040] The enzyme-linked product was directly transformed into competent Escherichia coli DH5α, and positive clones were screened using ampicillin (100 μg / mL) and X-gal (5-bromo-4-chloro-3-indolyl-β-D-galactoside) resistance plates. Positive clones were verified using colony PCR (lacZ-check-F and lacZ-check-R). The intermediate plasmid pAX01-PilvA-lacZ was extracted and recovered from the culture medium of the verified positive clones.

[0041] In the embodiment, promoter PilvA (SEQ ID NO.3), PargC (SEQ ID NO.6), PacsA (SEQ ID NO.9), PilvB (SEQ ID NO.12), PbcaP (SEQ ID NO.15), PsrfAA (SEQ ID NO.18) fragments were synthesized, and the synthesis process was referred to the PilvA fragment. PargC, PacsA, PilvB, PsrfAA and PbcaP fragments were inserted into pAX01-lacZ respectively by the same method as above, and intermediate plasmids pAX01-PargC-lacZ, pAX01-PacsA-lacZ, pAX01-PilvB-lacZ, pAX01-PsrfAA-lacZ and pAX01-PbcaP-lacZ were obtained respectively. Among them, the primer sequences involved are PilvA-XhoI-F (SEQ ID NO.4) and PilvA-BcuI-R (SEQ ID NO.5), PargC-XhoI-F (SEQ ID NO.7) and PargC-BcuI-R (SEQ ID NO.8), PacsA-XhoI-F (SEQ ID NO.10) and PacsA-BcuI-R (SEQID NO.11), PilvB-XhoI-F (SEQ ID NO.13) and PilvB-BcuI-R (SEQ ID NO.14), PbcaP-XhoI-F (SEQ ID NO.16) and PbcaP-BcuI-R (SEQ ID NO.17), PsrfAA-XhoI-F (SEQ ID NO.19) and PsrfAA-BcuI-R (SEQ ID NO.20), as specifically shown in the sequence table.

[0042] Gene Editing Plasmids

[0043] The embodiment discloses a gene editing plasmid. The gene editing plasmid has: a first homology arm; a second homology arm; a first resistance gene located between the first homology arm and the second homology arm; and a second resistance gene and a replication initiation region located downstream of the second homology arm. The length of the first homology arm is selected from any length in the range of 600 to 1500 bp, the length of the second homology arm is selected from any length in the range of 600 to 1500 bp, and the lacA gene number is Gene ID: 936313.

[0044] In some embodiments, the length of the first homology arm is selected from 700bp, 800bp, 900bp, 1000bp, 1100bp, 1200bp, 1300bp, 1400bp, 1500bp.

[0045] In some embodiments, the length of the second homology arm is selected from 700bp, 800bp, 900bp, 1000bp, 1100bp, 1200bp, 1300bp, 1400bp, 1500bp.

[0046] In some embodiments, the gene editing plasmid is a plasmid in which the lacA homology arm of the intermediate plasmid is extended, for example, the plasmids in which the lacA homology arms of pAX01-PilvA-lacZ, pAX01-PargC-lacZ, pAX01-PacsA-lacZ, pAX01-PilvB-lacZ, pAX01-PsrfAA-lacZ and pAX01-PbcaP-lacZ are respectively extended are the gene editing plasmids pZDlacA, pZDlacA-PargC, pZDlacA-PacsA, pZDlacA-PilvB, pZDlacA-PbcaP, pZDlacA-PsrfAA.

[0047] Taking the pAX01-PilvA-lacZ plasmid in which the first homology arm and the second homology arm are respectively extended as an example, the construction method thereof includes:

[0048] 1. PCR

[0049] Using the genome of Bacillus subtilis 168 as a template, primer pair UP-F (SEQ ID NO.21) and UP-R (SEQ ID NO.22) were used for PCR amplification to obtain the first homology arm (SEQ ID NO.23). Using the genome of Bacillus subtilis 168 as a template, primer pair DOWN-F (SEQ ID NO.24) and DOWN-R (SEQ ID NO.25) were used for PCR amplification to obtain the second homology arm (SEQ ID NO.26). The PCR reaction system and reaction procedure were the same as above.

[0050] Using pAX01-PilvA-lacZ plasmid as template, primer pair PilvA lacZ-F (SEQ ID NO.27) and PilvAlacZ-R (SEQ ID NO.28) were used for PCR amplification to obtain fragment 1 (PilvA-lacZ-erm R , SEQ ID NO.29); PCR amplification was performed with primer pair amp up F (SEQ ID NO.30) and amp down R (SEQ ID NO.31) to obtain fragment 2 (ori-amp R , SEQ ID NO.32). The PCR reaction system and reaction procedure were the same as above.

[0051] After PCR was completed, DNA electrophoresis was performed to verify that the DNA was correct. After verification, DNA was recovered to obtain the first homology arm, the second homology arm, PilvA-lacZ-erm R and ori-amp R Four fragments.

[0052] 2. Gibson assembly

[0053] The first homology arm, the second homology arm, PilvA-lacZ-erm R , and ori-amp R The four fragments were ligated at 50°C for 45 min. The ligation reaction system contained 0.03 pmol of the first homology arm, 0.03 pmol of the second homology arm, 0.03 pmol of PilvA-lacZ-erm R , 0.03 pmol ori-amp R , 5 μL 2×MultiF Seamless Assembly (Cat. No. - Specification: RK21020-500 μL) and the balance double distilled water.

[0054] The enzyme-linked product was directly transformed into competent Escherichia coli DH5α, and positive clones were screened using ampicillin (100 μg / mL) and X-gal (5-bromo-4-chloro-3-indolyl-β-D-galactoside) resistance plates. The positive clones were verified by colony PCR (F1: SEQ ID NO.33 and R1: SEQ ID NO.34; F2: SEQ ID NO.35 and R2: SEQ ID NO.36). The intermediate plasmid pAX01-PilvA-lacZ was extracted and recovered from the culture fluid of the verified positive clones.

[0055] After successful sequencing, the plasmid was stored at -20°C. The complete sequence of the pZDlacA plasmid (SEQ ID NO.37) is shown in the sequence table. The maps of the original plasmid pAX01, the recombinant plasmid pAX01-PilvA-lacZ in the present invention, and the plasmid pZDlacA are shown in Figure 3 shown.

[0056] Editing efficiency of gene editing plasmids

[0057] In some test cases, gene editing plasmids pZDlacA, pZDlacA-PargC, pZDlacA-PacsA, pZDlacA-PilvB, pZDlacA-PbcaP, and pZDlacA-PsrfAA were respectively transferred into Bacillus subtilis to test their editing efficiency. Specifically, these test processes include:

[0058] 1. Linearize gene editing plasmid

[0059] The gene editing plasmid was digested with BsaI or NarI to obtain a linearized gene editing plasmid. The digestion reaction system contained 20 μL pZDlacA, 3 μL FastDigest Green buffer, 1 μL BsaI or NarI, and the balance double distilled water in 30 μL.

[0060] 2. Conversion

[0061] A fresh single colony of wild-type Bacillus subtilis 168 was inoculated into 2 mL MC medium (see Cell Syst. 4(3):291-305(2017) for ingredients) and cultured overnight at 37°C with a constant temperature air bath shaker at 200 rpm. The next day, the colony was transferred to competence medium (see Cell Syst. 4(3):291-305(2017) for an initial OD of 1. 600 0.1; 37°C, 200 rpm shaking incubator until OD 600 When the p value reached 1.5, 120 μL of bacterial solution was taken into a 1.5 mL sterile centrifuge tube, and 10 μL of linearized gene editing plasmid was added. The bacterial solution was incubated at 37°C and 200 rpm in a shaking incubator for 2 h, and then coated on an LB plate containing erythromycin (2 mg / mL) resistance to screen positive transformants.

[0062] 2. Colony PCR

[0063] like Figure 5 As shown, the positive transformants screened on the LB plate are further verified by colony PCR. Primers are designed for the upstream and downstream homology arms of lacA and primers are designed for lacZ between the two to verify the positive clones. For example, detection primers P1 (SEQ ID NO.38) and P2 (SEQ ID NO.39) are designed for the upstream homology arm of lacA, and PCR amplification is performed using the positive transformants screened on the LB plate as templates, and the amplified products are detected by electrophoresis. Detection primers P3 (SEQ ID NO.40) and P4 (SEQ ID NO.41) are designed for the downstream homology arm of lacA, and PCR amplification is performed using the positive transformants screened on the LB plate as templates, and the amplified products are detected by electrophoresis.

[0064] If the target band of 1220 bp is amplified using P1 and P2 as primer pair, and the target band of 1211 bp is amplified using P3 and P4 as primer pair, then the colony is a positive clone. The positive rate is equal to the ratio of the number of colonies with PCR bands consistent with the expected size / the total number of single colonies in PCR.

[0065] Figure 6The colony PCR verification results of the pAX01 series plasmids after transformation are shown.

[0066] Figure 6 Lanes 1 to 15 in A represent single colonies No. 1 to 15 transformed with pAX01-PargC-lacZ, and only single colony No. 14 was detected as a positive clone.

[0067] Figure 6 Lanes 1 to 15 in B represent single colonies No. 1 to 15 transformed with pAX01-PacsA-lacZ, and only single colony No. 14 was detected as a positive clone.

[0068] Figure 6 Lanes 1 to 10 in C are the upstream of single colonies No. 1 to 10 transformed with pAX01-PilvB-lacZ, and lanes 12 to 21 are the downstream. As a result, positive clones were detected from single colonies No. 3 (14), No. 5 (16), No. 6 (17), No. 9 (20), and No. 10 (21).

[0069] Figure 6 Lanes 1 to 9 in D are the upstream of single colonies No. 1 to 9 transformed with pAX01-PbcaP-lacZ, and lanes 11 to 19 are the downstream. As a result, only single colony No. 8 (18) was detected as a positive clone.

[0070] From the above results, it can be seen that the positive rate of pAX01 series plasmids after transformation is generally very low, usually only about 5-15%.

[0071] Figure 7 The colony PCR verification results of Bacillus subtilis 168 transformed with pZDlacA series plasmids are shown.

[0072] Figure 7 Lanes 1 to 20 in A represent single colonies No. 1 to 20 transformed with pZDlacA-PargC. As a result, only single colonies No. 10 and No. 12 were not detected as positive clones.

[0073] Figure 7 Lanes 1 to 20 in B represent single colonies No. 1 to 20 transformed with pZDlacA-PacsA, and all positive clones were detected.

[0074] Figure 7 Lanes 1 to 20 in C represent single colonies No. 1 to 20 transformed with pZDlacA-PilvB, and all positive clones were detected.

[0075] Figure 7 Lanes 1 to 20 in D represent single colonies No. 1 to 20 transformed with pZDlacA-Pbcap, and only single colonies No. 5, No. 18, and No. 19 were not detected as positive clones.

[0076] Figure 7 The colony PCR verification results of single colonies of Bacillus subtilis 168 transformed with pZDlacA series plasmids showed a positive rate of more than 85%. 3. Genomic PCR and detection editing efficiency

[0077] Since Bacillus subtilis is a Gram-positive bacterium with a thick cell wall, colony PCR is sometimes not successful; in addition, colony PCR may produce false positives, so it is necessary to extract genomic DNA for genome verification. After each plasmid transformation, 4-6 transformants were selected for overnight culture and genomic DNA was extracted, and the genome was used as a template for further PCR verification.

[0078] Furthermore, PCR amplification was performed using P1 and P2, P3 and P4, P5 (SEQ ID NO.42) and P6 (SEQ ID NO.43) as primer pairs, respectively, and the extracted bacterial colony genomic DNA as a template, and the amplified products were detected by electrophoresis to verify whether lacZ was integrated into the lacA position of the chromosome.

[0079] like Figure 8 As shown, the expected upstream bands can be detected in the transformant colonies of lanes 3 and 4, the expected downstream bands can be detected in the transformant colonies of lanes 7 and 8, and the expected lacZ bands can be detected in the transformant colonies of lanes 11 and 12. This indicates that lacZ was edited and integrated into the lacA site of the Bacillus subtilis 168 genome.

[0080] Fig. 9 Lanes 1 to 6 in A are the upstream of 6 single colonies transformed with pZDlacA-PargC, lanes 8 to 13 are the downstream, and lanes 15 to 20 are lacZ, and positive clones were detected in the genome.

[0081] Fig. 9 Lanes 1 to 6 in B are the upstream of 6 single colonies transformed with pZDlacA-PacsA, lanes 8 to 13 are the downstream, and lanes 15 to 20 are lacZ, and positive clones were detected in the genome.

[0082] Fig. 9 Lanes 1 to 4 in C are respectively the upstream of four single colonies transformed with pZDlacA-PilvB, lanes 5 to 8 are the downstream, and lanes 9 to 12 are lacZ, and positive clones were detected in the genome.

[0083] Fig. 9 Lanes 1 to 4 in D are respectively the upstream of four single colonies transformed with pZDlacA-PbcaP, lanes 5 to 8 are the downstream, and lanes 9 to 12 are lacZ, and positive clones were detected in all of them on the genome.

[0084] Combination Figure 6 to Figure 9 It can be seen that the editing positive rate of the pAX01 series is often only about 5-15%, while the editing positive rate of the pZDlacA series is significantly better than that of the pAX01 series, reaching 85% or even 100%.

[0085] Promoter transcription activity test

[0086] Some test examples also tested the transcriptional activity of the reporter gene lacZ driven by the promoters PargC, PacsA, PilvB, PbcaP, PilvA, and PsrfAA in single clones transformed with pZDlacA-PargC, pZDlacA-PacsA, pZDlacA-PilvB, pZDlacA-PbcaP, pZDlacA-PilvA, and pZDlacA-PsrfAA, respectively.

[0087] Test methods include:

[0088] The above-mentioned single clones that have been verified to be correct and transferred with different gene editing plasmids were activated in LB plus erythromycin (2 mg / mL), and then the lacZ transcription activity of their promoters under various culture conditions was determined. Among them, the culture method of the positive clones transferred with different gene editing plasmids includes: picking fresh single clones and inoculating them in 2mL LB plus erythromycin liquid culture medium, 37°C, 200rpm shaking culture as seed culture; taking the seed culture and centrifuging it at 12000rpm for 2min, removing the supernatant, resuspending the precipitate with sterile water, and transferring it to C-restricted culture medium (the main components refer to J Bacteriol 190:3557-3564 (2008), containing 20mM NH4Cl as a nitrogen source; the carbon source is 0.4% glucose or 0.4% glucose plus 0.4% casein hydrolysate) overnight culture as pre-culture. The next day, the pre-culture was inoculated in the same C-restricted culture medium to make its OD 600 The OD value of the bacteria in the exponential phase is about 0.02 to 0.03, which is called experimental culture. 600 , through data processing, the growth curve of bacteria is obtained and its growth rate is calculated.

[0089] Method for determining LacZ transcriptional activity:

[0090] During the exponential growth phase (OD 600=0.2-0.5), 3-4 samples of 0.5 mL were collected under each culture condition, quickly frozen in liquid nitrogen, and stored in a -80°C refrigerator. The activity of LacZ was determined at 37°C using a conventional ONPG assay method (see Nature. 2013, 500(7462):301-6). 0.5 mL of Z-buffer (Z-buffer contains 60 mM disodium hydrogen phosphate, 40 mM sodium dihydrogen phosphate, 10 mM KCl, 1 mM magnesium sulfate; and 27 μL of β-mercaptoethanol is added to 1 mL of Z-buffer) is added to the reaction tube, and 25 μL of 0.1% sodium dodecyl sulfate, 50 μL of chloroform, and 0.5 mL of sample are added to each reaction tube; the reaction tube is vortexed for 10 seconds in the first round and 20 seconds in the second round, and then incubated in a 37°C constant temperature water bath for 15 minutes; 200 μL of 4 mg / mL ONPG is added to each reaction tube, vortexed to mix, and the reaction start time is recorded; the reactants are observed until a distinct yellow color appears, and 0.5 mL of 1 M sodium carbonate is added to terminate the reaction, and the reaction termination time is recorded; finally, the reaction solution is centrifuged at 12000 rpm for 10 minutes, and the OD is measured using a spectrophotometer 420 The activity obtained (unit: U / mL = OD 420 / min / mL) and the corresponding OD 600 The ratio is the "LacZ expression level" (unit: U / ml / OD 600 , or “Miller Units” or “MU”). Each culture condition had at least three biological replicates.

[0091] The results are as follows Fig.10 As shown, the positive clones of the lacZ reporter gene driven by six different promoters can detect lacZ activity under three culture conditions. This shows that the gene editing plasmid provided in the embodiment of the present application can successfully edit and integrate lacZ into the chromosome of Bacillus subtilis, and stably express it. At the same time, lacA, as the β-galactosidase of Bacillus subtilis, has background activity, because the promoter and the lacZ reporter gene are fused and edited to the lacA site, which destroys the open reading frame of lacA, thereby avoiding the interference of lacA with the detection of the lacZ reporter gene.

[0092] The above is only a preferred specific implementation of the present application, but the protection scope of the present application is not limited thereto. Any changes or substitutions that can be easily conceived by any technician familiar with the technical field within the technical scope disclosed in the present application should be covered within the protection scope of the present application.

Claims

1. A gene editing plasmid of Bacillus subtilis, the nucleotide sequence of which is shown in SEQ ID NO:

37.

2. A gene editing kit for Bacillus subtilis, comprising the gene editing plasmid as described in claim 1.

3. A gene editing method for Bacillus subtilis, comprising: Transforming the gene editing plasmid as claimed in claim 1 into Bacillus subtilis; The positive transformants whose exogenous genes were edited into the lacA gene site were harvested.

4. Use of the gene editing plasmid as claimed in claim 1 in constructing an engineered strain of Bacillus subtilis.

Images