A molecular marker method for predicting chicken abdominal fat content using SPG20 gene and its application

Abstract

The present invention discloses a molecular marker method and application thereof for predicting the abdominal fat content of chickens using the SPG20 gene, and belongs to the technical field of animal molecular genetics. The purpose of the present invention is to provide a molecular marker for breeding low-abdominal-fat broilers. The present invention designs primers according to the upstream 74bp and downstream 282bp sequences of the chicken SPG20 gene mutation site c.-7731_-7732insGATG, performs PCR amplification using chicken genomic DNA as a template, and performs electrophoresis on the amplified product to obtain the genotype. The corresponding relationship between the genotype and the abdominal fat content of the chicken is determined by correlation analysis, the marker genotype corresponding to the different abdominal fat contents of the chicken is determined, and the abdominal fat content of the sample chicken to be tested is determined according to the marker genotype. The present invention is simple to operate, low in cost, high in accuracy, and can be automatically detected. It is an effective molecular marker breeding method. The method can be used to accelerate the breeding process of chickens and cultivate broilers with low abdominal fat content suitable for market demand, thereby obtaining better economic benefits. The method described in the present invention can be applied to the field of chicken genetic breeding.

Description

Technical Field

[0001] The invention belongs to the technical field of animal molecular genetics, and in particular relates to a molecular marker method for predicting chicken abdominal fat content by using SPG20 gene and application thereof. Background Art

[0002] Chicken is the second most consumed meat in my country after pork. After more than half a century of artificial selection, the growth rate and meat production of broilers have been significantly improved. However, the increase in broiler growth rate has brought many negative effects to the broiler industry, such as excessive deposition of body fat (especially abdominal fat) and decreased immune function. Among them, excessive deposition of abdominal fat has attracted widespread attention. Abdominal fat deposition can lead to many adverse effects, not only reducing egg production rate, fertilization rate, hatching rate, feed conversion efficiency and slaughter rate, but also increasing the incidence and mortality of metabolic diseases in broilers, thereby causing huge economic losses to the broiler industry. Therefore, breeding low-fat broilers is a major issue that needs to be studied and solved in broiler breeding. The abdominal fat trait is a slaughter trait. The conventional breeding method is not only time-consuming and labor-intensive, but also expensive, while marker-assisted selection (MAS) is an effective method for selecting target traits. By identifying molecular markers that significantly affect the target trait and selecting individuals carrying favorable marker genotypes as breeding materials, the target traits of the offspring can be effectively improved. Summary of the invention

[0003] The invention discloses a molecular marker method for predicting the abdominal fat content of chickens by using the SPG20 gene and application thereof. The abdominal fat content of chickens can be determined by genotype, thereby rapidly breeding low-fat broilers.

[0004] The technical solution of the present invention is as follows:

[0005] A molecular marker method for predicting chicken abdominal fat content using the SPG20 gene, characterized in that the method comprises the following steps:

[0006] Step 1: Design primers SPG20-F and SPG20-R according to the upstream 74bp and downstream 282bp sequences of the insertion mutation site c.-7731_-7732insGATG of the chicken SPG20 gene to obtain amplification primers;

[0007] Step 2: using the amplification primers obtained in step 1 to perform PCR amplification of chicken genomic DNA to obtain an amplification product;

[0008] Step 3: Perform agarose gel electrophoresis using the amplified product obtained in step 2 to identify the amplified fragment;

[0009] Step 4: Perform non-denaturing polyacrylamide gel electrophoresis using the amplified product obtained in step 2 to obtain the genotype;

[0010] Step 5: Determine the corresponding relationship between the genotype and the abdominal fat content of the chicken through correlation analysis to obtain the marker genotype;

[0011] Step 6: Compare the genotype result of the sample chicken to be tested with the marker genotype described in step 5 to determine the abdominal fat content of the sample chicken to be tested.

[0012] Furthermore, the nucleotide sequence of the primer SPG20-F in step 1 is shown as SEQ ID NO.1, and the nucleotide sequence of the primer SPG20-R is shown as SEQ ID NO.2.

[0013] Furthermore, the concentration of agarose gel in agarose gel electrophoresis in step 3 is 1.5%.

[0014] Furthermore, the concentration of the non-denaturing polyacrylamide gel used in the non-denaturing polyacrylamide gel electrophoresis in step 4 is 14%.

[0015] Furthermore, the genotype in step 4 is as follows: if the electrophoresis band presents one band with a size of 215bp, the site of the molecular marker is a homozygous GATG sequence deletion, which is named DD genotype; if the electrophoresis band presents two bands with sizes of 215bp and 219bp, the site of the molecular marker is a heterozygous GATG sequence insertion or deletion, which is named ID genotype.

[0016] Furthermore, the marker genotypes in step 5 are DD genotype and ID genotype; the trait corresponding to the DD genotype is low abdominal fat content in chickens, and the trait corresponding to the ID genotype is high abdominal fat content in chickens.

[0017] Furthermore, the abdominal fat content includes the abdominal fat weight and abdominal fat rate of the chicken.

[0018] The invention relates to the application of chicken marker genotype obtained by the molecular marker method in chicken genetic breeding.

[0019] Beneficial Effects

[0020] The present invention proves that the effects of two genotypes of the chicken SPG20 gene mutation site c.-7731_-7732insGATG on abdominal fat weight and abdominal fat rate reach a significant level (P<0.05), indicating that the chicken SPG20 gene mutation site c.-7731_-7732insGATG is a molecular marker that affects the growth and development of chicken abdominal fat. The molecular marker of the present invention can be used to select the abdominal fat weight and abdominal fat rate of chickens with one marker, and an effective, simple and easy molecular marker breeding method is provided for improving the abdominal fat traits of chickens. The method of the present invention is simple to operate, low in cost, and high in accuracy, and can be automatically detected to efficiently and accurately identify broilers with low abdominal fat. The molecular marker method of the present invention can be used to select the abdominal fat content of chickens with one molecular marker, and an effective molecular marker is provided for improving the abdominal fat content of chickens, and broilers with low abdominal fat content that meet market demand are cultivated, thereby obtaining better economic benefits and accelerating the breeding process of broilers. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 It is the agarose gel electrophoresis diagram of the PCR amplification product of the SPG20 gene mutation site c.-7731_-7732insGATG;

[0022] Figure 2 This is the non-denaturing polyacrylamide gel electrophoresis diagram of the PCR amplification product of the SPG20 gene mutation site c.-7731_-7732insGATG. DETAILED DESCRIPTION

[0023] The reagents, instruments, equipment, and experiments involved in the present invention are described as follows:

[0024] 1. Experimental animals and trait determination

[0025] A total of 426 male and female chickens from the Northeast Agricultural University F2 population (constructed by hybridization of AA roosters and white-eared chickens) were collected. Blood was collected from the wing vein at 12 weeks of age and anticoagulated with EDTA-Na2. The live weight was measured before slaughter at 12 weeks of age, and the abdominal fat weight was measured after slaughter. The weight traits were divided by the live weight at 12 weeks of age to calculate the corresponding weight ratio.

[0026] 2. Medicines

[0027] TaKaRa Ex Premier TMDNA Polymerase was purchased from Bio-Rad Biotechnology (Beijing) Co., Ltd.; 30% acrylamide and TEMED were purchased from Bio-Technology Co., Ltd.; Tris was purchased from Sigma Chemicals Co.; 6× loading buffer and DNA Marker were purchased from Quanshijin Company; Tris saturated phenol was purchased from Beijing Dingguo Biotechnology Development Center; agarose was purchased from Yuanpinghao Company; 10000× SuperRed nucleic acid dye was purchased from Zhuangmeng Company; blood / cell / tissue genomic DNA extraction kit was purchased from Beijing Tiangen Technology Biochemical Co., Ltd.

[0028] 3. Main instruments and equipment

[0029] PCR instrument and micropipette were purchased from Eppendorf, Germany; electronic scale ACS-30 was purchased from Shanghai Huade Company; -20℃ / 4℃ refrigerator was purchased from Qingdao Haier Company; -80℃ refrigerator was purchased from Froma Company, USA; electronic constant temperature water bath was purchased from Shanghai Yiheng Technology Co., Ltd.; electrophoresis instrument and electrophoresis tank were purchased from Beijing Liuyi Instrument Factory; electronic balance was purchased from Mettler-Toledo Instrument (Shanghai) Co., Ltd.; vertical plate electrophoresis tank was purchased from Beijing Oriental Special Power Co., Ltd.; gel imaging system was purchased from UVP Company, USA; ultrapure water instrument was purchased from Milli-Q Company, USA; ultraviolet spectrophotometer was purchased from Phamacia Company, USA; high-pressure steam sterilizer was purchased from SANYO Company, Japan; and ultra-clean bench was purchased from Suzhou Purification Equipment Co., Ltd.

[0030] 4. Preparation of buffer and common reagents

[0031] 1×TAE buffer: weigh 242 g Tris and 37.2 g Na2EDTA·2H2O (disodium ethylenediaminetetraacetate dihydrate) into a beaker, add about 600 mL of deionized water, stir thoroughly to dissolve, add 57.1 mL of acetic acid, stir thoroughly, dilute the solution to 1 L, and store at room temperature.

[0032] 10×TBE buffer: weigh 108 g Tris, 7.44 g Na2EDTA·2H2O (disodium ethylenediaminetetraacetate dihydrate), and 55 g boric acid into a beaker, add 800 mL of deionized water, stir thoroughly to dissolve, add deionized water to make up to 1 L, and store at room temperature.

[0033] 10% ammonium persulfate: Weigh 1 g of ammonium persulfate into a beaker, add 10 mL of deionized water to dissolve, and store in a refrigerator at 4°C.

[0034] Silver staining solution: weigh 0.5 g AgNO3, add 100 mL of deionized water and stir thoroughly to dissolve, add deionized water to make up to 500 mL, and store in a 4°C refrigerator away from light.

[0035] Color developing solution: Weigh 3.25 g NaOH and place it in a beaker. Add 100 mL of deionized water and 2.5 mL of formaldehyde. Stir thoroughly to dissolve. Add deionized water to make up to 250 mL.

[0036] Example 1

[0037] 1. Primer design and synthesis:

[0038] Primers were designed based on the upstream 74bp and downstream 282bp sequences of the chicken SPG20 gene c.-7731_-7732insGATG (the variation starts from the A base of 173985509bp of chicken chromosome 1, corresponding to the chicken genome sequence of version 6 GRCg6a: NC_006088.5: 173993239) and synthesized by Anshengda Technology Co., Ltd. The primer sequences are as follows:

[0039] SPG20-F:5'-CGCTTTGTGGTAAGTGTCTG-3' (SEQ ID NO.1);

[0040] SPG20-R:5'-ATAGCTTGTCTTGTGGGAG-3' (SEQ ID NO.2);

[0041] The sequence information of the upstream 74bp and downstream 282bp of the chicken SPG20 gene c.-7731_-7732insGATG is as follows (the inserted fragment is in brackets):

[0042] AGTGCTTACATCCACTTCCTGCAGCTACAATTCGCTTTGTGGTAAGTGTCTGATATGGCAGAGCAGCATCTGCA(GATG)CAGATGGAGACTTTGTCACAGTGGATGTGCCTACGTGTTTCTGATAACTGAGAACATGCAGCCAGGTGGCCTTGATGTGCATCTGCACTGTTCATCCCCCTCT CACTGATGATGATGCCGTGTCTTGACCAATTTTTGGCCTAACAAGGGCAGCTCCCACAAGACAAGCTATTTCTATATGAGGGGAGGGGCAGGTGTGGGCCAGGGCCAGGTTCTGCACCATAGGGTGCATGGAACAGGCTGCCCAGGGCAAGGCAGTGGGCATGGCCCTGAGCTGCCAG(SEQ IDNO.3).

[0043] 2. Use the amplification primers obtained in step 1 to perform PCR amplification of chicken genomic DNA to obtain an amplification product:

[0044] 1) Extraction of chicken DNA

[0045] The blood / cell / tissue genomic DNA extraction kit (DP304) was used to extract the genome. The specific steps are as follows:

[0046] (1) Take 20 μL of anticoagulated blood, add 180 μL of buffer GA, add 20 μL of proteinase K, and mix well;

[0047] (2) Add 200 μL of buffer GB, invert thoroughly, place at 70°C for 10 min, and briefly centrifuge to remove water droplets on the inner wall of the tube cap;

[0048] (3) Add 200 μL of anhydrous ethanol and vortex thoroughly for 15 seconds. Flocculent precipitation may appear at this time. Centrifuge briefly to remove water droplets on the inner wall of the tube cap.

[0049] (4) Add the obtained solution and flocculent precipitate to the adsorption column CB3 (the adsorption column is placed in the collection tube), centrifuge at 12,000 rpm for 30 seconds, discard the waste liquid, and place the adsorption column CB3 back into the collection tube;

[0050] (5) Add 500 μL of buffer GD to the adsorption column CB3 (check whether anhydrous ethanol has been added before use), centrifuge at 12,000 rpm for 30 seconds, discard the waste liquid, and return the adsorption column CB3 to the collection tube;

[0051] (6) Add 600 μL of rinse solution PW to the adsorption column CB3 (check whether anhydrous ethanol has been added before use), centrifuge at 12,000 rpm for 30 seconds, discard the waste liquid, and return the adsorption column CB3 to the collection tube;

[0052] (7) Repeat step (6);

[0053] (8) Place the adsorption column CB3 back into the collection tube and centrifuge at 12,000 rpm for 2 min to discard the waste liquid. Place the adsorption column CB3 at room temperature for several minutes to completely dry the residual rinse liquid in the adsorption material.

[0054] (9) Transfer the adsorption column CB3 to a clean centrifuge tube, add 50 μL of elution solution TE to the middle part of the adsorption membrane, let it stand at room temperature for 5 min, centrifuge at 12,000 rpm for 2 min, and collect the solution in the centrifuge tube.

[0055] 2) PCR amplification reaction system

[0056] The chicken DNA obtained above was used as a template for PCR amplification, and the reaction system contained the following solutions or reagents:

[0057]

[0058] The above solutions were mixed and PCR reaction was carried out under the following conditions: denaturation at 94°C for 1 min; 98°C for 10 sec, 52.6°C for 15 sec, 68°C for 30 sec, 30 cycles; extension at 68°C for 5 min to obtain the amplified product.

[0059] 3. Perform agarose gel electrophoresis on the amplified product obtained in step 2:

[0060] 1) Prepare 1.5% agarose gel; weigh 0.75 g agarose and place it in a conical flask, add 50 ml 1×TAE, add 10 ul 10000×SuperRed nucleic acid dye, heat in a microwave oven until the agarose is completely melted, shake well and set aside;

[0061] 2) Preparation of gel plate: Wash the organic glass gel tank in the electrophoresis tank, put the gel glass plate in it after drying, seal the glass plate and the edges of the gel tank with transparent tape, and place the comb in a fixed position. Mix the 1.5% agarose gel solution cooled to about 65°C and carefully pour it into the gel tank, scraping away the bubbles. After the gel cools down, remove the tape, and put the gel and gel tank into the electrophoresis tank with 1×TAE electrophoresis buffer added;

[0062] 3) Sample loading: Mix the amplified product obtained in step 2 with 2 μL 6× loading buffer, and apply 10 μL of the mixture to the sample wells of the gel plate. Replace the sample tip after each sample is applied to prevent contamination. Do not damage the gel surface around the sample wells when applying the sample. Apply DNA marker and negative control on the left side of the gel.

[0063] 4) Electrophoresis: After adding the sample, the gel plate is immediately powered on for electrophoresis at a voltage of 60V-100V. The sample moves from the negative electrode to the positive electrode. The electrophoresis is stopped when the bromophenol blue moves to about 1 cm from the bottom edge of the gel plate.

[0064] 5) Observation and photography: Observe the corresponding DNA marker under ultraviolet light to see if the target band appears (such as Figure 1 shown);

[0065] 4. Perform non-denaturing polyacrylamide gel electrophoresis on the amplified product obtained in step 2:

[0066] 1) Preparation of non-denaturing polyacrylamide gel

[0067] (1) Prepare a 14% non-denaturing polyacrylamide gel using the following solutions or reagents:

[0068]

[0069]

[0070] (2) Glue filling

[0071] ① Place the sealed glass plates at an angle of 30° on the tabletop (with the pouring port on top), quickly shake the gel solution and slowly pour it into the two glass plates until they are full, taking care not to generate bubbles;

[0072] ② Insert the comb immediately after the glue is poured. The comb should be inserted straight, with the top slightly higher than the top of the glass plate, so that it is easy to pull out after the glue is solidified. Be careful not to leave any bubbles at the bottom of the comb;

[0073] ③ The gel will polymerize at room temperature for about 45 to 60 minutes. Lines with different color refraction rates will appear on the gel at the bottom of the comb, indicating that the gel polymerization is complete. When pulling up the comb, use both hands to apply force evenly to ensure that the sample well is straight. If you want to shorten the gel polymerization time, you can add more ammonium persulfate and TEMED, and the amount can be controlled by yourself;

[0074] ④ After pulling out the comb, rinse the sample well with distilled water to wash away excess unpolymerized acrylamide;

[0075] ⑤ Transfer the glass plate with gel to the electrophoresis tank and fix it with iron clamps;

[0076] ⑥ Pour 1×TBE buffer into the upper and lower tanks, and pay attention to whether there is leakage in the upper tank.

[0077] 2) Electrophoresis

[0078] (1) Pre-electrophoresis for 10 min and prepare sample spotting;

[0079] (2) Add 2 μL of 6× loading buffer to 10 μL of PCR product and mix well;

[0080] (3) The sample volume is 1 μL. Be sure to mark the order of spotting on the glass plate.

[0081] (4) Turn on the electrophoresis apparatus and perform electrophoresis at 120 V at 4°C for 23-24 h.

[0082] 3) Silver staining

[0083] (1) After electrophoresis, remove the glass plate, pry the edge of the glass plate with a surgical knife handle or other object, use a gasket to cut the sample wells flush, and cut off a corner on the side where the sample is to be added as a mark;

[0084] (2) Fix in 70% ethanol for 15 min;

[0085] (3) Wash twice with deionized water, 2 to 3 minutes each time;

[0086] (4) Add silver stain solution and stain for 15 minutes;

[0087] (5) Wash with deionized water 2 to 3 times, 2 to 3 minutes each time;

[0088] (6) Add color developing solution. After 10 minutes, when the electrophoresis bands become clear, rinse with deionized water and stop developing.

[0089] 4) Genotyping

[0090] If the band is one band with a size of 215bp, the site of the molecular marker is a homozygous GATG sequence deletion, which is named DD genotype; if the band is two bands with sizes of 215bp and 219bp, the site of the molecular marker is a heterozygous GATG sequence insertion / deletion, which is named ID genotype.

[0091] 5. Correlation analysis:

[0092] 1) Statistical model establishment

[0093] According to the characteristics of the F2 chicken population of Northeast Agricultural University, the following linear model was constructed:

[0094] Y=μ+S+G+F+D(F)+BW 12 +e

[0095] Y is the observed value of the trait, μ is the population mean, S is the sex fixed effect, G is the genotype fixed effect, F is the rooster random effect, D(F) is the hen random effect nested in the rooster, BW 12 As a covariate variable, e is the residual value. When Y is a ratio trait, BW is not included in the model 12 The significant threshold is 0.05, that is, when P < 0.05, it reaches a significant level.

[0096] 2) Correlation analysis between chicken SPG20 gene polymorphism and abdominal fat traits

[0097] The primers (SPG20-F and SPG20-R) of the present invention were used to perform PCR amplification on the genomic DNA of 426 broilers from the F2 population of Northeast Agricultural University, and then polymorphism analysis was performed on the variable site c.-7731_-7732insGATG. As a result, two genotypes were detected in the F2 population, namely, ID type and DD type (see Figure 2 The ones with deletion were recorded as DD type (homozygous for GATG sequence deletion), and those with insertion sequence were recorded as ID type (heterozygous for GATG sequence insertion / deletion).

[0098] The effects of the two genotypes of c.-7731_-7732insGATG on the abdominal fat traits of chickens were analyzed. The results of correlation analysis showed that the genotype of this site had a significant effect on the abdominal fat rate and abdominal fat weight (P<0.05) (Table 1). It can be seen that this site is an important molecular marker that affects the abdominal fat content of chickens. Further multiple comparison results showed that individuals with the DD genotype have the characteristics of low abdominal fat content, that is, the DD genotype is a favorable genotype, and the selection of individuals with the DD genotype for breeding will be able to improve the abdominal fat content. The molecular marker method of the present invention can be used to select the abdominal fat content of chickens, providing an effective, simple and easy molecular marker breeding method for improving the abdominal fat traits of chickens.

[0099] Table 1 Effect of SPG20 gene c.-7731_-7732insGATG site on chicken abdominal fat content (P value)

[0100]

[0101] Note: The least square means in the same row marked with ab indicate significant differences (P<0.05)

[0102] Although the present invention has been disclosed as above in the preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A molecular marker method for predicting chicken abdominal fat content using the SPG20 gene, characterized in that: The method comprises the following steps: Step 1: Design primers SPG20-F and SPG20-R according to the sequence SEQ ID NO.3 of the upstream 74bp and downstream 282bp of the insertion mutation site c.-7731_-7732insGATG of the chicken SPG20 gene to obtain amplification primers; the nucleotide sequence of primer SPG20-F is shown in SEQ ID NO.1, and the nucleotide sequence of primer SPG20-R is shown in SEQ ID NO.2; Step 2: using the amplification primers obtained in step 1 to perform PCR amplification of chicken genomic DNA to obtain an amplification product; Step 3: Perform agarose gel electrophoresis using the amplified product obtained in step 2 to identify the amplified fragment; Step 4: Perform non-denaturing polyacrylamide gel electrophoresis using the amplified product obtained in step 2 to obtain the genotype; if the electrophoresis band shows one band with a size of 215 bp, the site of the molecular marker is a homozygous GATG sequence deletion, which is named DD genotype; if the electrophoresis band shows two bands with sizes of 215 bp and 219 bp, the site of the molecular marker is a heterozygous GATG sequence insertion or deletion, which is named ID genotype; Step 5: Determine the corresponding relationship between the genotype and the abdominal fat content of the chicken by correlation analysis to obtain a marker genotype; the marker genotype is a DD genotype and an ID genotype; the trait corresponding to the DD genotype is low abdominal fat content in the chicken, and the trait corresponding to the ID genotype is high abdominal fat content in the chicken; Step 6: Compare the genotype result of the sample chicken to be tested with the marker genotype described in step 5 to determine the abdominal fat content of the sample chicken to be tested.

2. The method according to claim 1, characterized in that The concentration of agarose gel in agarose gel electrophoresis in step 3 is 1.5%.

3. The method according to claim 1, characterized in that The concentration of the non-denaturing polyacrylamide gel used in the non-denaturing polyacrylamide gel electrophoresis in step 4 is 14%.

4. The method according to claim 1, characterized in that: The abdominal fat content includes the abdominal fat weight and abdominal fat rate of the chicken.

5. Use of the molecular marker method according to any one of claims 1 to 4 in predicting the abdominal fat content of chickens.

Images