A molecular marker, primer set and application thereof for identifying Lentinula edodes LMYP62
By providing primer sets of SSR molecular markers and SCAR markers and combining with kits, the problem of identifying LMYP62 in shiitake strains was solved, and rapid and accurate screening was achieved, which significantly improved the efficiency of shiitake breeding.
Patent Information
- Application Number
- CN202410816917.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-06-24
- Publication Date
- 2025-01-17
- Estimated Expiration
- 2044-06-24
AI Technical Summary
The prior art cannot effectively identify the mushroom strain LMYP62, resulting in limited breeding work, traditional morphological methods have large errors and are time-consuming and labor-intensive, and lack of specific molecular markers.
A SSR molecular marker and its primer set are provided for identification of shiitake strain LMYP62, and a specific primer set is obtained by SCAR label transformation, combining a kit of 2×Taq Mix and ddHO to achieve rapid and accurate strain identification.
The screening cycle was shortened, from 2-3 weeks and 3 months of traditional methods to 2-3 hours, achieving a 100% accuracy rate, greatly improving the screening efficiency and having good specificity.
Smart Images
Figure CN118389742B_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the field of biotechnology, and more particularly to a molecular marker for identifying Lentinus edodes LMYP62, a primer set and an application thereof. Background Art
[0002] Lentinula edodes, also known as shiitake mushrooms and winter mushrooms, is the second largest edible mushroom in the world after Agaricus bisporus. Lentinula edodes is rich in nutrition, has a pleasant aroma, and is rich in active ingredients that can treat tumors and infections, such as sterols, lipids, polysaccharides and terpenoids. It has important food and medicinal value and is widely cultivated.
[0003] At present, there are more than 100 strains of shiitake mushrooms in China. The phenomenon of synonyms is relatively common, and the genetic background is narrow, which is not conducive to the further development of breeding. The existing variety identification methods are generally based on morphological methods, but most agronomic traits of shiitake mushrooms are quantitative traits with continuous variation, and their phenotypic traits are greatly affected by the environment. If the strains are identified only based on morphology, it is time-consuming and laborious, and the error is large.
[0004] With the development of molecular biology technology, especially the establishment of molecular markers and gene marker technology, a more convenient means for strain identification has been provided. The specific molecular marker SCAR (sequence characterized amplified regions) is generally transformed from markers such as RAPD, SRAP, SSR, etc. It is a very stable molecular marker that is fast, simple and low-cost in strain identification. Compared with the traditional method of conventional antagonism test which takes 2-3 weeks and mushroom test which takes 3 months, molecular detection only takes a few hours, which greatly improves the screening efficiency. However, there is currently no specific molecular marker for the detection of Lentinus edodes strain LMYP62.
[0005] Therefore, providing a molecular marker for identifying Lentinus edodes LMYP62 is an urgent problem to be solved by those skilled in the art. Summary of the invention
[0006] In view of this, the present invention provides a molecular marker, a primer set, a detection product and applications thereof for identifying Lentinus edodes LMYP62.
[0007] In order to achieve the above object, the present invention adopts the following technical solution:
[0008] An SSR molecular marker for identifying Lentinus edodes strain LMYP62, the nucleotide sequence of the molecular marker is shown as SEQ ID NO.3.
[0009] Another object of the present invention is to provide a primer set for amplifying the above-mentioned SSR molecular marker, the nucleotide sequence of the primer set is shown in SEQ ID NO.1 and SEQ ID NO.2.
[0010] Another object of the present invention is to provide a SCAR molecular marker for identifying the Lentinus edodes strain LMYP62, the nucleotide sequence of the molecular marker is shown in SEQ ID NO.6, and the SCAR molecular marker is transformed from the above-mentioned SSR molecular marker.
[0011] Another object of the present invention is to provide a primer set for amplifying the above-mentioned SCAR molecular marker, the nucleotide sequence of the primer set is shown in SEQ ID NO.4 and SEQ ID NO.5.
[0012] Another object of the present invention is to provide a product for identifying Lentinus edodes strain LMYP62, wherein the product is a reagent or a kit, and the reagent or the kit comprises the above-mentioned primer set.
[0013] As a preferred solution, the reagent or the kit further comprises 2× Taq Mix and ddH2O.
[0014] More preferably, the volume ratio of 2× Taq Mix, primer set, shiitake mushroom DNA template to be tested and ddH2O in the reaction system for identifying shiitake mushroom samples using the product is 10:1:1:1:7.
[0015] Another object of the present invention is to provide the use of the above molecular marker or the above primer set or the above product in identifying the Lentinus edodes strain LMYP62.
[0016] Another object of the present invention is to provide a method for identifying the shiitake mushroom strain LMYP62, by using the above-mentioned primer set or the above-mentioned product to amplify the shiitake mushroom sample to be tested, and the sample that can obtain the corresponding specific amplified fragment is the shiitake mushroom strain LMYP62.
[0017] As a preferred solution, the method for determining the corresponding specific amplified fragment is:
[0018] When the primer set shown in SEQ ID NO.1 and SEQ ID NO.2 is used for amplification, a specific amplified fragment appears at 271 bp after amplification by agarose gel detection; or the amplified specific fragment is recovered and sequenced, and the amplified sequence is consistent with the sequence of SEQ ID NO.3;
[0019] When amplification is performed using the primer set shown in SEQ ID NO.4 and SEQ ID NO.5, a specific amplified fragment appears at 171 bp after amplification by agarose gel detection; or the amplified specific fragment is recovered and sequenced, and the amplified sequence is consistent with the sequence of SEQ ID NO.6; or ethidium bromide is added to the PCR amplification reaction system, and then fluorescence is observed under ultraviolet light.
[0020] Beneficial effect: The present invention screened and obtained a molecular marker of a Lentinus edodes strain LMYP62 and its amplification primers. The Lentinus edodes samples to be tested were detected using the molecular markers and amplification primers, and the screening results could be quickly obtained. The screening period was shortened from 2-3 weeks for antagonism test and 3 months for fruiting test using the traditional method to 2-3 hours, with an accuracy rate of 100%, good specificity, and greatly improved screening efficiency. BRIEF DESCRIPTION OF THE DRAWINGS
[0021] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.
[0022] Figure 1 PAGE electrophoresis diagrams provided for the embodiments and comparative examples of the present invention; wherein A is the amplification map of the SSR molecular marker F1 / R1 of shiitake mushrooms; B is the specific amplification map of shiitake mushrooms after SSR is converted into SCAR using primers F3 / R3; C is the specific amplification map of shiitake mushrooms after SSR is converted into SCAR using primers F2 / R2; in the figure, M is Marker, and the gel wells after M correspond to the blank control CK1, the blank control CK2, and the shiitake mushroom strains No. 1-55 corresponding to the numbers in Table 1, respectively. DETAILED DESCRIPTION
[0023] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.
[0024] The embodiment of the present invention discloses a molecular marker primer set, a kit and an application thereof for identifying Lentinus edodes LMYP62. The Taq enzyme, DNA marker and pMD19T (simple) Vector used in the embodiment of the present invention were purchased from TaKaRa, and the genomic DNA extraction kit was purchased from Sangon Biotech (Shanghai) Co., Ltd.; primer synthesis and DNA sequencing analysis were completed by Sangon Biotech (Shanghai) Co., Ltd., which is only for illustrating the implementation process of the present invention and is not a limitation of the present invention.
[0025] Example 1
[0026] Table 1 Test strains of Lentinula edodes
[0027]
[0028] The shiitake mushroom strains in Table 1 above are all well-known in the art and have been screened and identified. There are no homonymous species and they are all preserved in this unit.
[0029] In the present invention, 55 strains of Lentinus edodes as shown in Table 1 were used as test materials, and a Lentinus edodes genomic DNA rapid extraction kit (Shanghai Biotech Co., Ltd.) was used to extract Lentinus edodes genomic DNA. The concentration and purity of the DNA were determined using a NanoDrop 2000 spectrophotometer (Thermo Scientific, USA), and the DNA sample concentration was diluted to 100 ng / µl.
[0030] Then, the 95 pairs of SSR primers designed were used to perform polymorphism amplification screening on the DNA samples, from which a pair of specific amplification primers (FI and R1) were obtained. The amplification results are shown in the attached Figure 1 Middle A.
[0031] F1: AAACGAAAACAGAGAGGCGA, SEQ ID NO.1;
[0032] R1: GTGGTGACATGTACGTTCGG, SEQ ID NO. 2.
[0033] PCR system: 2×Taq Mix 10 μl; 1 μl of each 10μM primer; 1μl of Lentinus edodes DNA, and the system was made up to 20μl with ddH2O.
[0034] PCR amplification program: pre-denaturation at 94°C for 4 min; denaturation at 94°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 60 s, for a total of 35 cycles; and extension at 72°C for 5 min.
[0035] SSR-PCR product detection: The product was mixed with 1× Loading buffer, denatured at 95°C for 10 min, and quickly placed in an ice-water mixture for 5 min to keep it in a single-stranded state; then 6% PAGE (denaturation) electrophoresis was performed at 75 W for 80 min; silver staining was used to observe and count the bands. The electrophoresis results showed that the size of the amplified fragment was about 270 bp, which was consistent with the designed 271 bp (see Appendix). Figure 1 A, indicated by black arrow).
[0036] Example 2
[0037] The specific gel excision and recovery of LMYP62 amplified by primers F1 and R1 were performed. The specific operation steps were as follows: cut the PAGE gel containing the target band and place it in a clean EP tube; add 5 times the volume of ddH2O and boil it in a boiling water bath for 3-5 min; high-speed centrifuge, 9000g, centrifuge for 1 min, and place it at 4℃ for use.
[0038] The recovered DNA fragments were connected to pMD19T (Simple) (TaKaRa). The specific operation was as follows: prepare the connection system in a microcentrifuge tube, with a total volume of 5µl [pMD19T (Simple) 0.5µl, gel recovery product 4.5µl]; incubate the connection reaction in a 16℃ water bath for 4-16h; add the connection system to 100µl JM109 competent cells and ice bath for 30min; heat at 42℃ for 90s and ice bath for 3-5min; add 890µl LB liquid culture medium and culture at 37℃, 150rpm for 1h; 10000 Centrifuge at 400 rpm for 1 minute, discard most of the supernatant, and leave 100-200 µl of suspended bacterial liquid; spread on LB solid culture medium containing 100 µg / mL ampicillin, and incubate at 37°C for about 12 hours; after colonies grow, perform colony PCR with universal sequencing primers M13-47 / 48, and detect with 1.0% agarose gel electrophoresis; select positive clones, sequence them with universal sequencing primers of pMD19T (Simple) plasmid, and name the LMYP62-specific fragment sequence as SEQ ID NO.3.
[0039] AAACGAAAACAGAGAGGCGACCTGGATATCGTGGAAGGAGAGGGAGCTTATGTCGGTCCTTGGGCGACTTGGCAAGGAGATGAACCTGAAAATCATTTCTTAACTGGTGTAGAAGTAGGTGATGAGCAAGAGGAAGA GGAGGAGGAAGAAGAAGAAGAAGTCGTAAAGACGAAGAAAGCAAAACCAAAGCGCGGCGCACCTGGTCAGGAAACATCTATCTTCCATGGAAAGTCTATGACAGACTACCAGGGCCGAACGTACATGTCACCAC, SEQ ID NO.3.
[0040] Example 3
[0041] According to the specific fragment SEQ ID NO.3 of the LMYP62 genome of Lentinus edodes in Example 2, primers F2 and R2 were designed, F2: TCTTAACTGGTGTAGAAGTAGGTGA (SEQ ID NO.4), R2: GTGACATGTACGTTCGGCC (SEQ ID NO.5), and PCR amplification was performed using the genomic DNA of 55 Lentinus edodes strains shown in Table 1 as templates, and the SSR marker was converted into a SCAR marker using primers F2 and R2. The specific amplified fragments of F2 and R2 are shown in SEQ ID NO.6:
[0042] TCTTAACTGGTGTAGAAGTAGGTGATGAGCAAGAGGAAGAGGAGGAGGAAGAAGAAGAAGAAGTCGTAAAGACGAAGAAAGCAAAACCAAAGCGCGGCGCACCTGGTCAGGAAACATCTATCTTCCATGGAAAGTCTATGACAGACTACCAGGGCCGAACGTACATGTCAC, SEQ ID NO. 6.
[0043] The amplification system and procedures are as follows:
[0044] PCR system: 2×Taq Mix 10 μl; 1 μl of each 10μM primer; 1μl of Lentinus edodes DNA, and the system was made up to 20μl with ddH2O.
[0045] PCR program: pre-denaturation at 94°C for 4 min; denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 60 s, for a total of 35 cycles; extension at 72°C for 5 min, cooling to 4°C for storage.
[0046] The PCR products were separated by 6% PAGE gel electrophoresis and identified by silver staining (see Appendix Figure 1 C in the middle). The electrophoresis results showed that the size of the amplified fragment was about 170 bp, which was consistent with the designed 171 bp (indicated by the black arrow). After three repetitions, the L. edodes strain LMYP62 could amplify a band of about 170 bp, while other L. edodes had no specific bands.
[0047] In order to further verify the sequence of the specific band, the present invention recovered a specific band obtained by amplification, connected it to the T vector and sent it to Sangon Biotechnology Co., Ltd. for gene sequencing. The sequencing result was compared using DNAMAN, and the similarity with SEQ ID NO.3 was 100%, which can prove that the SCAR fragment comes from SEQ ID NO.3. Therefore, the fragment amplified by primers F2 and R2 is highly specific and can be used as a SCAR marker for identifying the edodes strain LMYP62.
[0048] Comparative Example 1
[0049] According to the specific fragment SEQ ID NO.3 of the LMYP62 genome of Lentinus edodes in Example 2, primers F3 and R3 were designed, and the theoretical size of the PCR product was 209 bp, F3: AGCTTATGTCGGTCCTTGGG (SEQ ID NO.7); R3: GGCCCTGGTAGTCTGTCATA (SEQ ID NO.8). The genomic DNA of the 55 strains of Lentinus edodes shown in Table 1 was used as a template, and PCR amplification was performed with primers F3 and R3 to convert the SRAP marker into a SCAR marker.
[0050] The amplification system and procedures are as follows:
[0051] PCR system: 2× Taq Mix 10 μl; 1 μl of each 10μM primer; 1μl of shiitake mushroom DNA, and the system is made up to 20μl with ddH2O.
[0052] PCR program: pre-denaturation at 94°C for 4 min; denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 60 s, for a total of 35 cycles; extension at 72°C for 5 min, cooling to 4°C for storage.
[0053] The PCR products were separated by 6% PAGE gel electrophoresis and identified by silver staining (see Appendix Figure 1 In the figure, from left to right, M is a marker; 1-55 are Lentinus edodes (the numbers correspond to Table 1). The size of the amplified fragment is about 200 bp, which is basically consistent with the designed 209 bp. The results showed that the fragments amplified by primers F3 and R3 were not highly specific and could not be used as a SCAR marker for identifying Lentinus edodes strain LMYP62.
[0054] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.
[0055] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.
Claims
1. Application of a reagent for detecting SSR molecular markers in identifying Lentinula edodes strain LMYP62, characterized in that: The nucleotide sequence of the SSR molecular marker is shown in SEQ ID NO.
3. When the nucleotide sequence shown in SEQ ID NO.3 exists in the genome of the shiitake mushroom sample to be identified, the shiitake mushroom sample to be identified is the shiitake mushroom strain LMYP62. The shiitake mushroom sample to be identified is derived from the following table:
2. The use of the reagent for detecting SSR molecular markers according to claim 1 in identifying the edodes strain LMYP62, characterized in that: The reagents include a primer set, and the nucleotide sequences of the primer set are shown as SEQ ID NO.1 and SEQ ID NO.
2.
3. The use of the reagent for detecting SSR molecular markers according to claim 2 in identifying the edodes strain LMYP62, characterized in that: The reagents also include 2×Taq Mix and ddH2O.
4. The use of a reagent for detecting SCAR molecular markers in identifying the shiitake mushroom strain LMYP62, characterized in that: The nucleotide sequence of the SCAR molecular marker is shown in SEQ ID NO.6, and the SCAR molecular marker is transformed from the SSR molecular marker shown in SEQ ID NO.3; when the nucleotide sequence shown in SEQ ID NO.6 exists in the genome of the shiitake mushroom sample to be identified, the shiitake mushroom sample to be identified is the shiitake mushroom strain LMYP62; the shiitake mushroom sample to be identified is derived from the following table:
5. The use of the reagent for detecting SCAR molecular markers according to claim 4 in identifying the edodes strain LMYP62, characterized in that: The reagents include a primer set, and the nucleotide sequences of the primer set are shown as SEQ ID NO.4 and SEQ ID NO.
5.
6. The use of the reagent for detecting SCAR molecular markers according to claim 5 in identifying the edodes strain LMYP62, characterized in that: The reagents also include 2×Taq Mix and ddH2O.
7. A method for identifying Lentinula edodes strain LMYP62, characterized in that: Using primers with nucleotide sequences such as SEQ ID NO.1 and SEQ ID NO.2, and / or primers with nucleotide sequences such as SEQ ID NO.4 and SEQ ID NO.5, amplification is performed on the shiitake mushroom sample to be identified, and the sample from which the corresponding specific amplified fragment can be obtained is the shiitake mushroom strain LMYP62; The method for determining that the corresponding specific amplified fragment is obtained is as follows: when the primer set shown in SEQ ID NO.1 and SEQ ID NO.2 is used for amplification, a specific amplified fragment appears at 271 bp after amplification by agarose gel detection; or the amplified specific fragment is recovered and sequenced, and the amplified sequence is the same as SEQ ID NO.3; when the primer set shown in SEQ ID NO.4 and SEQ ID NO.5 is used for amplification, a specific amplified fragment appears at 171 bp after amplification by agarose gel detection; or the amplified specific fragment is recovered and sequenced, and the amplified sequence is the same as SEQ ID NO.6; or by adding ethidium bromide to the PCR amplification reaction system, and then observing the generation of fluorescence under ultraviolet light; Furthermore, the mushroom samples to be identified are derived from the following table: 。 8. The method for identifying the Lentinula edodes strain LMYP62 according to claim 7, characterized in that: When amplifying the shiitake mushroom sample to be identified, the amplification system also includes 2×Taq Mix and ddH2O, and the volume ratio of 2×Taq Mix, upstream primer, downstream primer, shiitake mushroom DNA template to be identified and ddH2O in the reaction system is 10:1:1:1:7.