Use of RGD peptide in the preparation of drugs against aquatic animal viruses and viral diseases

Abstract

The present invention relates to the field of biomedicine, and the present invention relates to the use of an RGD peptide in the preparation of drugs for resisting aquatic animal viruses and viral diseases, wherein the RGD peptide is a polypeptide composed of three amino acids, Arg-Gly-Asp. (1) The present invention first verifies from both positive and negative aspects: FN protein can promote GCRV, SVCV and KHV infection after incubation of grass carp kidney cells and carp epithelial cells, and can inhibit the infection of the three viruses after treatment with the FN inhibitor RGD peptide. (2) The present invention reveals a new biological function of the RGD peptide, which can effectively inhibit the invasion of viruses into cells and reduce the infection of viruses in hosts. The present invention also found that at a certain concentration, the RGD peptide is not toxic to grass carp and carp cells. It provides a theoretical and factual basis for the development of drugs for resisting aquatic animal viral diseases.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to use of an RGD peptide in preparing drugs for resisting aquatic animal viruses and viral diseases. Background Art

[0002] my country is a major aquaculture country in the world, and its aquaculture output has always ranked first in the world. However, due to the interactive influence of climate, geographical location, and human factors, the quality of aquaculture water environment has deteriorated, and the task of disease prevention and control has become more severe. Among them, common viral diseases such as grass carp hemorrhagic disease, carp spring viremia, and koi herpes virus disease are the most serious. The pathogen of grass carp hemorrhagic disease is grass carp reovirus (GCRV), which is an icosahedral double-stranded RNA virus with a diameter of about 70nm and a virus core diameter of about 50nm. It has no envelope and has 11 gene segments, each of which contains an open reading frame. The pathogen of carp spring viremia is carp spring viremia virus (SVCV), which is a rhabdovirus with a lipid envelope, 90-180nm long and 60-90nm wide. The genome of SVCV is about 11,000bp long and contains 5 major open reading frames, encoding 5 structural proteins. The pathogen of Koi Herpes Virus Disease is Koi Herpes Virus (KHV), also known as Koi Herpes Virus Type III (CyHV-3), which is an enveloped spherical DNA virus with a virus particle diameter of 180-200nm. The three aquatic viral diseases cause economic losses to my country's aquaculture industry every year, and the treatment options for the diseases in production are very limited, so new drugs are urgently needed to solve the disease problem.

[0003] Fibronectin is a ubiquitous extracellular glycoprotein that exists in a soluble form in body fluids and in an insoluble form in the extracellular matrix. It is composed of two subunits of about 250 kDa, presenting a V-shape. It is a dimeric high molecular weight adhesion glycoprotein connected by a pair of disulfide bonds at its C-terminus. The subunits are composed of three repeated modules, called type I, type II and type III, which have similar protein folding. Each FN molecule consists of 12 type I repeats, 2 type II repeats and 15-17 type III repeats. FN is widely present in various tissues. The structure of FN subunits from different tissues is very similar. They are all composed of some repeated amino acid sequences to form several globular domains. Each domain can bind to different macromolecules or specific receptors on the cell surface. Therefore, FN is a multifunctional molecule. FN exists in soluble form in plasma and various body fluids (plasma FN) and insoluble form in the extracellular matrix and cell surface (cellular FN). It is mainly produced by interstitial cells (such as fibroblasts, chondroblasts, endothelial cells, macrophages, etc.). A large number of studies have shown that FN can play a role in the process of viral infection and can mediate viral infection of the host. RGD tripeptide refers to a sequence polypeptide consisting of three amino acids, Arg-Gly-Asp, which can competitively bind to the FN receptor on the cell membrane, thereby achieving the effect of inhibiting FN. Summary of the invention

[0004] The present invention firstly provides a use of an RGD peptide in preparing a drug for resisting aquatic animal viruses and viral diseases. The RGD peptide is a polypeptide composed of three amino acids: Arg-Gly-Asp.

[0005] The present invention also provides a use of a product containing RGD peptide in preparing drugs for resisting aquatic animal viruses and viral diseases. The RGD peptide is a polypeptide composed of three amino acids: Arg-Gly-Asp.

[0006] In certain embodiments, the aquatic animal virus comprises one or more of GCRV, SVCV, and KHV.

[0007] In certain embodiments, the aquatic viruses include GCRV, SVCV, and KHV.

[0008] In some embodiments, the aquatic animals include: one or more of grass carp, carp, and koi.

[0009] In some embodiments, the aquatic animals include: grass carp, carp and koi.

[0010] In some embodiments, the viral disease includes one or more of grass carp hemorrhagic disease, carp spring viremia, and koi herpes virus disease.

[0011] In certain embodiments, the viral diseases include: grass carp hemorrhagic disease, carp spring viremia and koi herpes virus disease.

[0012] The present invention also provides a method for inhibiting aquatic animal viruses, the method comprising the step of administering RGD peptide, the RGD peptide being a polypeptide consisting of three amino acids, Arg-Gly-Asp, and the method is for non-therapeutic purposes.

[0013] Finally, the present invention provides a method for alleviating viral diseases, which comprises the step of administering RGD peptide, wherein the RGD peptide is a polypeptide composed of three amino acids, Arg-Gly-Asp, and the viral diseases include: one or more of grass carp hemorrhagic disease, carp spring viremia, and koi herpes virus disease; the method is for non-therapeutic purposes.

[0014] Compared with the prior art, the present invention has at least the following beneficial effects:

[0015] (1) The present invention first verifies from both positive and negative aspects: FN protein can promote GCRV, SVCV and KHV infection after incubation of grass carp kidney cells and carp epithelial cells, and can inhibit the infection of the three viruses after treatment with FN inhibitor RGD peptide.

[0016] (2) The present invention reveals a new biological function of RGD peptide, which can effectively inhibit virus invasion of cells and reduce virus infection of hosts. The present invention also found that at a certain concentration, RGD peptide has no toxicity to grass carp and carp cells. It provides a theoretical and factual basis for the development of drugs against aquatic animal viral diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 :FN inhibitor RGD has an inhibitory effect on GCRV infection of grass carp kidney cell line (CIK). A: qPCR analysis of GCRV infection proliferation and FN transcription level under the condition of CIK cell line incubated with different doses of RGD for 1h and infected with GCRV; B: Immunoblotting analysis and quantification of GCRV outer capsid protein VP7 and FN protein level under the condition of CIK cell line incubated with different doses of RGD for 1h and infected with GCRV; C: qPCR analysis of GCRV infection proliferation and FN transcription level under the condition of CIK cell line incubated with different doses of RGD for 9h and infected with GCRV; D: Immunoblotting analysis and quantification of GCRV outer capsid protein VP7 and FN protein level under the condition of CIK cell line incubated with different doses of RGD for 9h and infected with GCRV.

[0018] Figure 2: The FN inhibitor RGD has an inhibitory effect on SVCV and KHV infection of carp epithelial cell lines (EPC); A: qPCR analysis of SVCV infection, proliferation and FN transcription levels under the condition that EPC cell lines were incubated with different doses of RGD for 1h and infected with SVCV; B: qPCR analysis of SVCV infection, proliferation and FN transcription levels under the condition that EPC cell lines were incubated with different doses of RGD for 12h and infected with SVCV; C: qPCR analysis of KHV infection, proliferation and FN transcription levels under the condition that EPC cell lines were incubated with different doses of RGD for 1h and infected with KHV; D: qPCR analysis of KHV infection, proliferation and FN transcription levels under the condition that EPC cell lines were incubated with different doses of RGD for 24h and infected with KHV.

[0019] Figure 3 :RGD has no toxic effect on cells; A:RGD has no toxic effect on grass carp CIK cells; B:RGD has no toxic effect on carp EPC cells. DETAILED DESCRIPTION

[0020] In order to make the technical problems, technical solutions and advantages to be solved by the present invention more clear, a detailed description will be given below with reference to the accompanying drawings and specific embodiments.

[0021] Experimental Materials:

[0022] 1. Cells and virus strains

[0023] Grass carp kidney cell line CIK, carp epithelial cell line EPC, GCRV, SVCV and KHV strains were maintained by our laboratory.

[0024] 2. Reagents and kits

[0025] M199 medium and fetal bovine serum (Gibco) were purchased from Changsha Boyi Biotechnology Co., Ltd. RGD (CHEMEGEN) was purchased from Changsha Boyi Biotechnology Co., Ltd.

[0026] 3. RNA extraction, reverse transcription, and fluorescence quantification

[0027] RNA extraction kit was purchased from Ambion, reverse transcription kit was purchased from Thermo, and SYBR Green PCR Master Mix was purchased from Vazyme.

[0028] Instrument consumables:

[0029] Cell culture dishes, cell culture plates, and cell culture flasks were purchased from Corning.

[0030] The centrifuge and carbon dioxide incubator were purchased from Thermo Company, and the cell operation table was purchased from Thermo Company. The pure water system was purchased from Millipore, and the fluorescence quantitative PCR system was the Bio-Rad CFX96TM Real-Time System.

[0031] Example 1 The FN inhibitor RGD has an inhibitory effect on GCRV infection of grass carp kidney cell line (CIK)

[0032] Experimental methods:

[0033] 1. Cell recovery and subculture

[0034] 1) Cell recovery: Take out the frozen cells, put them into a 37℃ digital water bath, and completely thaw them within 1-2 minutes. Carefully aspirate the cells in a sterile operating table and add them to a 15mL centrifuge tube containing M199. Centrifuge at 800r / min for 5 minutes at room temperature, carefully aspirate the supernatant, add 5mL of culture medium, slowly blow and resuspend the cell pellet, and transfer it to a T25 culture flask, and culture it in a 28℃ incubator. Change the medium after 24 hours and observe its growth.

[0035] 2) Cell passaging: Aspirate the culture medium and rinse once with PBS. Add 1 mL of trypsin (0.25% Trypsin-EDTA) to the culture bottle and place it in the incubator for digestion for 2 minutes. Observe the cell digestion status in real time. When the cells become round, quickly put them back into the sterile operating table, tap the culture bottle gently, and add 5 mL of M199 culture medium to terminate digestion. Use a pipette to blow evenly. The growth of adherent cells must be carefully monitored to ensure that the cells remain healthy. Depending on the cell type, many adherent cells need to be passaged when they reach 70-90% density.

[0036] 2. Cell attack

[0037] The cultured cells were replaced with serum-free basal medium M199, and GCRV, SVCV and KHV were added at a dose of about 10 MOI. The cells were collected at the corresponding time, and the 1-hour cell sample was used to measure the virus entry efficiency, and the subsequent time cell samples were used to measure the virus proliferation efficiency in the cells.

[0038] 3. Extract RNA

[0039] See TRIzol TM Reagent (Ambion) for total RNA extraction.

[0040] 1) Aspirate the culture medium in the well plate;

[0041] 2) Rinse 1-2 times with sterile PBS;

[0042] 3) Add 1 ml of Trizol lysis buffer to each well (6-well plate), let stand for 5 min, and then repeatedly pipette until the cells are completely lysed, and transfer to a 1.5 ml enzyme-free centrifuge tube;

[0043] 4) Transfer the liquid to a 1.5 mL enzyme-free centrifuge tube, add 200 μL of chloroform, shake up and down, and let stand for 15 min;

[0044] 5) Centrifuge at 4°C, 12,000 g for 15 min, aspirate the upper aqueous phase (measured) and transfer to a new enzyme-free centrifuge tube;

[0045] 6) Add an equal volume of isopropanol (pre-cooled with ice), mix gently and let stand at room temperature for 15 minutes;

[0046] 7) Centrifuge at 4°C, 12,000 g for 10 min, discard the supernatant, and let the RNA settle to the bottom of the tube;

[0047] 8) Add 1 mL of pre-cooled 75% ethanol (prepared with DEPC water), gently shake the centrifuge tube to suspend the precipitate (invert and mix for 10 seconds, wash);

[0048] 9) Centrifuge at 8000 g for 5 min at 4°C and discard the supernatant as much as possible (be careful to ensure that the RNA is not discarded);

[0049] 10) Dry at room temperature for 5-10 minutes (do not dry the RNA too much, otherwise it will be difficult to dissolve);

[0050] 11) Dissolve RNA samples in DEPC water;

[0051] 12) Measure the concentration using a spectrophotometer, record the results, and store at -80°C.

[0052] 4. First-strand cDNA synthesis

[0053] Refer to RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, Cat#:K1622);

[0054] The kit instructions are as follows:

[0055] Premix Ⅰ See Table 1:

[0056] Table 1 Premix I reaction system

[0057] Reagent Volume <![CDATA[oligdT 18 ]]> 0.5 μL / sample Random Primer 0.5 μL / sample Sample 2000 / RNA concentration DEPC water 11 μL - sample

[0058] 12μL system: 65℃5min

[0059] Premix II see Table 2:

[0060] Table 2 Premix I reaction system

[0061] Reagent Volume Reaction Buffer 4 μL / sample dNTP 2 μL / sample RT 1 μL / sample RI 1 μL / sample

[0062] 20μL system: 25℃5min→42℃70min→70℃5min→4℃+∞

[0063] 5. Fluorescence quantitative PCR

[0064] 1) Primer design:

[0065] a. Primer length is 20 or 21 bp;

[0066] b. Five identical bases cannot appear consecutively in the primer;

[0067] c. The bases at both ends of each primer should preferably be G or C;

[0068] d.GC content is 45% to 55%;

[0069] e. The size of PCR product is 85-300 bp.

[0070] The primers in this study were designed by Prime5, and the primers are shown in Table 3;

[0071] Table 3 Primer sequences

[0072] q-PCR primer Sequence gcβ-actin-qF SEQ ID No.1: AGCCATCCTTCTTGGGTATG gcβ-actin-qR SEQ ID No.2: GGTGGGGCGATGATCTTGAT gcFN-qF SEQ ID No.3: GCTGGAGTGCGTCTGTTTGG gcFN-qR SEQ ID No.4: TGAAGTGCGTGTGTCCTGGT VP7-qF SEQ ID No.5: CCATGACACTCACGCACACG VP7-qR SEQ ID No.6: GGCAAGCGAAGGTCAGGTTG SVCV-qF SEQ ID No.7: CCGCTCCAAGAGAGCACTGA SVCV-qR SEQ ID No.8: GCCATCAGCAGGCTTGCATT KHV ORF4L-qF SEQ ID No.9: GTCGTGCAGTCGTGGACCT KHV ORF4L-qR SEQ ID No.10: CCAGAGCATAGGCATCAGCC

[0073] 2) Fluorescence quantitative 10 μL system (Vazyme, Cat#: Q711-02), see Table 4;

[0074] Table 4 Reaction system

[0075] Reagent Volume 2×ChamQ Universal SYBR qPCR Master Mix 5.0 μL Primer1(10 μM) 0.4 μL Primer2(10 μM) 0.4 μL Template DNA / cDNA x μL <![CDATA[ddH2O]]> To 10.0 μL

[0076] 3) qPCR program, see Table 5:

[0077] Table 5 Reaction system

[0078]

[0079]

[0080] 6. Western blot

[0081] The cells were collected and lysed with west / ip lysis buffer (Beyotime, Cat#: P0013) plus protease inhibitors for 30 min, the cell lysate was ultrasonically treated and broken, centrifuged at 4°C, 12000 rpm for 20 min, the supernatant was removed, 5× SDS loading buffer was added in proportion, boiled at 98°C for 10 min, and then protein samples were separated by SDS-PAGE (ACE Biotechnology, Cat#: ET15420Gel) at a constant voltage of 150 V and transferred to a PVDF membrane at a current of 300 mA for 3 h. QuickBlock TM Closure Solution (TBSTw) (Beyotime, Cat#: P0231) was used to block for 20 min at room temperature. All immunoblot analyses were performed using the indicated primary antibodies (1:1000-1:2000 dilution in TBST) at 4°C overnight and HRP-conjugated secondary antibodies (1:2000-1:4000 dilution in TBST) at room temperature for 1 h. Proteins were visualized using an ECL detection kit (Beyotime, Cat#: 17047). The antibodies used are listed in Table 6;

[0082] Table 6 Antibodies

[0083]

[0084] Experimental results:

[0085] like Figure 1 As shown, grass carp CIK cell line was incubated with different doses (0, 50, 100, 200ng) of RGD for 4h, and then GCRV (10MOI) was added to the culture system (2ml). Cells were collected at 1h (entry) and 9h (proliferation), RNA and protein were extracted, and viral load and FN expression were detected. The results showed that RGD could inhibit the infection and proliferation of GCRV by inhibiting FN at both the nucleic acid level and the protein level, and this inhibition was dose-dependent. WB result analysis showed that RGD inhibition of GCRV may play a role more in the early stage of infection.

[0086] Example 2 FN inhibitor RGD has an inhibitory effect on SVCV and KHV infection of carp epithelial cell line (EPC)

[0087] Experimental methods:

[0088] The cell culture, virus challenge, RNA extraction, reverse transcription and fluorescence quantification methods were the same as those in Example 1.

[0089] Experimental results and discussion:

[0090] like Figure 2As shown, SVCV and KHV (10MOI) were added to the culture system (2ml) after incubating the EPC cell line with different doses (0, 50, 100, 200ng) of RGD for 4h. Since SVCV is an RNA virus and KHV is a DNA virus, the KHV infection time is longer than that of SVCV, where 1h is the virus entry into the cell, and 12h and 24h are the corresponding virus proliferation. The results showed that RGD can effectively inhibit the infection and proliferation of SVCV and KHV on carp epithelial cell lines.

[0091] Example 3 RGD has no toxic effect on cells

[0092] Experimental methods:

[0093] Cell culture and drug treatment were the same as in Example 1. After the cells were collected, the cell survival rate was calculated using a trypan blue staining cell survival rate detection kit (Beyotime, Cat#: C0011).

[0094] Experimental results and discussion:

[0095] In Examples 1 and 2, RGD was used to verify its inhibitory effect on three aquatic animal viral diseases. In order to exclude that the inhibitory effect was caused by the toxicity of the drug to the cells, we incubated CIK and EPC cells with corresponding concentrations of RGD for 4 hours, collected the cells and calculated their survival rates, as shown in Figure 2. Figure 3 As shown, within the concentration range used, RGD has little effect on cell survival rate, which indicates that it is safe and feasible to use RGD to prepare drugs against aquatic animal viral diseases.

[0096] Based on the above three examples, it can be concluded that RGD can significantly inhibit the infection and proliferation of three aquatic animal viral diseases, providing a theoretical basis for the application of RGD peptide in the preparation of anti-aquatic animal viral disease drugs.

[0097] The above is a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A use of RGD peptide in the preparation of drugs for resisting aquatic animal viruses and viral diseases, characterized in that: The RGD peptide is a polypeptide composed of three amino acids, Arg-Gly-Asp; The aquatic animal virus is selected from one or more of GCRV, SVCV and KHV; The viral disease is selected from one or more of grass carp hemorrhagic disease, carp spring viremia, and koi herpes virus disease.

2. Use of a product containing RGD peptide in the preparation of drugs against aquatic animal viruses and viral diseases, characterized in that: The RGD peptide is a polypeptide composed of three amino acids, Arg-Gly-Asp; The aquatic animal virus is selected from one or more of GCRV, SVCV and KHV; The viral disease is selected from one or more of grass carp hemorrhagic disease, carp spring viremia, and koi herpes virus disease.

3. A method for inhibiting aquatic animal viruses, characterized in that: The method comprises the step of administering an RGD peptide, wherein the RGD peptide is a polypeptide consisting of three amino acids, Arg-Gly-Asp, and the method is for non-therapeutic purposes; The aquatic animal virus is selected from one or more of GCRV, SVCV and KHV.

Images