A light-responsive transcription factor gene PgGRAS54 of Pennisetum americanum for improving plant cold tolerance and its application

Abstract

The present invention discloses a Pennisetum gracilis light-responsive transcription factor gene PgGRAS54 and application thereof for improving the cold resistance of plants, and belongs to the field of genetic engineering technology. The CDS sequence of the Pennisetum gracilis light-responsive transcription factor gene PgGRAS54 is shown in SEQ ID NO.9. The gene is located in the cell membrane and the nucleus, and exhibits obvious transcription inhibition activity in yeast and tobacco systems, indicating that PgGRAS54 is a transcription inhibitor that responds to light and cold. Further studies have found that overexpression of PgGRAS54 enhances the cold resistance of Arabidopsis thaliana by increasing the expression level of the COR gene. The PgGRAS54 gene provided by the present invention is of great significance for improving the cold resistance of Pennisetum gracilis and expanding its distribution in high-latitude areas, and at the same time provides a theoretical basis for breeding highly cold-resistant plants.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to a Pennisetum americanum light-responsive transcription factor gene PgGRAS54 for improving the cold resistance of plants and an application thereof. Background Art

[0002] Temperature is one of the main environmental factors affecting plant growth and development. Temperature stress includes high or low temperature stress, which affects the growth and development of crops, leading to reduced yields and threatening food security (Lesk et al., 2016; Ding et al., 2022). Every 1°C increase in global temperature will lead to a 6%, 3.1%, 7.4% and 3.2% decrease in wheat, rice, corn and soybean yields, respectively, while low temperature stress will also cause a 30-40% loss in crop yields in temperate regions (Zhao et al., 2017; Andaya et al., 2003). Light is another key factor in regulating plant growth and development. More and more studies have revealed the connection between light and temperature stress (Jiang et al., 2017). The light signal transcription factor PIF3 positively regulates plant cold tolerance by binding to CBF to stabilize phytochrome B (Jiang et al., 2020). Phy B, as a photoreceptor, interacts with a circadian clock gene ELF3 to resist cold stress (Liu et al., 2001; Lee et al., 2022). Under cold stress, CRY2 is a key transcription factor in the blue light-mediated cold adaptation process. It interacts with COP1 to inhibit the degradation of HY5, while the photoreceptor HY5 directly regulates BBX7 / 8 containing the B-box domain, and improves the freezing resistance of Arabidopsis by regulating the expression of a series of COR genes including anthocyanin biosynthesis genes (Li et al., 2021). The plant hormone (IAA, BR and GA) pathway mediated by the bHLH transcription factor PIF4 that interacts with the plant phytochrome phy B plays a core regulatory role in plant thermomorphogenesis (Ding et al., 2020). Under light conditions, BES1 forms homodimers and represses the expression of BR biosynthesis genes; however, this process is disrupted by PIF4 at dawn in response to high temperatures, allowing BRs to act downstream of auxin to play a role in thermomorphogenesis (Ding et al., 2020).

[0003] The GRAS family is a class of transcription factors widely present in plants. Its name comes from the first three transcription factors identified in the family, GAI, RGA and SCR. The number of amino acids in a typical GRAS protein is 400 to 770 (Zhang Wenhui et al., 2022). The C-terminal sequence of the GRAS conserved domain is highly conserved, and the N-terminal sequence is variable, which will undergo specific folding when encountering a suitable ligand (Cenci et al., 2017; Sun et al., 2011). At present, GRAS family genes have been identified in plants such as Arabidopsis, rice, corn and wheat, and can be divided into subfamilies such as SHR, SCL3, LISCL, DELLA, SCR, LS, PAT1, HAM, OS19 and DLT (Hirsch et al., 2009; Tian et al., 2004; Guo et al., 2017; Mishra et al., 2023). GRAS transcription factors not only play a key role in plant growth and development, but also regulate plant responses to abiotic stresses and participate in phytochrome and plant hormone signal transduction. Studies have reported that PAT1 subfamily GRAS genes can participate in light signal transduction and abiotic stress responses, but it is still unknown whether PAT1 subfamily PgGRAS genes in Pennisetum americanum can participate in light and temperature stress responses (Bolle et al., 2000; Torres et al., 2006; Yuan et al., 2016; Wang et al., 2021).

[0004] Pennisetum is an annual grass of the genus Pennisetum in the Poaceae family and one of the six major cereal crops in the world. It has the characteristics of rapid growth, rich nutrition, high yield and good quality. It has high protein and cellulose content and high concentrations of trace elements such as iron and zinc (Nambiar et al., 2011; Tako et al., 2015). In addition, Pennisetum is resistant to a variety of abiotic stresses such as high temperature, drought and salinity, and is suitable for planting on marginal land. Its output accounts for about 50% of the world's cereal output, which is of great significance in ensuring food and feed security in arid and semi-arid tropical regions (Sun et al., 2023; Ramu et al., 2023). Pennisetum has excellent heat tolerance and can tolerate extreme high temperatures above 42°C during its reproductive growth period (Cupta et al., 2015), but it is very sensitive to low temperatures. Under normal conditions, the seed germination and seedling growth rates of Pennisetum virgatum are significantly faster than those of corn, rice, orchard grass, and switchgrass. However, when Pennisetum virgatum seedlings have not been previously adapted to stress conditions, they show a greater electrolyte leakage rate when subjected to increasing temperature freezing stress, compared with switchgrass and millet seedlings grown under the same conditions, and their half-lethal temperature is also the highest, at -1.55±0.08℃ (Wu et al., 2021; Meng et al., 2021).

[0005] Based on this, it is of great significance to explore the genes corresponding to low temperature stress in American foxtail grass in order to improve its adaptability to low temperature stress and expand its distribution in high-latitude areas. Summary of the invention

[0006] The purpose of the present invention is to provide a light-responsive transcription factor gene PgGRAS54 of Pennisetum americanum for improving the cold resistance of plants and its application, so as to solve the problems existing in the above-mentioned prior art. The present invention identifies a PAT1 subfamily gene-PgGRAS54 in Pennisetum americanum, and the acquisition of this gene is of great significance for improving the cold resistance of Pennisetum americanum and expanding its distribution in high-latitude areas, and at the same time provides a theoretical basis for cultivating plants with high cold resistance.

[0007] To achieve the above object, the present invention provides the following solutions:

[0008] The invention provides a Pennisetum gracilis light-responsive transcription factor gene PgGRAS54 for improving the cold resistance of plants. The CDS sequence of the Pennisetum gracilis light-responsive transcription factor gene PgGRAS54 is shown in SEQ ID NO.9.

[0009] The invention also provides a recombinant vector comprising the Pennisetum americanum light-responsive transcription factor gene PgGRAS54.

[0010] The present invention also provides a recombinant bacterium comprising the recombinant vector.

[0011] The present invention also provides the use of the Pennisetum americanum light-responsive transcription factor gene PgGRAS54, the recombinant vector or the recombinant bacteria in improving the cold resistance of plants.

[0012] Furthermore, the plant includes Arabidopsis thaliana.

[0013] The present invention also provides a method for improving the cold resistance of plants, comprising introducing the Pennisetum americanum light-responsive transcription factor gene PgGRAS54 into a target plant to construct a transgenic strain with overexpression of PgGRAS54.

[0014] Furthermore, the target plant includes Arabidopsis thaliana.

[0015] The present invention also provides the use of the Pennisetum americanum light-responsive transcription factor gene PgGRAS54, the recombinant vector or the recombinant bacteria in cultivating plants with high cold resistance.

[0016] The present invention discloses the following technical effects:

[0017] The present invention identified a PAT1 subfamily gene, PgGRAS54, in Pennisetum americanum. The gene is 1644 bp long and encodes 547 amino acids. The PgGRAS54 protein contains a typical GRAS conserved domain at the 177-547 amino acid positions. qRT-PCR detection found that the expression of PgGRAS54 was induced by light and temperature stress. PgGRAS54 was localized in the cell membrane and nucleus, and showed obvious transcriptional inhibition activity in yeast and tobacco systems, indicating that PgGRAS54 is a transcriptional inhibitor that responds to light and cold. Further studies have found that PgGRAS54 enhances the cold tolerance of transgenic Arabidopsis by increasing the expression level of the COR gene.

[0018] The acquisition of the Pennisetum gracilis light-responsive transcriptional repressor gene PgGRAS54 of the present invention is of great significance for improving the cold resistance of Pennisetum gracilis and expanding its distribution in high-latitude areas, and also provides a theoretical basis for cultivating highly cold-resistant plants. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0020] Figure 1is the response of PgGRAS54 gene of Pennisetum americanum to light and temperature stress, where A is the expression level of PgGRAS54 gene within 48 hours under normal growth conditions, and B is the expression level of PgGRAS54 gene within 48 hours under low temperature and high temperature stress;

[0021] Figure 2 The results of subcellular localization analysis of PgGRAS54;

[0022] Figure 3 The results of the PgGRAS54 yeast self-activation activity experiment;

[0023] Figure 4 The results of the transcriptional activation experiment of PgGRAS54 in plant cells;

[0024] Figure 5 The phenotypes (A) and survival rates (B) of overexpression lines and wild-type plants after freezing damage (-10℃), where OE-3, OE-9 and OE-10 are overexpression lines, and WT is a wild-type plant;

[0025] Figure 6 The phenotypes (A), electrolyte permeability (B) and relative water content (C) of the overexpression lines and wild-type plants after low temperature (4°C) treatment, among which OE-3, OE-9 and OE-10 are overexpression lines, and WT is the wild-type plant;

[0026] Figure 7 The expression patterns of cold-responsive genes CBF1 (A), CBF2 (B), COR15a (C), COR47 (D), CBF3 (E), and KIN1 (F) in PgGRAS54 overexpressing plants and wild-type plants after cold treatment. DETAILED DESCRIPTION

[0027] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0028] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0029] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0030] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0031] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0032] Example 1 Expression of PgGRAS54 gene in circadian rhythm and under temperature stress

[0033] 1. Material processing of Pennisetum americanum

[0034] The Pennisetum americanum (Tifleaf3) samples were obtained from the Chongzhou base of Sichuan Agricultural University and subjected to circadian rhythm and temperature stress treatments, specifically 12 h of light and 12 h of darkness, and the temperature stress was set to cold stress (4°C) and high temperature stress (38°C).

[0035] 2. Analysis of relative expression of PgGRAS54 under diurnal and temperature stress

[0036] Total RNA was extracted from leaves collected after treatment using a plant RNA extraction kit. The extracted RNA was reverse transcribed into cDNA using a reverse transcription kit. The relative expression of PgGRAS54 in the circadian rhythm and at different time points of temperature stress was determined using fluorescent quantitative polymerase chain reaction. UBC-E2 was used as an internal reference gene. The primers used in the fluorescent quantitative polymerase chain reaction process are as follows:

[0037] qPgGRAS54-F: CCAAGGCAGACTCCAAAGCA (SEQ ID NO. 1);

[0038] qPgGRAS54-R:ACAACGTGGGTATCCGAAGC (SEQ ID NO. 2);

[0039] UBC-E2-F:ACCGCCTGACAATCCCTATG(SEQ ID NO.3);

[0040] UBC-E2-R: GGGATAGTCTGGCGGAAAATG (SEQ ID NO. 4).

[0041] The qRT-PCR reaction system was 20 μL, including 5 μL cDNA, 0.8 μL qPgGRAS54-F, 0.8 μL qPgGRAS54-R, 10 μL SYBR enzyme, and the rest was made up to 20 μL with RNase-free ddH2O.

[0042] The qRT-PCR reaction program was: 95°C for 30 s; 95°C for 5 s, 58°C for 30 s, 40 cycles; the melting curve was set by default. -ΔΔCt The relative expression levels of genes were calculated.

[0043] Test results such as Figure 1 As shown, qRT-PCR was used to detect the expression level of PgGRAS54 within 48 h under normal growth conditions of Pennisetum americanum ( Figure 1 A), PgGRAS54 showed obvious circadian rhythm changes, with strong up-regulation in light and down-regulation in darkness. At the same time, PgGRAS54 was significantly up-regulated under both low temperature (4°C) and high temperature (38°C) stress ( Figure 1 B).

[0044] Example 2 Identification of PgGRAS54

[0045] 1. Cloning of PgGRAS54

[0046] The first round of PCR amplification was performed using the cDNA of Pennisetum americanum as a template, 5'UTR upstream primer F1 (PgGRAS54-F) and 3'UTR downstream primer R1 (PgGRAS54-R). CDS region specific primers (PgGRAS54-CDS-F and PgGRAS54-CDS-R) were designed again, and the PCR recovery product obtained from the first PCR was used as a template for the second round of amplification.

[0047] The primers required for PCR amplification are as follows:

[0048] PgGRAS54-F: CTACCCTGTTCCTCGTTGTCTG (SEQ ID NO.5);

[0049] PgGRAS54-R: ACGGCATTCTTCGTCAGGTCAA (SEQ ID NO. 6);

[0050] PgGRAS54-CDS-F: gctctagaATGGCTGATACTCCAACTTC (SEQ ID NO.7);

[0051] PgGRAS54-CDS-R: acgcgtcgacGTGCCATGCCGACGAGACTATC (SEQ ID NO.8), wherein the lowercase letters in the sequences shown in SEQ ID NO.7 and SEQ ID NO.8 represent primer sequences corresponding to restriction enzyme cleavage sites.

[0052] The PCR reaction system was: 10 μL 2×Phanta Flash Master Mix (Dye Plus), 1 μL cDNA, 1 μL upstream primer (10 μM), 1 μL downstream primer (10 μM), and ddH2O was added to 20 μL.

[0053] The PCR reaction conditions were: 98°C for 3 min, 98°C for 1 min, 58°C for 30 s, 72°C for 1 min, 30 cycles, 72°C for 3 min, and storage at 10°C. The amplified CDS sequence fragment was digested with enzymes and then ligated into the pENTR vector by T4 ligase to obtain pEntry-PgGRAS54, which was sent to the company for sequencing and compared with the Pennisetum genome reference sequence.

[0054] The enzyme digestion reaction system was: 20 μL pENTR vector, 1 μL EcoRI, 1 μL HindIII, 5 μL 10×Cutsmart, and ddH2O was added to 50 μL. The reaction conditions were 37°C for 2 h.

[0055] PgGRAS54 belongs to the PAT1 subfamily gene, which is 1644 bp long and encodes 547 amino acids. The PgGRAS54 protein contains a typical GRAS conserved domain at amino acid positions 177-547.

[0056] The CDS sequence of the amplified PgGRAS54 gene (SEQ ID NO.9):

[0057]

[0058] 2. Construction of recombinant expression vector and recombinant bacteria

[0059] pEntry-PgGRAS54 was digested with PvuI restriction endonuclease, and then LR recombinase was used to perform LR recombination with the pEarlyGate103 expression vector to form a new recombinant expression vector pEarlyGate103-PgGRAS54, and the expression vector was transferred into Agrobacterium AGL1.

[0060] 3. PgGRAS54 is a light- and cold-responsive GRAS transcriptional repressor

[0061] 3.1 Subcellular localization analysis

[0062] Since PgGRAS54 can strongly respond to light induction and low temperature stress, in order to explore whether the localization of the PgGRAS54 gene can be affected by external environmental conditions, the present invention subjected tobacco transiently transformed with the target gene Agrobacterium to darkness and low temperature treatment. Subcellular localization analysis was also performed. Specifically:

[0063] Select 2-3 pEarlyGate103-PgGRAS54 Agrobacterium single colonies and place them in a 2 mL centrifuge tube containing LB liquid medium containing 50 mg / L Kan and 100 mg / L Rif antibiotics, and culture them in a 28°C shaker for 1-2 days. Then pipette 100 μL into a 50 mL centrifuge tube containing LB liquid medium containing 50 mg / L Kan and 100 mg / L Rif antibiotics, and culture them in a 28°C shaker until OD 600 =0.8-1.0. According to V 菌液 ×OD 600 =0.8, the corresponding volume of bacterial solution was centrifuged at 4000rpm for 4min to collect the bacteria, the supernatant was discarded, and the bacteria were resuspended with 1mL tobacco infection solution (1mL 100μMAS was added to every 100mL tobacco infection solution). Finally, the resuspended solution was treated in the dark for 2-3h and then injected into tobacco. After the tobacco was cultured normally for 2d, the eGFP fluorescence was observed using a Leica ultra-high resolution confocal microscope (excitation wavelength was 488nm, scanning wavelength was 505-530nm).

[0064] The results showed that under normal conditions, PgGRAS54 was localized in the cell membrane and nucleus; although darkness and low temperature treatment did not change the nuclear membrane co-localization of PgGRAS54, they reduced the GFP fluorescence signal to a certain extent, especially the nuclear localization signal ( Figure 2 ).

[0065] 3.2. Verification of transcriptional activity

[0066] To further verify whether PgGRAS54 has transcriptional activation activity, the Y2HGold yeast transformed with the target gene was spotted onto the selection medium of SD / -Trp and SD / -Trp-His-Ade (+25mM 3AT). The Agrobacterium strain containing the target gene recombinant plasmid was transiently transformed into tobacco leaves for dual luciferase reporter gene detection. The results showed that yeast containing the target gene could not grow on the triple-deficient selection medium ( Figure 3 ), indicating that PgGRAS54 has no transcriptional activation activity. In addition, the Agrobacterium strain containing the target gene recombinant plasmid was transiently transformed into tobacco leaves for dual luciferase reporter gene detection. Qualitative results showed that the fluorescence intensity of the recombinant plasmid containing PgGRAS54 was lower than that of the empty vector; quantitative results showed that the LUC / REN ratio of the recombinant plasmid containing PgGRAS54 was lower than that of the empty vector ( Figure 4 ). The above results indicate that PgGRAS54 is a GRAS transcriptional repressor that responds to light and cold.

[0067] Example 3 Phenotypic analysis of PgGRAS54 transgenic plants under low temperature stress

[0068] 1. Obtaining Arabidopsis transgenic lines

[0069] The Agrobacterium carrying the pEarlyGate103-PgGRAS54 vector constructed above was shaken to an OD value of 0.6, the bacterial solution was collected and resuspended, and then the Arabidopsis flowers were immersed in the Agrobacterium infection solution. After the Arabidopsis seeds matured, positive Arabidopsis were screened on 1 / 2MS+Basta medium.

[0070] 2. Identification of transgenic Arabidopsis

[0071] The T0 generation Arabidopsis seeds received were spread on a 1 / 2MS solid medium containing 20 mg / L Basta. After growing for about 2 weeks, the green and healthy seedlings were transferred to nutrient soil for further cultivation. When the Arabidopsis leaves grew slightly larger, the transgenic Arabidopsis genomic DNA was extracted for PCR identification. At the same time, the obtained transgenic positive strains were further cultured, and their T1 generation seeds were collected. The strains with a segregation ratio of offspring close to 3:1 were screened and harvested, and the T3 generation homozygous strains were used for functional verification.

[0072] 3. Analysis of cold-resistance phenotype of PgGRAS54 overexpressing transgenic Arabidopsis

[0073] 3.1 Experimental Methods

[0074] The T2 transgenic Arabidopsis seeds were spread on 1 / 2MS solid medium containing 20 mg / L Basta. When the Arabidopsis grew 2-4 cotyledons, they were transferred to a square culture dish on 1 / 2MS solid medium. The culture was continued for about 1 week. The CPK28-NLP7 module integrates cold-induced Ca 2+ Arabidopsis thaliana was treated with freezing injury using the "signal and transcriptional reprogramming inArabidopsis" method, and the survival rate was calculated.

[0075] T3 transgenic Arabidopsis seedlings of the same growth and about 3 weeks old were selected, and wild-type Arabidopsis was used as a control, and subjected to 4°C low temperature treatment. During the treatment, the phenotypes were observed and the physiological indicators were measured.

[0076] The measurement of physiological indicators includes the following operations.

[0077] (1) Determination of electrolyte leakage rate (EL)

[0078] Take 0.1g of fresh plant leaves, wrap them with absorbent paper and put them into a 50mL centrifuge tube filled with 30mL deionized water, so that the sample is fully immersed in water, set 5 biological replicates, seal and place them in a shaker for 24 hours, and then use a conductivity meter to measure the initial conductivity value C0. Then seal the centrifuge tube after measuring the initial conductivity value and place it in a boiling water bath for 20 minutes to kill the green, take it out and cool it to room temperature, place it in a shaker for 24 hours, and measure the conductivity C1 again. The conductivity calculation formula is: EL = C0 / C1×100%.

[0079] (2) Determination of relative water content (RWC)

[0080] Use a 1 / 10,000 balance to accurately weigh 0.1g of fresh weight (FW) of plant leaves, wrap the leaves with absorbent paper and immerse them in a centrifuge tube filled with 10mL deionized water, seal and place at room temperature for 24 hours. Then take out the leaves and wipe the surface moisture with absorbent paper and quickly weigh the saturated fresh weight (TW) of the leaves, put the leaves in an envelope and place them in an oven (65°C) to constant weight, and finally weigh the dry weight (DW) of the leaves. The calculation formula for relative water content of leaves: RWC = (FW-DW) / (TW-DW) × 100%.

[0081] 3.2 Experimental Results

[0082] Arabidopsis was subjected to freezing treatment below 0°C, and then placed at normal temperature for recovery, and the survival rate was observed and counted. After freezing treatment, almost all leaves of Arabidopsis seedlings died in the early recovery period, and the leaves gradually returned to green in the late recovery period. In addition, the survival rate of PgGRAS54-overexpressing Arabidopsis was significantly higher than that of the wild type, indicating that PgGRAS54 improved the freezing tolerance of Arabidopsis ( Figure 5 ).

[0083] PgGRAS54 overexpressing Arabidopsis was subjected to 4°C low temperature treatment, and the ion permeability and relative water content were measured. The results showed that after 6 days of cold treatment, the leaves of wild-type Arabidopsis began to turn purple, while the leaves of overexpressing Arabidopsis remained relatively green; after 12 days of cold treatment, almost all the leaves of wild-type Arabidopsis turned purple and began to turn yellow, while the purple degree of transgenic Arabidopsis leaves was weaker than that of wild-type ( Figure 6 Before cold treatment, there was no significant difference in ion permeability and relative water content between wild type and overexpressed Arabidopsis, but after cold treatment, the ion permeability of PgGRAS54 overexpressed Arabidopsis was significantly lower than that of wild type, and the relative water content was significantly higher than that of wild type ( Figure 6 B and C), indicating that the cell membrane damage of PgGRAS54-overexpressing Arabidopsis was less after low temperature stress, and PgGRAS54 enhanced the cold resistance of Arabidopsis.

[0084] 4. Expression of cold-responsive genes in PgGRAS54 transgenic plants

[0085] 1. Detection of cold response gene expression

[0086] Use a plant RNA extraction kit to extract plant total RNA from the samples stored in step "3. Analysis of cold tolerance phenotype of PgGRAS54 overexpressing transgenic Arabidopsis". Use a reverse transcription kit to reverse transcribe plant RNA into cDNA. Design primers and detect the relative expression levels of related cold-responsive genes by RT-qPCR. ACTIN2 was used as an internal reference gene.

[0087] The primers used in the RT-qPCR process are as follows:

[0088] CBF1-F: GCATGTCTCAACTTCGCTGA (SEQ ID NO. 10);

[0089] CBF1-R:ATCGTCTCCTCCATGTCCAG (SEQ ID NO. 11);

[0090] CBF2-F: TGACGTGTCCTTATGGAGCTA (SEQ ID NO. 12);

[0091] CBF2-R: CTGCACTCAAAAACATTTGCA (SEQ ID NO. 13);

[0092] CBF3-F:GATGACGACGTATCGTTATGGA (SEQ ID NO. 14);

[0093] CBF3-R: TACACTCGTTTCTCAGTTTTACAAAC (SEQ ID NO. 15);

[0094] COR15a-F: GCTTCAGATTTCGTGACGGATAAAAC (SEQ ID NO. 16);

[0095] COR15a-R: GCAAAACATTAAAGAATGTGACGGTG (SEQ ID NO. 17);

[0096] COR47-F: CAGTGTCGGAGAGTGTGGTG (SEQ ID NO. 18);

[0097] COR47-R:ACAGCTGGTGAATCCTCTGC (SEQ ID NO. 19);

[0098] KIN2-F: ACCAACAAGAATGCCTTCCA (SEQ ID NO. 20);

[0099] KIN2-R: CCGCATCCGATACACTCTTT (SEQ ID NO. 21);

[0100] ACTIN2-F: GGTAACATTGTGCTCAGTGGTGG (SEQ ID NO. 22);

[0101] ACTIN2-R: AACGACCTTAATCTTCATGCTGC (SEQ ID NO. 23).

[0102] The reaction procedure and reaction system are the same as in Example 1.

[0103] By detecting the expression levels of CORs genes, it was found that after cold treatment, the expression levels of CBF1, CBF2, and CBF3 genes in overexpressed Arabidopsis were significantly higher than those in WT; the expression levels of COR15a, COR47, and KIN1 genes showed a trend of first increasing and then decreasing, but their expression levels in overexpressed Arabidopsis were still significantly higher than those in WT ( Figure 7 ). The above results indicate that PgGRAS54 can induce the expression of downstream cold-responsive genes and thus enhance the cold tolerance of Arabidopsis thaliana.

[0104] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A light-responsive transcription factor gene PgGRAS54 of Pennisetum truncatum that improves plant cold tolerance, It is characterized in that The CDS sequence of the Pennisetum americanum light-responsive transcription factor gene PgGRAS54 is shown in SEQ ID NO.

9. 2 . A recombinant vector comprising the Pennisetum americanum light-responsive transcription factor gene PgGRAS54 according to claim 1 .

3. A recombinant bacterium comprising the recombinant vector according to claim 2.

4. Use of the Pennisetum americanum light-responsive transcription factor gene PgGRAS54 according to claim 1, the recombinant vector according to claim 2 or the recombinant bacteria according to claim 3 in improving the cold resistance of Arabidopsis thaliana.

5. A method for improving the cold tolerance of Arabidopsis thaliana, It is characterized in that The method comprises introducing the Pennisetum gracilis light-responsive transcription factor gene PgGRAS54 described in claim 1 into Arabidopsis thaliana to construct a transgenic strain with overexpression of PgGRAS54.

6. Use of the Pennisetum americanum light-responsive transcription factor gene PgGRAS54 according to claim 1, the recombinant vector according to claim 2, or the recombinant bacteria according to claim 3 in cultivating highly cold-resistant Arabidopsis thaliana.

Images