A molecular marker g8087186 for rapid identification of immunity of Tibetan sheep and its application

Abstract

The present invention belongs to the technical field of molecular biological detection, and in particular to a molecular marker g8087186 for rapid identification of Tibetan sheep immunity and its application. The present invention obtains a SNP molecular marker g8087186 related to Tibetan sheep immune traits by screening, which is located at the 8087186th base on chromosome 3 of the sheep reference genome group Oar_v4.0 version, and the mutant base is G or C. The SNP molecular marker can be used to obtain the content of immunoglobulin A, immunoglobulin G, and immunoglobulin M of Tibetan sheep individuals, and provides a new SNP molecular marker resource for marker-assisted selection of Tibetan sheep immune traits for non-diagnostic purposes. Provide a basis for breeding Tibetan sheep with high immunity.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biological detection, and in particular relates to a molecular marker g8087186 for rapidly identifying the immunity of Tibetan sheep and an application thereof. Background Art

[0002] Tibetan sheep are an important part of grassland animal husbandry in the high-altitude pastoral areas of the Qinghai-Tibet Plateau. The Tibetan sheep population is large and widely distributed, and has unique biological characteristics, providing many production and living resources for the Tibetan people. Due to the harsh environment in the Qinghai-Tibet Plateau, sheep with high immunity and high disease resistance are needed to adapt to the environmental conditions in the region. However, when selecting Tibetan sheep with high immunity and high disease resistance, there are still defects such as insufficient selection and breeding, small group size, and difficulty in meeting market demand. These defects affect the sustainable development of the Tibetan sheep industry.

[0003] Immune indicators can be used as an important reference to evaluate the disease resistance and health status of Tibetan sheep. By detecting changes in immune indicators, immune problems of Tibetan sheep can be discovered in time, and corresponding measures can be taken to improve their disease resistance, prevent and treat diseases. It can be seen that studying the immunity of Tibetan sheep can reflect the disease resistance of Tibetan sheep and provide an important basis for the auxiliary breeding of Tibetan sheep.

[0004] With the rapid development of molecular marker technology, in Tibetan sheep breeding, the mutation sites in genes are searched at the gene level, and the relationship between genes and traits is discovered through association analysis between genes and traits, so that early selection can be carried out to improve the efficiency and accuracy of seed selection, which has broad application value. Therefore, molecular markers provide a basis for people to study the genetic mechanism of immunity of Tibetan sheep at the molecular level, and screening corresponding molecular markers for more efficient use in Tibetan sheep breeding is an important issue in this field. There are not many molecular markers related to Tibetan sheep immunity in the prior art for molecular marker-assisted selection related to immunity. It is very important to provide a molecular marker related to the immune traits of Tibetan sheep, so as to be used in molecular marker-assisted breeding of Tibetan sheep to screen Tibetan sheep with high disease resistance. Summary of the invention

[0005] The purpose of the invention is to provide a molecular marker g8087186 for rapidly identifying the immunity of Tibetan sheep and an application thereof.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The invention provides a molecular marker g8087186 for rapidly identifying immunity of Tibetan sheep. The molecular marker g8087186 is located at the 8087186th base on chromosome 3 of the sheep reference genome Oar_v4.0 version, and the mutant base is G or C.

[0008] Preferably, the genotype of the Tibetan sheep with the mutant base G is GG or GC;

[0009] The genotype of Tibetan sheep with the mutant base C is CC;

[0010] The immunoglobulin content in Tibetan sheep with genotype GG was higher than that in Tibetan sheep with genotype GC or CC.

[0011] The immunoglobulin content in Tibetan sheep with genotype GC was higher than that in Tibetan sheep with genotype CC.

[0012] The immunoglobulin includes one or more of immunoglobulin A, immunoglobulin G and immunoglobulin M.

[0013] The present invention also provides the use of the molecular marker g8087186 in preparing a product for detecting the immunity of Tibetan sheep.

[0014] The present invention also provides the use of the molecular marker g8087186 in preparing a product for auxiliary breeding of Tibetan sheep.

[0015] The present invention also provides a primer pair for amplifying the molecular marker g8087186, and the primer pair is shown as SEQ ID NO.1-2.

[0016] The invention also provides application of the primer pair in preparing a product for detecting immunity of Tibetan sheep.

[0017] The present invention also provides application of the primer pair in preparing products for auxiliary breeding of Tibetan sheep.

[0018] The present invention also provides a kit for detecting the immunity of Tibetan sheep, comprising a reagent for detecting the molecular marker g8087186 or the primer pair.

[0019] The present invention also provides a kit for Tibetan sheep assisted breeding, comprising a reagent for detecting the molecular marker g8087186 or the primer pair.

[0020] The present invention provides a molecular marker g8087186 for rapid identification of Tibetan sheep immunity and its application. The molecular marker of the present invention is a SNP molecular marker, which is located at the 8087186th base on chromosome 3 of the international sheep reference genome Oar_v4.0 version; when the 8087186th base on the chromosome is G, the genotype is GG or GC; when the 8087186th base on the chromosome 3 is C, the genotype is CC; through the association analysis of different genotypes with immunoglobulin A, immunoglobulin G, and immunoglobulin M content, it is found that the immunoglobulin A, immunoglobulin G, and immunoglobulin M of the Tibetan sheep individual with the GG genotype are significantly higher than those of the GC and CC genotype individuals (p<0.05), and the immunoglobulin A, immunoglobulin G, and immunoglobulin M of the Tibetan sheep individual with the GC genotype are significantly higher than those of the CC genotype individual (p<0.05). By detecting the bases at the 8087186th nucleotide site on the third chromosome of Tibetan sheep, the content of immunoglobulin A, immunoglobulin G and immunoglobulin M of Tibetan sheep individuals can be obtained. The present invention provides a new molecular marker resource for marker-assisted selection of Tibetan sheep immune traits for non-diagnostic purposes, and provides a basis for breeding Tibetan sheep with high immunity. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 is the PCR amplification product; M represents Marker; 1, 2, and 3 represent three groups of repetitions.

[0022] Figure 2 The peak diagram and sequence are obtained after the PCR product is purified and sequenced. DETAILED DESCRIPTION

[0023] The invention provides a molecular marker g8087186 for rapidly identifying immunity of Tibetan sheep. The molecular marker g8087186 is located at the 8087186th base on chromosome 3 of the sheep reference genome Oar_v4.0 version, and the mutant base is G or C.

[0024] In the present invention, the genotype of the Tibetan sheep with the mutant base G is GG or GC;

[0025] The genotype of Tibetan sheep with the mutant base C is CC;

[0026] The immunoglobulin content in Tibetan sheep with genotype GG was higher than that in Tibetan sheep with genotype GC or CC.

[0027] The immunoglobulin content in Tibetan sheep with genotype GC was higher than that in Tibetan sheep with genotype CC.

[0028] The immunoglobulin includes one or more of immunoglobulin A, immunoglobulin G and immunoglobulin M.

[0029] The present invention also provides the use of the molecular marker g8087186 in preparing a product for detecting the immunity of Tibetan sheep.

[0030] The present invention also provides the use of the molecular marker g8087186 in preparing a product for auxiliary breeding of Tibetan sheep.

[0031] The present invention also provides a primer pair for amplifying the molecular marker g8087186, and the primer pair is shown as SEQ ID NO.1-2.

[0032] SEQ ID NO.1 is an upstream primer, and its sequence is: 5'-TGTTCCCTGCATTTCTTGGTT-3'; SEQ ID NO.2 is a downstream primer, and its sequence is: 5'-TTGTGGCTTCCAGGCTCTC-3'. In the present invention, the primer pair is synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0033] In the present invention, the length of the amplified fragment obtained by amplification using the primer pair is 581 bp, and the specific sequence is shown in SEQ ID NO. 3. SEQ ID NO. 3:.

[0034] In the present invention, the amplification system is 25 μL: 22 μL of gold mix (green), 1 μL of upstream and downstream primers, and 1 μL of genomic DNA.

[0035] PCR amplification program: 98°C for 2 min; 98°C for 10 s, 57°C for 10 s, 72°C for 10 s, for a total of 40 cycles; extension at 72°C for 2 min.

[0036] The invention also provides application of the primer pair in preparing a product for detecting immunity of Tibetan sheep.

[0037] The present invention also provides application of the primer pair in preparing products for auxiliary breeding of Tibetan sheep.

[0038] The present invention also provides a kit for detecting the immunity of Tibetan sheep, comprising a reagent for detecting the molecular marker g8087186 or the primer pair.

[0039] The present invention also provides a kit for Tibetan sheep assisted breeding, comprising a reagent for detecting the molecular marker g8087186 or the primer pair.

[0040] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0041] Example 1

[0042] 1. Sample collection

[0043] The samples came from Tibetan sheep populations under natural grazing conditions, including 58 samples from Gannan Tibetan Autonomous Prefecture, Gansu Province, 64 samples from Yushu Tibetan Autonomous Prefecture, Qinghai Province, and 50 samples from Shigatse City, Tibet Autonomous Region. 5 mL of blood samples were collected from 172 fasting Tibetan sheep and placed in a clean pro-coagulant vacuum blood collection tube, left to stand for 30 minutes, and then centrifuged at 3500r / min for 15 minutes. The supernatant was aspirated into a clean PE tube, which was sealed and stored in a -20℃ low-temperature refrigerator. Another 5 mL of blood sample was collected in a blood collection tube with EDTA-K2 anticoagulant added. After the blood sample was collected, it was quickly mixed and temporarily stored in a sampling box containing ice packs. After being transported back to the laboratory, it was frozen in a -20℃ refrigerator for extraction of genomic DNA.

[0044] 2 Main reagents and instruments

[0045] Blood collection tubes with EDTA-K2 anticoagulant were purchased from Jiangsu Yuli Medical Instrument Co., Ltd.; the blood genomic DNA extraction kit was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; NanoDrop2000 spectrophotometer was purchased from ThermoFisher Scientific, USA; DL2000 Marker, agarose, and nucleic acid dyes were purchased from Beijing Solebow Technology Co., Ltd.; Gold Medal Mix (green) was purchased from Beijing Qingke Biotechnology Co., Ltd.; electrophoresis instrument was purchased from Beijing Liuyi Instrument Factory; PCR instrument was purchased from BioRad. Immunoglobulin A (IgA) (E027-1-1), immunoglobulin G (IgG) (E026-1-1), and immunoglobulin M (IgM) (E025-1-1) detection kits were purchased from Nanjing Jiancheng Bioengineering Institute.

[0046] 3 Methods

[0047] 3.1 IgA, IgG, and IgM testing

[0048] According to the IgA, IgG, and IgM detection kits of Nanjing Jiancheng Bioengineering Institute, the determination was performed using a spectrophotometer. First, a standard curve was established using a standard product; secondly, distilled water, a standard solution, and 7 μL of the sample to be tested were added to the blank tube, standard tube, and measurement tube, respectively, and R1 solution was added to 900 μL, incubated at 37°C for 5 minutes, and the reading at a wavelength of 340 nm was recorded as A1; then 180 μL of R2 solution was added to each tube, incubated at 37°C for 5 minutes, and the reading at a wavelength of 340 nm was recorded as A2; finally, △A was calculated as A2-A1, and △A was substituted into the standard curve equation to calculate the sample IgA, IgG, and IgM concentrations.

[0049] 3.2 Extraction of genomic DNA from blood

[0050] The blood genome extraction kit of Tiangen Biochemical Technology (Beijing) Co., Ltd. was used to extract genomic DNA from the blood samples. The extracted DNA was placed under an ultraviolet spectrophotometer to detect the concentration and purity. The concentration was greater than 20 ng / μL and OD260 / OD280 was between 1.7 and 1.9, which met the experimental requirements. It was stored at -20°C for future use.

[0051] 3.3 Primer design

[0052] Referring to the chromosome 3 gene sequence of the international sheep genome Oar_v4.0 version (GenBank accession number: NC_019460.2), a pair of specific primers were designed using primerpremier5.0 software, and the nucleotides of the primer pair are shown in SEQ ID NO.1-2. SEQ ID NO.1 is the upstream primer, and its sequence is: 5'-TGTTCCCTGCATTTCTTGGTT-3'; SEQ ID NO.2 is the downstream primer, and its sequence is: 5'-TTGTGGCTTCCAGGCTCTC-3'.

[0053] The length of the amplified fragment was 581 bp, and the primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0054] 3.4 PCR amplification and sequencing

[0055] PCR amplification system 25 μL: Gold Mix (green) 22 μL, upstream and downstream primers 1 μL each, genomic DNA 1 μL.

[0056] PCR amplification program: 98°C for 2 min; 98°C for 10 s, 57°C for 10 s, 72°C for 10 s, for a total of 40 cycles; extension at 72°C for 2 min.

[0057] The PCR product was detected by 1.5% agarose gel electrophoresis. After the PCR product was qualified by agarose gel electrophoresis, it was sequenced by direct sequencing, and the sequencing was completed by Beijing Qingke Biotechnology Co., Ltd. The amplified nucleotide sequence is shown in SEQ ID NO.3, and the SNP marker is located at position 499 of the nucleotide sequence described in SEQ ID NO.3.

[0058] The biological analysis software MEGA6.0 was used to compare the sequencing results of PCR products, analyze the sequencing peak graph, and complete the typing.

[0059] SEQ ID NO.3: TGTTCCCTGCATTTCTTGGTTCATAGCCCCTTCCATCCATCTTCCAAGTCAGCCCTGTAGGGCTGAGTCCTTCTCACGAAGCCATCTCTGTTTTCCTTCAGTCTCTCTCTTTCACACTGAAGGATACTTGTAATTACATTGGATGTAGTCACACTCAGATAATCCAGAATAATCTCCCTATTTTAAGGTTAGCTGATTAGCAACTTCAATTCCGTC TGCAACCTGAACTCCACTTTGCCAGGTAGCCTCATGTACTCATACTAATCCCAGGATTAGAATGGGGATATCTTGGGAATTCCTCGGTGGTCCAGTGGTTAAGACTTAGGGCTTTCATTGCTGTGGCCCCAGCTTGACTTCTGGTTTGGAAAGGAAGAGCCCGTAAGCCACATGGTACAGCCAAATTAAAAAAAAAAAAAGATAAAGGCCTTCTCTGGTGG CTCATGGTAAAGAATCTACCTGCCGATACAGGAAACACGGGTTCGATCCCTGATCCGTGAAGATCCCACAAGCCACAGAGCGACTAAGCCTGAGCACCACCACTACTGAGCCTGTGCTCGAGAGCCTGGAAGCCACAA.

[0060] 4 Statistical analysis

[0061] According to the genotyping results, the number of individuals with different genotypes at each site was counted. Popgen32 software was used to calculate the g8087186G>C gene frequency, genotype frequency, effective allele number (Ne), site heterozygosity (He), and Hardy-Weinberg equilibrium test, and PIC (polymorphism information content, referred to as PIC) calculation software was used to calculate the polymorphic information content. The general linear model in IBM SPSS Statistics 22 software was used to analyze the association between different genotypes of Tibetan sheep and IgA, IgG, and IgM, and the results were expressed as "mean ± standard error".

[0062] 5 Results

[0063] 5.1 PCR amplification and sequencing results

[0064] The amplified product of the g8087186G>C SNP site on chromosome 3 of Tibetan sheep was detected by 1.5% agarose gel (see Figure 1 ), the bands were clear without any other bands, the specificity was good, and the PCR product fragment size was 581bp, which was in line with the expected size, so the next step of the experiment could be carried out.

[0065] The peak diagram and sequence obtained after the PCR product was purified and sequenced are shown in Figure 2 .Depend on Figure 2 It can be seen that a GC mutation occurred at the g8087186G>CSNP site, and there are three genotypes: GG, GC, and CC.

[0066] 5.2 Statistical analysis results

[0067] The genotype and allele frequencies of the g8087186G>CSNP locus on chromosome 3 of Tibetan sheep were analyzed from the perspective of population genetics. As shown in Table 1, at the g8087186G>C SNP locus, the CC genotype frequency was the highest, which was the dominant genotype, and the C allele frequency was 91.6%, which was a dominant allele. The χ2 fitness test showed that the SNP locus deviated significantly from the Hardy-Weinberg equilibrium state (P<0.05) (Table 1). The expected heterozygosity of this locus was 1.180, the PIC was 0.140, and the PIC was <0.25, which was a low degree of polymorphism.

[0068] Table 1 Polymorphism of g8087186G>CSNP locus on chromosome 3 of Tibetan sheep

[0069]

[0070] 5.3 Association analysis between different genotypes and IgA, IgG, and IgM

[0071] The general linear model in IBM SPSS Statistics 22 software was used to analyze the association between different genotypes of Tibetan sheep and the content of immunoglobulins IgA, IgG, and IgM. The results showed that the immunoglobulins IgA, IgG, and IgM of Tibetan sheep individuals with GG genotype were significantly higher than those of individuals with GC and CC genotypes (p<0.05), and the immunoglobulins IgA, IgG, and IgM of Tibetan sheep individuals with GC genotype were significantly higher than those of individuals with CC genotype (p<0.05), indicating that the base of the g8087186G>CSNP site on chromosome 3 of Tibetan sheep is significantly correlated with IgA, IgG, and IgM of Tibetan sheep, and is a SNP marker related to IgA, IgG, and IgM of Tibetan sheep. The results are shown in Table 2.

[0072] Table 2 Relationship between different genotypes and immunoglobulins A, G and M

[0073]

[0074] Note: Different lowercase letters between data in the same row indicate significant differences (P<0.05).

[0075] The invention provides a molecular marker g8087186 for rapidly identifying the immunity of Tibetan sheep and application thereof. The molecular marker of the invention is a SNP molecular marker, which is located at the 8087186th base on chromosome 3 of the international sheep reference genome Oar_v4.0 version; the variation type is G / C, named g8087186G>C, and there are three genotypes, when the 8087186th base on chromosome 3 is G, the genotype is GG or GC; when the 8087186th base on chromosome 3 is C, the genotype is CC; through the association analysis between different genotypes and the contents of immunoglobulin A, immunoglobulin G and immunoglobulin M, it is found that the immunoglobulin A, immunoglobulin G and immunoglobulin M of the Tibetan sheep individual with the GG genotype are significantly higher than those of the GC and CC genotype individuals (p<0.05), and the immunoglobulin A, immunoglobulin G and immunoglobulin M of the Tibetan sheep individual with the GC genotype are significantly higher than those of the CC genotype individual (p<0.05). By detecting the bases at the 8087186th nucleotide site on the third chromosome of Tibetan sheep, the content of immunoglobulin A, immunoglobulin G and immunoglobulin M of Tibetan sheep individuals can be obtained. The present invention provides a new molecular marker resource for marker-assisted selection of Tibetan sheep immune traits for non-diagnostic purposes, and provides a basis for breeding Tibetan sheep with high immunity.

[0076] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Application of a reagent for rapid identification of Tibetan sheep immunity molecular marker g8087186 in the preparation of a product for detecting Tibetan sheep immunity, characterized in that: The Tibetan sheep immunity molecular marker g8087186 is located at the 8087186th base on chromosome 3 of the sheep reference genome Oar_v4.0 version, and the mutant base is G or C; According to the molecular marker alleles of Tibetan sheep immunity, Tibetan sheep have three genotypes: CC, GC or GG; The immunoglobulin content in Tibetan sheep with genotype GG was higher than that in Tibetan sheep with genotype GC or CC. The immunoglobulin content in Tibetan sheep with genotype GC was higher than that in Tibetan sheep with genotype CC. The reagent is a primer pair, and the primer pair is shown in SEQ ID NO.1~2.

2. The use according to claim 1, characterized in that The immunoglobulin is one or more of immunoglobulin A, immunoglobulin G and immunoglobulin M.

3. Application of a kit for detecting Tibetan sheep immunity molecular marker g8087186 in detecting Tibetan sheep immunity, characterized in that: The Tibetan sheep immunity molecular marker g8087186 is located at the 8087186th base on chromosome 3 of the sheep reference genome Oar_v4.0 version, and the mutant base is G or C; According to the molecular marker alleles of Tibetan sheep immunity, Tibetan sheep have three genotypes: CC, GC or GG; The immunoglobulin content in Tibetan sheep with genotype GG was higher than that in Tibetan sheep with genotype GC or CC. The immunoglobulin content in Tibetan sheep with genotype GC was higher than that in Tibetan sheep with genotype CC.

Images