A liquid phase chip of wheat 2K+ fusarium head blight resistance loci and its application

Abstract

The present invention discloses a liquid phase chip of wheat 2K+fusarium head blight resistance loci and its application, wherein the genotyping objects of the liquid phase chip include 2274 single copy SNP loci located in 100 high confidence QTL intervals of fusarium head blight resistance in the wheat reference genome, and the position information of the 2274 SNP loci on the wheat reference genome is shown in Table 2 of the specification. The liquid phase chip of wheat 2K+fusarium head blight resistance loci of the present invention improves the coverage and accuracy of QTL in the study of fusarium head blight resistance, improves the throughput and efficiency of marker-assisted selection, and reduces the cost of genotype analysis.

Description

Technical Field

[0001] The invention belongs to the technical field of gene chips, and in particular relates to a wheat 2K+fusarium head blight resistance site liquid phase chip and application thereof. Background Art

[0002] Wheat fusarium head blight is a worldwide wheat disease. Breeding disease-resistant varieties and supplementing it with preventive drugs is an ideal and reliable prevention and control strategy. Conventional breeding has played an irreplaceable role in breeding fusarium head blight-resistant varieties and ensuring food security in the past, present and foreseeable future. However, it is undeniable that conventional breeding has problems such as low predictability and reproducibility of results. This is mainly because fusarium head blight resistance is a complex quantitative trait controlled by multiple genes, and the inheritance of resistance is relatively complex. Most breeders have limited knowledge of the background information of resistance sources and the composition of resistance. Coupled with technical limitations, the efficiency of improving fusarium head blight resistance is not high.

[0003] Traditional molecular-assisted selection breeding can only track 1-5 loci at present, and it is difficult to track or use more than 5 loci at the same time, let alone track hundreds of loci at the same time. The high-throughput molecular marker-assisted selection breeding system for wheat resistance to Fusarium head blight has not been effectively established. Currently, more than 600 QTLs (quantitative trait locus) have been reported to be related to Fusarium head blight resistance, but most of the QTLs are poorly robust. In addition, due to theoretical and technical limitations, only a very small number of loci are used for Fusarium head blight resistance breeding.

[0004] With the development of genome sequencing technology, the cost of wheat resequencing and chip development has been greatly reduced, thereby reducing the cost of genotype analysis. Among them, chips are characterized by high efficiency and convenience, and are widely used in wheat genetic breeding. Up to now, wheat SNP chips developed at home and abroad include 820K, 660K, 90K, 55K, 16K, 15K and 9K SNP solid phase or liquid phase chips, and some chips for breeding purposes are also being developed. These chips are of great use in wheat gene mapping, but the SNPs of existing chips are sparsely or extremely unevenly distributed in the high-confidence QTL intervals related to Fusarium resistance that we established. If multi-copy markers, high heterozygosity and highly skewed segregation markers in natural populations are eliminated, the coverage rate will be even lower, and about 1 / 4 of the high-confidence QTLs have no markers available. Summary of the invention

[0005] In view of the shortcomings of the prior art, the present invention provides a wheat 2K+ ergot resistance locus liquid phase chip and its application, which improves the coverage and accuracy of QTL in ergot resistance research, improves the throughput and efficiency of marker-assisted selection, and reduces the cost of genotype analysis.

[0006] The present invention is achieved through the following technical solutions:

[0007] A liquid phase chip for wheat 2K+ fusarium head blight resistance loci, wherein the genotyping objects of the liquid phase chip include 2274 single copy SNP loci located in 100 high confidence QTL intervals of fusarium head blight resistance in the wheat reference genome, and the position information of the 2274 SNP loci on the wheat reference genome is shown in Table 2.

[0008] Preferably, the 100 high-confidence QTL intervals for fusarium head blight resistance are identified by performing QTL meta-analysis based on a high-density integrated genetic map of wheat and directly based on a Chinese Spring sequencing map, and by comparing and integrating the two meta-analysis results.

[0009] Preferably, the wheat reference genome is based on the genome of the wheat sequenced variety Chinese Spring IWGSCreference genome v2.1 as a reference sequence, and also refers to the wheat resequencing database.

[0010] Preferably, each SNP site corresponds to two probe sequences, namely a forward probe and a reverse probe, with a total length of 201bp; the probe sequence of the SNP site is determined in the following manner: according to the probe target position, it is extended 100bp forward and backward from the position on the corresponding reference genome sequence.

[0011] The above-mentioned wheat 2K+ ergot resistance locus liquid phase chip is used in the positioning of wheat ergot resistance candidate genes, genetic diversity analysis, variety identification, kinship identification, haplotype analysis, germplasm resource evaluation and new germplasm creation, association analysis, and genomic selection breeding.

[0012] The beneficial effects of the present invention are as follows:

[0013] (1) The present invention optimizes the design of the wheat ergot resistance chip by using 100 high-confidence QTLs on 21 wheat chromosomes as probe targets, thereby improving the coverage and accuracy of QTLs in ergot resistance research, increasing the throughput and efficiency of marker-assisted selection, and reducing the cost of genotype analysis.

[0014] (2) The present invention screened out 2274 SNP sites that can be used for chip design from large-scale resequencing data. Compared with the SNP sites designed in existing commercial chips, the sources of these sites cover the QTL sites for resistance to ergot published domestically and abroad, and are more targeted, which is conducive to the tracking and precise utilization of ergot resistance sites and haplotypes at home and abroad.

[0015] (3) The present invention is suitable for targeted capture sequencing technology (i.e., constructing a liquid phase chip). Through the corresponding probe design, not only the probe target point can be typed, but also the amplified area around the probe target point can be typed. Therefore, compared with solid or liquid phase chips with the same number of probes, more SNP variation sites can be detected in the high-confidence QTL interval. At the same time, the number and accuracy of detection sites are increased while the typing cost is significantly reduced. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 The chromosome distribution statistics of SNP markers of 12 samples in Example 2;

[0017] Figure 2 Comparison of the prediction ability of 249 wheat varieties in Example 3 on the wheat 2K+ chip and 16K chip genome: A is the best linear unbiased estimate (BLUP) of diseased spikelet rate as the phenotype; B is the BLUP value of DON content as the phenotype;

[0018] Figure 3 The population structure of 491 wheat varieties analyzed using the wheat 2K+ chip in Example 4: A is the calculated K value; B is the phylogenetic tree of the 491 wheat varieties. DETAILED DESCRIPTION

[0019] The present invention is further described in detail below with reference to the accompanying drawings and specific embodiments.

[0020] Example 1 Preparation of Wheat 2K+ Fusarium Scab Resistance Site Liquid Phase Chip

[0021] The chip loci designed in this example are based on the wheat high-density integrated genetic map and directly based on the Chinese Spring sequencing map for QTL meta-analysis. By comparing and integrating the two meta-analysis results, taking into account the robustness and chromosome distribution of QTL, 100 high-confidence QTL intervals were identified. The details are as follows:

[0022] 1. Site selection

[0023] The QTLs for resistance to fusarium head blight identified in important resistance sources at home and abroad from 2000 to date were subjected to meta-analysis based on genetic maps and meta-analysis based on wheat reference genome and QTL. Through comprehensive analysis and comparison, 100 high-confidence QTL intervals on 21 chromosomes of wheat were located, as shown in Table 1. These high-confidence QTLs represent the robust and major resistance loci carried by wheat fusarium head blight resistance sources at home and abroad, providing great convenience for the improvement of fusarium head blight resistance. The wheat reference genome uses the Chinese Spring genome IWGSC reference genome v2.1 (IWGSC, 2018) as the reference sequence, and also refers to the wheat resequencing database (source: http: / / wheat.cau.edu.cn / WheatUnion / ; http: / / wheatomics.sdau.edu.cn / ; local database, etc.).

[0024] Reliable and high-resolution SNP markers were screened based on information such as the separation ratio, copy number, and heterozygosity of SNPs in the population. These markers represent all high-confidence QTL intervals. The markers in the intervals are evenly distributed and representative, which is convenient for wheat breeding and resource identification. On average, there are 20 SNP markers for each high-confidence QTL site, and each SNP site corresponds to at least two probe sequences, namely forward probes and reverse probes, with a total length of 201bp, to ensure the success rate of site design and detection.

[0025] Table 1 Information of 100 high-confidence QTLs

[0026]

[0027]

[0028]

[0029]

[0030] 2. Final determination of chip sites and results

[0031] After the target capture region corresponding to the locus and the location information of the locus were sent to Shijiazhuang Boredy Biotechnology Co., Ltd. for scoring, the probe loci that were not recommended for design were removed. The chip loci were screened for SNP markers in the 100 high-confidence QTL intervals in Table 1, and the spacing on the wheat reference genome was within 20 Kb.

[0032] Results: A total of 30,539 loci were transferred to reference and site verification, followed by site evaluation of the successfully verified loci, and finally 2,274 loci were selected (Table 2).

[0033] Table 2 Chip site information (sites located on the reference genome)

[0034]

[0035]

[0036]

[0037]

[0038]

[0039]

[0040]

[0041]

[0042]

[0043]

[0044]

[0045]

[0046]

[0047]

[0048]

[0049]

[0050]

[0051]

[0052]

[0053] Note to Table 2: Chrom indicates the chromosome where the site is located. Since the probe target is selected based on the SNP site on the reference genome, the position (POS) information and allele information of the SNP site on the reference genome are provided.

[0054] 3. Obtain the probe corresponding to the site

[0055] According to the SNP position information in Table 2, a probe was designed on the reference genome. According to the probe target position, 100 bp was extended forward and backward from the position on the corresponding reference genome sequence, and finally a total of 201 bp of bases including the site were selected as the probe sequence of the site.

[0056] Finally, the designed probes were synthesized to obtain the wheat 2K+ fusarium head blight resistance locus liquid phase chip (hereinafter referred to as wheat 2K+ chip).

[0057] The site adopts the following probe sequence site, taking a SNP site (A / G) in Table 2 as an example:

[0058] CCCAAATATAGCACTTATTTCTATTTGTCATCCCTCGTTTGTCCCCTGGC TCACGCTTCTGGTGTTACCATAGAAGTTGTCGCTTTAGACATCAAACATC[A / G]ACACATTCTTCAAAATGTTGCTTTTGACCATTATTTTTTTATTATACCATATT ATAAAAGTTTTATAATATTGTAACTTGAGAAGACACTTCTCAAACGA

[0059] In the above probe sequence, the forward probe (SEQ ID NO.1) is 100 bp forward of the SNP site (A / G) in the sequence: 5'-CCCAAATATAGCACTTATTTCTATTTGTCATCCCTCGTTT GTCCCCTGGCTCACGCTTCTGGTGTTACCATAGAAGTTGTCGCTTTAGACAT CAAACATC-3'; the reverse probe (SEQ ID NO.2) is 100 bp backward of the SNP site (A / G) in the sequence: 3'-ACACATTCTTCAAAATGTTGCTTTTGACCATTATTTTTTTATTAT ACCATATTATAAAAGTTTTATAATATTGTAACTTGAGAAGACACTTCTCAAAC GA-5'.

[0060] 4. Process of genotyping wheat DNA samples using the wheat 2K+ chip

[0061] (1) Obtaining DNA samples

[0062] A high-throughput DNA extraction kit was used to extract sample DNA. The extracted DNA samples were subjected to the following two tests:

[0063] ① The purity and integrity of DNA were analyzed using 1% agarose gel electrophoresis.

[0064] ② Use Qubit to accurately quantify DNA concentration.

[0065] (2) Gene chip detection

[0066] Follow the standard liquid phase chip detection process.

[0067] (3) Data analysis

[0068] Data quality control (removal of adapters and low-quality data), comparison with the reference genome, variant detection and annotation, and other analyses.

[0069] Example 2 Variety genotype analysis based on wheat 2K+ chip

[0070] 12 wheat varieties from different regions were randomly selected, and the wheat 2K+ chip prepared in Example 1 was used to detect the 12 samples, and the typing results of the wheat liquid phase chip raw data were collected. The results are shown in Table 3 and Figure 1 As shown, the average site detection rate of the wheat 2K+ chip is 98.168%, which meets the requirements for wheat marker chip development.

[0071] Table 3 SNP detection rates of 12 samples

[0072] Sample name Number of SNP deletion sites Number of SNP detection sites Total number of SNP sites SNP detection rate (%) S1 38 2236 2274 98.329 S2 40 2234 2274 98.241 S3 32 2242 2274 98.593 S4 19 2255 2274 99.165 S5 32 2242 2274 98.593 S6 46 2228 2274 97.977 S7 42 2232 2274 98.153 S8 45 2229 2274 98.021 S9 38 2236 2274 98.329 S10 32 2242 2274 98.593 S11 42 2232 2274 98.153 S12 94 2180 2274 95.866 Average detection rate - - - 98.168

[0073] Example 3 Application of wheat 2K+ chip in genomic selection

[0074] Breeding varieties and some excellent strains from 1980 to 2022 in Jiangsu Province, Huainan City and Huaibei City were collected, and parent materials for genetic mapping of QTL for fusarium resistance reported at home and abroad were added. These materials were distributed from high resistance, medium resistance, medium sensitivity and high sensitivity, totaling 491 varieties. After DNA was extracted from these samples, the 491 samples were tested using the wheat 2K+ chip prepared in Example 1, and 249 varieties were randomly selected for 16K (16000SNP) commercial liquid phase probe analysis (hereinafter referred to as 16K chip) to compare the ability of wheat 2K+ chip and 16K chip in genome prediction. A whole-genome selection model was constructed by combining the genotyping process described in Example 1 and the best linear unbiased estimate (BLUP) of the diseased spikelet rate and the BLUP data of the DON toxin content identified in two different environments, the mist field and the growth chamber. At the same time, a whole-genome selection model was also constructed using the wilt rate as a phenotype, and the prediction capabilities of the wheat 2K+ chip and 16K chip on different whole-genome selection models (BayesA, BayesB, BayesC, Bayes Lasso, Bayesian Ridge Regression, GBLUP) were compared.

[0075] The results are as follows Figure 2 As shown in the figure, it can be seen that the model prediction ability of the wheat 2K+ chip is better than that of the 16K chip, especially in the prediction of DON toxin content ( Figure 2 (middle B).

[0076] Example 4: Utilization of wheat 2K+ chip in population structure

[0077] The correlation between the 491 varieties of wheat materials described in Example 3 was estimated using two statistical methods, population structure and neighbor-joining method, and the maximum value was reached when K=2.

[0078] like Figure 3 The results showed that these 491 wheat varieties can be divided into two different subgroups ( Figure 3 The genetic differentiation index between the two subpopulations was 0.64 ( Figure 3 A in the middle), indicating a high level of genetic variation between the associated groups. Subgroup I had 206 wheat varieties with an average proportion of symptomatic spikelets (PSS) of 0.513 and a DON content of 18.18 ppm; subgroup II had 176 wheat varieties with an average PSS of 0.425 and a DON content of 13.08 ppm; wheat varieties from Jiangsu Province were distributed in both subgroups (e.g. Figure 3As shown in B, red represents wheat varieties in Jiangsu Province), indicating that there may be obvious differentiation among wheat varieties in Jiangsu Province in the high-confidence QTL interval for Fusarium head blight resistance.

[0079] It can be seen from the experimental results of the above embodiments that the wheat 2K+fusarium head blight resistance site liquid phase chip of the present invention represents the robust and major resistance sites carried by wheat fusarium head blight resistance sources at home and abroad, greatly improving the coverage and accuracy of QTL in fusarium head blight resistance research, improving the flux and efficiency of marker-assisted selection, and is the first chip specifically used for improving fusarium head blight resistance at home and abroad. At the same time, the cost of genotyping is lower than other solid or liquid phase chips. In addition, the wheat 2K+fusarium head blight resistance site liquid phase chip of the present invention has flexibility in use and upgrade, which is reflected in the fact that there is no sample limit for a single test, no initial sample amount limit for customization and use, and no adjustment of existing probes is required when adding new probes in the later stage, ensuring the flexibility of upgrade.

[0080] The embodiments described above are only some embodiments of the present invention, rather than all embodiments. The detailed description of the embodiments of the present invention is not intended to limit the scope of the invention claimed for protection, but merely represents selected embodiments of the present invention. The scope of protection of the present invention shall be subject to the scope required by the claims. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work shall fall within the scope of protection of the present invention.

Claims

1. A wheat 2K+ fusarium head blight resistance site liquid phase chip, characterized in that: The genotyping objects of the liquid phase chip include 2274 single-copy SNP sites located in 100 high-confidence QTL intervals of fusarium head blight resistance in the wheat reference genome; each SNP site corresponds to two probe sequences, namely a forward probe and a reverse probe, with a total length of 201 bp; The probe sequence of the SNP site is determined in the following manner: according to the probe target position, the probe is extended forward and backward 100 bp from the position on the corresponding reference genome sequence, and the probe 100 bp forward of the SNP site in the sequence is the forward probe, and the probe 100 bp backward of the SNP site in the sequence is the reverse probe; The wheat reference genome is based on the IWGSC reference genome v2.1 of the wheat sequenced variety Chinese Spring, and also refers to the wheat resequencing database; Among them, the location information of 2274 SNP loci on the wheat reference genome is as follows: Among them, Chrom represents the chromosome where the site is located, POS represents the position information, and Alle represents the allele information.

2. A wheat 2K+ fusarium head blight resistance site liquid phase chip according to claim 1, characterized in that: The 100 high-confidence QTL intervals for ergot resistance were identified through QTL meta-analysis based on a high-density integrated genetic map of wheat and directly based on a Chinese Spring sequencing map, and by comparing and integrating the two meta-analysis results.

3. Application of the wheat 2K+ ergot resistance locus liquid phase chip as described in claim 1 or 2 in the positioning of wheat ergot resistance candidate genes, genetic diversity analysis, variety identification, kinship identification, haplotype analysis, germplasm resource evaluation and new germplasm creation, association analysis, and genomic selection breeding.

Images