A method for preparing functional bacterial flora for carbon fixation and pollution elimination in organic polluted soil

Abstract

The present invention relates to the technical field of soil microbial remediation, and specifically to a method for preparing a functional bacterial community for carbon fixation and pollution elimination in organic polluted soil, comprising the following steps: S1, first bacterial species cultivation: obtaining a single bacterium Sphingobium sp.RS2; S2, second bacterial species cultivation: obtaining a single bacterium Nitrososphaera viennensis.EN76; S3, cell number quantification; S4, single bacteria mixing: mixing a single bacterium Sphingobium sp.RS2 and a single bacterium Nitrososphaera viennensis.EN76 at a cell number of 1:1 to obtain a functional bacterial community. The functional bacterial community obtained by the method of the present invention is simple to cultivate, has low compounding difficulty, is easy to operate, can not only repair phenanthrene-contaminated farmland soil and reduce its threat to agricultural product safety, but also can fix CO2, increase the SOC content in farmland soil, achieve the goals of carbon peak and carbon neutrality, and provide technical support and theoretical support for carbon fixation and pollution elimination in farmland soil.

Description

Technical Field

[0001] The present invention relates to the technical field of soil microbial remediation, and in particular to a method for preparing a functional bacterial community for carbon fixation and pollution elimination in organically contaminated soil. Background Art

[0002] Polycyclic aromatic hydrocarbons (PAHs) are a class of refractory organic pollutants containing multiple benzene rings. They are genotoxic, mutagenic and carcinogenic. PAHs in the natural environment mainly come from coking, oil refining, coal combustion, and straw and firewood burning. Soil is one of the main places where PAHs are enriched in the environment. PAHs that enter the soil can be adsorbed by organic matter and are difficult to eliminate, leading to soil pollution. Farmland is the main body of agricultural production, and the problem of PAHs pollution in farmland soil will threaten the quality of agricultural products and human health. Therefore, the problem of PAHs pollution in farmland soil should be given sufficient attention.

[0003] Soil is the largest carbon pool on land, and 25% of potential global climate problems are caused by soil carbon. Therefore, soil is very important for reducing carbon emissions and increasing carbon sinks, and has a reliable ecological function in mitigating climate change.

[0004] How to efficiently treat PAHs in soil is still a key issue that needs to be solved urgently. Biodegradation by microorganisms can decompose harmful organic pollutants into non-toxic or low-toxic products, which is safe, economical and easy to use. At the same time, microorganisms in the soil also play a key role in the formation of soil organic carbon and maintaining the persistence of organic carbon. At present, many domestic and foreign experts have screened strains with PAHs degradation function, but there are few reports on the preparation technology of microbial functional flora that can simultaneously achieve phenanthrene degradation and CO2 fixation in soil. Summary of the invention

[0005] In order to solve the above problems, the present invention provides a method for preparing a functional bacterial community for carbon fixation and pollution removal in organic contaminated soil, comprising the following steps:

[0006] S1. First strain culture: Take Sphingobium sp. RS2 strain and use LB medium to activate and culture it to obtain Sphingobium sp. RS2 single strain for standby use;

[0007] S2, second bacterial strain culture: take Nitrososphaera viennensis.EN76 bacterial strain and culture it in a constant temperature incubator in the dark to obtain a single Nitrososphaera viennensis.EN76 bacterial strain for standby use;

[0008] S3, cell number quantification: the single-copy gene nahE was used to quantify the cell number in the Sphingobium sp.RS2 single bacterium prepared in S1, and the single-copy gene amoA was used to quantify the cell number in the Nitrososphaera viennensis.EN76 single bacterium prepared in S2;

[0009] S4, single bacteria mixing: the Sphingobium sp. RS2 single bacteria and the Nitrososphaeraviennensis.EN76 single bacteria were mixed at a ratio of 1:1 in terms of cell number, and the cell number was 10 8 , and obtain functional bacterial flora.

[0010] Furthermore, in S1, the activation culture method is: adding an inoculation loop of Sphingobium sp.RS2 strains into 20-30 mL LB culture medium, culturing the Sphingobium sp.RS2 strains to the logarithmic growth phase, centrifuging, removing the supernatant to obtain a Sphingobium sp.RS2 precipitate, adding an inorganic salt culture medium to the Sphingobium sp.RS2 precipitate for resuspending, repeating the above centrifugation and resuspension steps 2-3 times, and obtaining the Sphingobium sp.RS2 single bacteria after the last resuspension.

[0011] Furthermore, the culture conditions for culturing the Sphingobium sp. RS2 strain to the logarithmic growth phase are: a temperature of 28-32° C. and shaking culture at a rotation speed of 120-160 rpm for 10-15 hours.

[0012] Furthermore, the centrifugal treatment conditions are: temperature of 3-5°C, centrifugation at a speed of 7500-8500 rpm for 4-6 min.

[0013] Furthermore, in S2, the temperature of the constant temperature incubator is 40-43°C, and during the continuous light-proof culture process, each culture is carried out to the logarithmic growth phase to obtain the Nitrososphaera viennensis.EN76 single bacterium.

[0014] Furthermore, in S3, the method for quantifying the number of cells in the single bacterium Sphingobium sp. RS2 prepared in S1 is:

[0015] Primers are designed based on the gene sequence of the single-copy gene nahE, the primers include a forward primer and a reverse primer, the sequence of the forward primer is shown in SEQ ID NO.1, the sequence of the reverse primer is shown in SEQ ID NO.2,

[0016] SEQ ID NO.1:TTGGCGTGCCGATGTGGTG

[0017] SEQ ID NO.2: GCGGGAAATCGAATTTGAAGG

[0018] The primers are subjected to PCR amplification to obtain a gene sequence, and the gene sequence is introduced into a plasmid to construct a standard plasmid, and then the standard plasmid is subjected to 10-fold gradient dilution to obtain a template DNA, and then fluorescent quantitative PCR is performed to obtain a standard curve, and then a DNA extraction kit is used to extract 1 mL of DNA of a single bacterium Sphingobium: sp. Rs2, and fluorescent quantitative PCR is performed to obtain a CT value, and the copy number is calculated according to the CT value. The copy number of a single copy gene represents the number of cells per microliter.

[0019] Furthermore, the reaction system of the fluorescent quantitative PCR is as follows:

[0020] Reagents volume Ace qPCR SYBR Green Master Mix 10 μL Forward Primer 0.4 μL Reverse primer 0.4 μL Template DNA 1 μL <![CDATA[ddH2O]]> 8.2 μL

[0021] The program conditions of the fluorescent quantitative PCR are as follows: the template DNA is pre-denatured and heated at 95°C for 5 minutes, then denatured and heated at 95°C for 10 seconds, annealed for 30 seconds at 56°C, extended for 30 seconds at 72°C, and a total of 40 cycles are completed. The melting curve analysis is performed under the analysis conditions of heating at 95°C for 15 seconds, cooling to 60°C and heating for 1 minute, and heating to 95°C and holding for 1 second.

[0022] Furthermore, in S3, the method for quantifying the number of cells in the Nitrososphaera viennensis.EN76 single bacteria prepared in S2 is:

[0023] Primers are designed based on the gene sequence of the single-copy gene amoA, the primers comprising a forward primer and a reverse primer, the sequence of the forward primer is shown in SEQ ID NO.3, the sequence of the reverse primer is shown in SEQ ID NO.4,

[0024] SEQ ID NO.3: TCGGTCTCGGATACTTGAA

[0025] SEQ ID NO.4: GCACGCTGTCATCATCAT

[0026] The primers are subjected to PCR amplification to obtain a gene sequence, and the gene sequence is introduced into a plasmid to construct a standard plasmid, and then the standard plasmid is subjected to 10-fold gradient dilution to obtain a template DNA, and then fluorescent quantitative PCR is performed to obtain a standard curve, and then 1 mL of DNA of Nitrososphaera viennensis.EN76 single bacteria is extracted using a DNA extraction kit, and fluorescent quantitative PCR is performed to obtain a CT value, and the copy number is calculated according to the CT value. The copy number of a single copy gene represents the number of cells per microliter.

[0027] Furthermore, the reaction system of the fluorescent quantitative PCR is as follows:

[0028] Reagents volume Ace qPCR SYBR Green Master Mix 10 μL Forward Primer 0.4 μL Reverse primer 0.4 μL Template DNA 1 μL <![CDATA[ddH2O]]> 8.2 μL

[0029] The program conditions of the fluorescent quantitative PCR are as follows: the template DNA is pre-denatured and heated at 95°C for 5 minutes, then denatured and heated at 95°C for 10 seconds, annealed for 30 seconds at 60°C, extended for 30 seconds at 72°C, and a total of 40 cycles are completed. The melting curve analysis is performed under the analysis conditions of heating at 95°C for 15 seconds, cooling to 60°C and heating for 1 minute, and heating to 95°C and holding for 1 second.

[0030] Preferably, the method further comprises: verifying the feasibility of the designed primers by agarose gel electrophoresis.

[0031] Compared with the prior art, the present invention has the following beneficial effects:

[0032] (1) In the preparation method of the functional bacterial community for carbon fixation and pollution removal in organic contaminated soil of the present invention, the bacterial strain is simple to culture, the difficulty of compounding is low, and it is easy to operate. It can not only repair the phenanthrene-contaminated farmland soil and reduce its threat to the safety of agricultural products, but also fix CO2 and increase the SOC content in the farmland soil.

[0033] (2) The functional bacterial community prepared by the method of the present invention can be used to repair PAHs-contaminated farmland soil, which can provide technical and theoretical support for carbon fixation and pollution removal in farmland soil. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 This is a standard curve diagram of the single copy gene nahE used for quantification of strain Sphingobium sp. RS2 in Example 1 of the present invention;

[0035] Figure 2 This is a standard curve diagram of the single copy gene amoA used for quantification of strain Nitrososphaera viennensis. EN76 in Example 1 of the present invention;

[0036] Figure 3This is a schematic diagram of the degradation ability of the functional bacteria in Experimental Example 1 of the present invention on phenanthrene in soil;

[0037] Figure 4 In Experimental Example 2 of the present invention 13 CO2 labeled soil 13 C / 12 Schematic diagram of the percentage of C atoms;

[0038] Figure 5 This is a schematic diagram of the amount of CO2 assimilated by the functional bacteria in the organic carbon in Experimental Example 2 of the present invention;

[0039] Figure 6 This is a schematic diagram of carbon fixation efficiency of functional bacteria in Experimental Example 2 of the present invention;

[0040] Figure 7 is a flow chart of the method of the present invention;

[0041] Figure 8 It is the agarose gel electrophoresis diagram in Example 1 of the present invention. DETAILED DESCRIPTION

[0042] In order to further illustrate the method adopted by the present invention and the effect achieved, the technical solution of the present invention will be clearly and completely described in combination with experiments below.

[0043] Example 1: This example describes a method for preparing a functional bacterial community for carbon fixation and pollution elimination in organic contaminated soil. Figure 7 As shown, the following steps are included:

[0044] S1. First strain culture: Take Sphingobium sp.RS2 strain and use LB medium for activation culture to obtain Sphingobium sp.RS2 single bacteria for standby use. The activation culture method is: add an inoculation loop of Sphingobium sp.RS2 strain to 24 mL of LB medium, culture the Sphingobium sp.RS2 strain to the logarithmic growth phase, centrifuge, remove the supernatant to obtain Sphingobium sp.RS2 precipitate, add inorganic salt medium to the Sphingobium sp.RS2 precipitate for resuspending, repeat the above steps of centrifugation and resuspending 3 times, and obtain Sphingobium sp.RS2 single bacteria after the last resuspending. The centrifugation conditions are: temperature 4°C, centrifugation at a speed of 8000 rpm for 5 minutes;

[0045] The culture conditions for culturing Sphingobium sp. RS2 to the logarithmic growth phase were as follows: temperature 30°C, shaking culture at 150 rpm for 12 h;

[0046] S2, second bacterial strain culture: Nitrososphaera viennensis.EN76 was cultured in a constant temperature incubator in the dark to obtain a single Nitrososphaera viennensis.EN76 bacterium for standby use. The temperature of the constant temperature incubator was 42° C. During the continuous dark culture process, each culture was cultured to the logarithmic growth phase to obtain a single Nitrososphaera viennensis.EN76 bacterium.

[0047] The following is the inorganic salt medium used for the single bacterial culture of Nitrososphaera viennensis. EN76, as shown in Table 1;

[0048] Table 1 Inorganic salt culture medium

[0049] Element concentration NaCl 17.1 mM <![CDATA[MgCl2* 6H2O]]> 2.0 mM <![CDATA[CaCl2* 2H2O]]> 0.7 mM KCl 6.7 mM <![CDATA[KH2PO4]]> 2 g / L <![CDATA[NaHCO3]]> 2 mM HEPES 10 mM mod Trace Elements 1 × FeNaEDTA 7.5 mM <![CDATA[NH4Cl]]> 2 mM Sodium pyruvate 0.2 mM

[0050] Among them, the components of mod Trace Elements are shown in Table 2:

[0051] Table 2 Composition of mod Trace Elements

[0052] Element concentration <![CDATA[H3BO3]]> 0.5 mM <![CDATA[MnCl2* 4H2O]]> 0.5 mM <![CDATA[CoCl2* 6H2O]]> 0.8 mM <![CDATA[NiCl2* 6H2O]]> 0.1 mM <![CDATA[CuCl2* 2H2O]]> 0.01 mM <![CDATA[ZnSO4* 7H2O]]> 0.5 mM <![CDATA[Na2MoO4* 2H2O]]> 0.15 mM HCL (37%) 100 mM

[0053] S3. Cell number quantification:

[0054] S3-1. Quantification of the number of cells in the single bacterium Sphingobium sp. RS2 prepared in S1 using the single copy gene nahE:

[0055] Primers were designed based on the gene sequence of the single-copy gene nahE. The primers included a forward primer and a reverse primer. The sequence of the forward primer was shown in SEQ ID NO.1, and the sequence of the reverse primer was shown in SEQ ID NO.2.

[0056] SEQ ID NO.1:TTGGCGTGCCGATGTGGTG

[0057] SEQ ID NO.2: GCGGGAAATCGAATTTGAAGG

[0058] The primers were used for PCR amplification to obtain the gene sequence, and the gene sequence was introduced into the plasmid to construct a standard plasmid. The standard plasmid was then diluted 10 times to obtain the template DNA, and then fluorescent quantitative PCR was performed to obtain the standard curve. The R2 of the standard curve was greater than 0.99, and the amplification efficiency was greater than 110% and greater than 90%. Figure 1As shown, a DNA extraction kit was then used to extract DNA from 1 mL of Sphingobium: sp. Rs2, and fluorescent quantitative PCR was performed to obtain the CT value. The CT value was substituted into the formula on the standard curve to calculate the copy number. The copy number of a single copy gene represents the number of cells per microliter.

[0059] S3-2. Quantification of the number of cells in the Nitrososphaera viennensis.EN76 single bacterium prepared in S2 using the single copy gene amoA:

[0060] Primers were designed based on the gene sequence of the single-copy gene amoA. The primers included a forward primer and a reverse primer. The sequence of the forward primer was shown in SEQ ID NO.3, and the sequence of the reverse primer was shown in SEQ ID NO.4.

[0061] SEQIDNO.3:TCGGTCTCGGATACTTGAA

[0062] SEQIDNO.4: GCACGCTGTCATCATCAT

[0063] The primers were used for PCR amplification to obtain the gene sequence, and the gene sequence was introduced into the plasmid to construct a standard plasmid. The standard plasmid was then diluted 10 times to obtain the template DNA, and then fluorescent quantitative PCR was performed to obtain the standard curve. The R2 of the standard curve was greater than 0.99, and the amplification efficiency was greater than 110% and greater than 90%. Figure 2 As shown, a DNA extraction kit was then used to extract 1 mL of DNA from a single bacterium of Nitrososphaera viennensis.EN76, and fluorescent quantitative PCR was performed to obtain the CT value, and the CT value was substituted into the formula on the standard curve to calculate the copy number. The copy number of a single copy gene represents the number of cells per microliter;

[0064] When the primers in S3-1 and S3-2 are used for PCR amplification, the PCR reaction system is shown in Table 3:

[0065] Table 3 PCR reaction system when primers are used for PCR amplification

[0066] Reagents volume Taq enzyme 10μL Forward Primer 0.5μL Reverse primer 0.5μL DNA 1μL ddH2O 8μL

[0067] In S3-1, the PCR amplification program conditions are as follows:

[0068] nahE gene: pre-denaturation at 95°C for 10 min, (denaturation at 95°C for 30 s, annealing at 58.26°C for 30 s, 72°C for 20 s) × 34 cycles, extension at 72°C for 5 min, three replicates for each sample, and a PCR system without template DNA (replaced by dd H2O) as a negative control.

[0069] In S3-2, the PCR amplification program conditions are as follows:

[0070] amoA gene: 95℃ pre-denaturation for 10 min, (95℃ denaturation for 30 s, 53.77℃ annealing for 30 s, 72℃ 20 s) × 34 cycles, 72℃ extension for 5 min, three parallels for each sample, and a PCR system without template DNA (dd H2O instead) as a negative control;

[0071] The feasibility of the designed primers was verified by agarose gel electrophoresis, including:

[0072] (1) Heat and melt 1% agarose gel, take 20 mL into a small beaker, add 2 μL TS-GelRed and mix well, prepare the gel plate, and put it into the electrophoresis tank after cooling and solidification;

[0073] (2) Add 5 μL of DL2000 Marker to the first gel well, and then add 5 μL of the collected PCR product to the gel well;

[0074] (3) Set the electrophoresis instrument voltage to 110 V, maintain it for 30 min, then turn off the electrophoresis instrument and take out the agarose gel;

[0075] (4) Place the gel into a gel imager to observe the electrophoresis structure. Based on the band clarity and marker alignment, determine whether the primers can be used for subsequent experiments.

[0076] The reaction system of fluorescence quantitative PCR in S3-1 and S3-2 is shown in Table 4:

[0077] Table 4 Reaction system of fluorescence quantitative PCR

[0078] Reagents volume AceqPCRSYBRGreenMasterMix 10μL Forward Primer 0.4μL Reverse primer 0.4μL Template DNA 1μL <![CDATA[ddH2O]]> 8.2μL

[0079] In S3-1, the program conditions of fluorescent quantitative PCR are as follows: the template DNA is pre-denatured and heated at 95°C for 5 min, then denatured and heated at 95°C for 10 s, annealed for 30 s at 56°C, extended for 30 s at 72°C, and a total of 40 cycles are completed. The melting curve analysis is performed under the conditions of heating at 95°C for 15 s, cooling to 60°C and heating for 1 min, and heating to 95°C and holding for 1 s;

[0080] In S3-2, the program conditions of fluorescent quantitative PCR are as follows: the template DNA is pre-denatured and heated at 95°C for 5 min, then denatured and heated at 95°C for 10 s, annealed for 30 s at 60°C, extended for 30 s at 72°C, and a total of 40 cycles are completed. The melting curve analysis is performed under the conditions of heating at 95°C for 15 s, cooling to 60°C and heating for 1 min, and heating to 95°C and holding for 1 s.

[0081] Note: A standard curve can be obtained by fluorescent quantitative PCR. The CT value obtained in subsequent experiments is substituted into the formula on the standard curve to calculate the copy number. The copy number of a single-copy gene can represent the number of cells per microliter.

[0082] S4, single bacteria mixing: Sphingobium sp. RS2 and Nitrososphaera viennensis. EN76 were mixed in a ratio of 1:1. The cell number was 10 8 , and obtain functional bacterial flora.

[0083] Embodiment 2: This embodiment differs from Embodiment 1 in that:

[0084] In S1, an inoculation loop of Sphingobium sp. RS2 was added to 30 mL of LB medium, the Sphingobium sp. RS2 was cultured to the logarithmic growth phase, centrifuged, the supernatant was removed to obtain a Sphingobium sp. RS2 precipitate, an inorganic salt medium was added to the Sphingobium sp. RS2 precipitate for resuspending, the above steps of centrifugation and resuspending were repeated twice, and a single Sphingobium sp. RS2 was obtained after the last resuspending. The centrifugation conditions were: temperature of 3°C, centrifugation at a speed of 7500 rpm for 6 min; the culture conditions for culturing Sphingobium sp. RS2 to the logarithmic growth phase were: temperature of 28°C, shaking culture at a speed of 120 rpm for 15 h;

[0085] In S2, the temperature of the constant temperature incubator is 40°C.

[0086] Embodiment 3: This embodiment differs from Embodiment 1 in that:

[0087] In S1, an inoculation loop of Sphingobium sp.RS2 strains was added to 20 mL of LB medium, the Sphingobium sp.RS2 strains were cultured to the logarithmic growth phase, centrifuged, the supernatant was removed to obtain a Sphingobium sp.RS2 precipitate, an inorganic salt medium was added to the Sphingobium sp.RS2 precipitate for resuspending, the above steps of centrifugation and resuspending were repeated 3 times, and a single Sphingobium sp.RS2 strain was obtained after the last resuspending. The centrifugation conditions were: temperature of 5°C, centrifugation at a speed of 8500 rpm for 4 minutes; the culture conditions for culturing Sphingobium sp.RS2 strains to the logarithmic growth phase were: temperature of 32°C, shaking culture at a speed of 160 rpm for 10 hours;

[0088] In S2, the temperature of the constant temperature incubator is 43°C.

[0089] Experimental Example 1: Next, we used the functional bacterial community prepared by the method of Example 1 of the present invention to treat the soil to verify the degradation ability of the functional bacterial community on phenanthrene in the soil.

[0090] The experimental device was a 100 mL serum bottle. Sterile water was added to the soil until the moisture content was 60%. Each experimental treatment was set according to Table 5, and three parallels were set for each treatment. Among them, phenanthrene was added to the test soil to a final concentration of 10 mg / kg; each device contained 10 g of soil. 13 The CO2 content is 5%. 90% 13 After CO2 is consumed, flush the top of the serum bottle with pressurized synthetic air (20% O2, 80% N2) for 1 min to maintain aerobic conditions, then add 13 The microcosm culture system was placed at 28°C, and the gas in the serum bottle was renewed every 5 days. All soil samples were collected at 5 days, 10 days, and 20 days for freeze-drying. The dried samples were immediately stored at -20°C for subsequent analysis.

[0091] Table 5 Experimental design of the degradation ability of functional bacteria on phenanthrene in soil

[0092] deal with condition Sterilized soil Sterilized soil + phenanthrene original soil Original soil + Phenanthrene Original soil+RS2 Original soil + phenanthrene + RS2 Original soil + EN76 Original soil + phenanthrene + EN76 Original soil+RS2+EN76 Original soil+Phenanthrene+RS2+EN76

[0093] After the soil sample was freeze-dried and fully ground, 2 g of soil sample was added to 10 mL of n-hexane and dichloromethane (volume ratio 1:1), vortexed, ultrasonically extracted for 30 min, centrifuged at 2000 rpm for 10 min, and the supernatant was collected. The process was repeated 3 times, and the extract was purified by 2 g of anhydrous sodium sulfate and 2 g of silica gel column, and finally eluted with 10 mL of n-hexane and dichloromethane mixture. The obtained mixture was dried by rotary evaporator, and then re-diluted with 2 mL of methanol. The phenanthrene concentration was detected by HPLC. The phenanthrene degradation rate of each treatment was calculated by the following formula:

[0094] Phenanthrene degradation rate (%) = (1-Phenanthrene content in other treatment groups / Phenanthrene content in sterilized group) × 100%

[0095] Depend on Figure 3 It can be seen that after 20 days, the degradation rate of phenanthrene by the functional bacteria can reach 87.51%, indicating that the functional bacteria have good phenanthrene degradation ability; after 5 days, the degradation rate of phenanthrene by the functional bacteria is significantly higher than that of Sphingobium sp. RS2 and Nitrososphaera viennensis. EN76, indicating that in the degradation process of phenanthrene, Sphingobium sp. RS2 and Nitrososphaera viennensis. EN76 have a certain synergistic effect, and the construction of functional bacteria is conducive to the removal of phenanthrene.

[0096] Experimental Example 2: Next, we used the functional bacterial community prepared by the method of Example 1 of the present invention to treat the soil to verify the CO2 fixation ability of the functional bacterial community.

[0097] The experimental device was a 100 mL serum bottle. Sterile water was added to the soil until the moisture content was 60%. Each experimental treatment was set according to Table 6, and three parallels were set for each treatment. Among them, phenanthrene was added to the test soil to a final concentration of 10 mg / kg; each device contained 10 g of soil; 13 The CO2 content was 5%. After 90% of the CO2 was consumed, the top of the serum bottle was flushed with pressurized synthetic air (20% O2, 80% N2) for 1 min to maintain aerobic conditions, and then added 13 The microcosm culture system was placed at 28°C, and the gas in the serum bottle was renewed every 5 days. All soil samples were collected at 5 days, 10 days, and 20 days for freeze-drying. The dried samples were immediately stored at -20°C for subsequent analysis.

[0098] Table 6 Experimental design of CO2 fixation capacity of functional bacteria

[0099] deal with condition Sterilized soil Sterilized soil original soil Original soil Original soil + Phenanthrene Original soil + Phenanthrene Original soil + phenanthrene + RS2 Original soil + phenanthrene + RS2 Original soil + EN76 Original soil + EN76 Original soil+Phenanthrene+EN76 Original soil + phenanthrene + EN76 Original soil+Phenanthrene+RS2+EN76 Original soil+Phenanthrene+RS2+EN76

[0100] The freeze-dried samples were used to determine the δ 13 C value and SOC for subsequent 13 C / 12 Analysis of the percentage of C atoms, the amount of CO2 assimilated in SOC and carbon fixation efficiency.

[0101] Depend on Figure 4~Figure 6 It can be seen that at 20 days, the number of Nitrososphaera viennensis. EN76 single bacteria 13 C / 12 The percentage of C atoms reaches 1.76, and the amount of CO2 assimilated in SOC is 77.27 mg·Kg -1 , the carbon fixation rate is 3.86 mg·Kg -1 ·d -1 However, after the soil was contaminated by phenanthrene, the Nitrososphaera viennensis. EN76 13 C / 12 The percentage of C atoms, the amount of CO2 assimilated in SOC, and the carbon fixation rate were significantly reduced, indicating that phenanthrene would inhibit its carbon fixation capacity. Nitrososphaera viennensis.EN76 and phenanthrene-degrading bacteria Sphingobium sp. RS2 were combined to obtain a microbial functional flora. 13 C / 12 The percentage of C atoms reaches 1.73, and the amount of CO2 assimilated in SOC is 76.02 mg·Kg -1 , the carbon fixation rate is 3.80 mg·Kg -1 ·d -1 , which is significantly higher than the carbon fixation capacity of Nitrososphaera viennensis. EN76 under phenanthrene stress.

[0102] Among them: Sphingobium sp. RS2 strain comes from the literature:

[0103] J.Liu., ZMZhang., YHSheng., YZGao., ZHZhao., Phenanthrene-degrading bacteria on root surfaces: a natural defense that protects plants from phenanthrene contamination. Plant Soil, 2018, 425: 335-350.

[0104] Nitrososphaera viennensis. EN76 strain comes from the literature:

[0105] M.Tournaa., M.Stieglmeiera., A.Spanga., M.Könnekeb., A.Schintlmeisterc., T.Uricha., M.Engeld., M.Schloterd., M.Wagnerc., A.Richterc., C.Schleper., Nitrososphaera viennensis, an ammonia oxidizing archaeon from soil.Proceedingsof the national academy of sciences of the united states of america, 2011, 108: 8420-8425.

[0106] The above experiments show that the functional bacterial community prepared by the preparation method of the present invention can reduce the stress of phenanthrene on Nitrososphaera viennensis. EN76 and achieve a better carbon fixation effect.

Claims

1. A method for preparing a functional bacterial community for carbon fixation and pollution removal in organically contaminated soil, characterized in that: The following steps are involved: S1. First strain culture: Take Sphingobium sp. RS2 strain and use LB medium to activate and culture it to obtain Sphingobium sp. RS2 single strain for standby use; The activation culture method comprises: adding an inoculation loop of Sphingobium sp. RS2 strain into 20-30 mL LB culture medium, culturing the Sphingobium sp. RS2 strain to the logarithmic growth phase, centrifuging, removing the supernatant to obtain a Sphingobium sp. RS2 precipitate, adding an inorganic salt culture medium to the Sphingobium sp. RS2 precipitate for resuspending, repeating the above steps of centrifugation and resuspending 2-3 times, and obtaining the Sphingobium sp. RS2 single strain after the last resuspending; S2, second bacterial strain culture: Nitrososphaera viennensis.EN76 was cultured in a constant temperature incubator in the dark to obtain a single strain of Nitrososphaera viennensis.EN76 for standby use; S3, cell number quantification: the single-copy gene nahE was used to quantify the cell number in the Sphingobium sp.RS2 single bacterium prepared in S1, and the single-copy gene amoA was used to quantify the cell number in the Nitrososphaera viennensis.EN76 single bacterium prepared in S2; S4, single bacteria mixing: the Sphingobium sp. RS2 single bacteria and the Nitrososphaeraviennensis.EN76 single bacteria were mixed at a ratio of 1:1 in terms of cell number, and the cell number was 10 8 , and obtain functional bacterial flora.

2. The method for preparing a functional bacterial community for carbon fixation and pollution removal in organic contaminated soil according to claim 1, characterized in that: The culture conditions for culturing the Sphingobium sp. RS2 strain to the logarithmic growth phase are: a temperature of 28-32° C. and shaking culture at a rotation speed of 120-160 rpm for 10-15 hours.

3. The method for preparing a functional bacterial community for carbon fixation and pollution removal in organic contaminated soil according to claim 1, characterized in that: The centrifugal treatment conditions are: temperature of 3-5°C, centrifugation at a speed of 7500-8500 rpm for 4-6 minutes.

4. The method for preparing a functional bacterial community for carbon fixation and pollution removal in organic contaminated soil according to claim 1, characterized in that: In S2, the temperature of the constant temperature incubator is 40-43°C, and during the continuous light-proof culture process, the culture is continued until the logarithmic growth phase to obtain the Nitrososphaera viennensis.EN76 single bacterium.

5. The method for preparing a functional bacterial community for carbon fixation and pollution removal in organic contaminated soil according to claim 1, characterized in that: In S3, the method for quantifying the number of cells in the single bacterium Sphingobium sp. RS2 prepared in S1 is: Primers are designed based on the gene sequence of the single-copy gene nahE, the primers include a forward primer and a reverse primer, the sequence of the forward primer is shown in SEQ ID NO.1, the sequence of the reverse primer is shown in SEQ ID NO.2, SEQ ID NO.1:TTGGCGTGCCGATGTGGTG SEQ ID NO.2: GCGGGAAATCGAATTTGAAGG The primers are subjected to PCR amplification to obtain a gene sequence, and the gene sequence is introduced into a plasmid to construct a standard plasmid, and then the standard plasmid is subjected to 10-fold gradient dilution to obtain a template DNA, and then fluorescent quantitative PCR is performed to obtain a standard curve, and then a DNA extraction kit is used to extract 1 mL of DNA of a single bacterium Sphingobium: sp. Rs2, and fluorescent quantitative PCR is performed to obtain a CT value, and the copy number is calculated according to the CT value. The copy number of a single copy gene represents the number of cells per microliter.

6. The method for preparing a functional bacterial community for carbon fixation and pollution removal in organic contaminated soil according to claim 5, characterized in that: The reaction system of the fluorescent quantitative PCR is as follows: The program conditions of the fluorescent quantitative PCR are as follows: the template DNA is pre-denatured and heated at 95°C for 5 minutes, then denatured and heated at 95°C for 10 seconds, annealed for 30 seconds at 56°C, extended for 30 seconds at 72°C, and a total of 40 cycles are completed. The melting curve analysis is performed under the analysis conditions of heating at 95°C for 15 seconds, cooling to 60°C and heating for 1 minute, and heating to 95°C and holding for 1 second.

7. The method for preparing a functional bacterial community for carbon fixation and pollution removal in organic contaminated soil according to claim 1, characterized in that: In S3, the method for quantifying the number of cells in the single bacterium Nitrososphaera viennensis.EN76 prepared in S2 is: Primers are designed based on the gene sequence of the single-copy gene amoA, the primers comprising a forward primer and a reverse primer, the sequence of the forward primer is shown in SEQ ID NO.3, the sequence of the reverse primer is shown in SEQ ID NO.4, SEQ ID NO.3: TCGGTCTCGGATACTTGAA SEQ ID NO.4: GCACGCTGTCATCATCAT The primers are subjected to PCR amplification to obtain a gene sequence, and the gene sequence is introduced into a plasmid to construct a standard plasmid, and then the standard plasmid is subjected to 10-fold gradient dilution to obtain a template DNA, and then fluorescent quantitative PCR is performed to obtain a standard curve, and then 1 mL of DNA of Nitrososphaera viennensis.EN76 single bacteria is extracted using a DNA extraction kit, and fluorescent quantitative PCR is performed to obtain a CT value, and the copy number is calculated according to the CT value. The copy number of a single copy gene represents the number of cells per microliter.

8. The method for preparing a functional bacterial community for carbon fixation and pollution removal in organic contaminated soil according to claim 7, characterized in that: The reaction system of the fluorescent quantitative PCR is as follows: The program conditions of the fluorescent quantitative PCR are as follows: the template DNA is pre-denatured and heated at 95°C for 5 minutes, then denatured and heated at 95°C for 10 seconds, annealed for 30 seconds at 60°C, extended for 30 seconds at 72°C, and a total of 40 cycles are completed. The melting curve analysis is performed under the analysis conditions of heating at 95°C for 15 seconds, cooling to 60°C and heating for 1 minute, and heating to 95°C and holding for 1 second.

9. The method for preparing a functional bacterial community for carbon fixation and pollution removal in organic contaminated soil according to claim 5 or 6, characterized in that: Also includes: The feasibility of the designed primers was verified by agarose gel electrophoresis.

Images