Application of BnSIT3 gene or related biological materials in improving plant salt tolerance

Abstract

The present invention provides an application of a BnSIT3 gene or a biological material related thereto in improving plant salt tolerance, and belongs to the field of genetic engineering technology. The present invention clones a BnSIT3 gene from Brassica napus, and uses a CaMV35S promoter to construct a rapeseed transformation vector for overexpressing the BnSIT3 gene. After the vector is transformed into Arabidopsis thaliana and rapeseed, the expression amount of the BnSIT3 gene can be significantly increased, and the salt tolerance of the transgenic plant is significantly improved, which provides new technical guidance for the cultivation of new salt-tolerant rapeseed varieties.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to the application of BnSIT3 gene or biological materials related thereto in improving the salt tolerance of plants. Background Art

[0002] Salt stress is one of the main environmental factors that restrict plant growth. Excessive salt concentration in the soil will seriously inhibit plant growth, development, quality and yield. At present, the area of ​​salinized soil in the world exceeds 1 billion hectares, which seriously limits the increase in agricultural production. Rapeseed is an important oil and cash crop. Soil salt stress seriously inhibits the growth and development of rapeseed and grain yield. How to effectively improve the salt tolerance of Brassica napus and cultivate new salt-tolerant varieties is an urgent need to ensure food and oil security.

[0003] Plant salt tolerance is a complex quantitative trait controlled by multiple genes, and its genetic regulation mechanism is complex, involving all levels of the plant from organs to tissues, from physiology and biochemistry to molecules. Therefore, it is difficult to meet the needs of genetic improvement of such traits by simply relying on traditional genetic breeding methods. With the rapid development of genomics and modern molecular biology techniques, the use of molecular biology methods to cultivate new salt-tolerant varieties of rapeseed has gradually become an important way to improve the salt tolerance of rapeseed. It is very necessary to analyze the genes and their biological functions involved in the response of rapeseed to salt stress for genetic improvement of rapeseed salt tolerance through molecular breeding technology. Summary of the invention

[0004] The object of the present invention is to provide application of BnSIT3 gene or biological materials related thereto in improving salt tolerance of plants.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides application of BnSIT3 gene or biological materials related to BnSIT3 gene in improving salt tolerance of plants. The nucleotide sequence of the BnSIT3 gene is shown in SEQ ID NO.1.

[0007] SEQ ID NO.1:

[0008]

[0009] The amino acid sequence of the protein encoded by the BnSIT3 gene is shown in SEQ ID NO.2.

[0010] SEQ ID NO.2:

[0011] .

[0012] Preferably, the biological material related to the BnSIT3 gene is: a recombinant vector containing the BnSIT3 gene, or a recombinant microorganism containing the BnSIT3 gene.

[0013] Preferably, the method for improving the salt tolerance of plants is to introduce the BnSIT3 gene or biological materials related to the BnSIT3 gene into the plants to construct plants overexpressing the BnSIT3 gene.

[0014] Preferably, the plants include rapeseed and Arabidopsis thaliana.

[0015] The present invention provides the application of BnSIT3 gene or biological materials related thereto in improving the salt resistance of plants. The present invention clones the BnSIT3 gene from double 11 of Brassica napus for the first time, and constructs a rapeseed transformation vector for overexpressing the BnSIT3 gene using the CaMV35S promoter. The expression level of the BnSIT3 gene can be significantly increased after the vector is transformed into Arabidopsis thaliana and rapeseed, and the salt tolerance of the transgenic plants is significantly improved, proving that the BnSIT3 gene is a positive regulatory gene in the salt stress response process. The method for overexpressing the BnSIT3 gene of Brassica napus of the present invention can be applied to genetic engineering breeding of plants, and can be applied to production practice, for cultivating new salt-tolerant rapeseed varieties, and ensuring the safe production of rapeseed crops in high-salt-alkali areas. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 is the expression level of ACTIN2 gene and BnSIT3 gene in wild-type Arabidopsis and transgenic Arabidopsis, where CK is wild-type Arabidopsis, TL-1, TL-2, and TL-3 are transgenic Arabidopsis;

[0017] Figure 2 The root growth of wild-type Arabidopsis and transgenic Arabidopsis under different concentrations of NaCl solution treatment. The left picture shows the root system of Arabidopsis treated with 0mM NaCl solution, and the right picture shows the root system of Arabidopsis treated with 100mM NaCl solution. Among them, Col-0 is wild-type Arabidopsis, and TL-2 and TL-3 are transgenic Arabidopsis.

[0018] Figure 3 The relative root lengths of wild-type Arabidopsis and transgenic Arabidopsis under treatment with different concentrations of NaCl solution, where Col-0 is wild-type Arabidopsis, and TL-2 and TL-3 are transgenic Arabidopsis;

[0019] Figure 4 is the expression level of BnACTIN7 gene and BnSIT3 gene in wild-type rapeseed and transgenic rapeseed, where K407 is wild-type rapeseed, and OE-1, OE-2 and OE-3 are transgenic rapeseed;

[0020] Figure 5 The growth of wild-type rapeseed and transgenic rapeseed under different concentrations of NaCl solution treatment, among which K407 is wild-type rapeseed, OE-1 and OE-2 are transgenic rapeseed;

[0021] Figure 6 The aboveground fresh weight of wild-type rapeseed and transgenic rapeseed under different concentrations of NaCl solution treatment, where K407 is wild-type rapeseed, and OE-1 and OE-2 are transgenic rapeseed. DETAILED DESCRIPTION

[0022] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0023] Example 1

[0024] The leaves of the Brassica napus variety Zhongshuang 11 that had grown for three weeks were taken, and the total RNA of the leaves was extracted using the EasyPure Plant RNA Kit (Transgen, Catalog No.: ER301-01). The nucleic acid concentration was determined using a nanodrop ultra-micro UV spectrophotometer, and 2 μg of total RNA was reverse transcribed using EasyScript One-Step gDNA Removal and cDNA Synthesis SuperMix (transgen, Catalog No.: AE311-02) to obtain single-stranded cDNA.

[0025] The cDNA obtained by reverse transcription was used as a template, and primers F1: GACCTCGACTCTAGAACTAGTATGTTCGTGAAGCTCCTCACCA (SEQ ID NO.3) and R1: CTCATTT TTTCTACCGGTACCGCCTCCTACCAGAGACTATAGAATCAACC (SEQ ID NO.4) were used for PCR amplification. The above primers were synthesized by Yangling Tianrun Aoke Biotechnology Co., Ltd., and the polymerase used for PCR amplification was TksGflex DNA Polymerase (Takara Company, Cat. No.: R091A). The PCR amplification system was 50 μL, and the PCR reaction solution was prepared according to the instructions of TksGflex DNA Polymerase. The reaction conditions were: 94℃1min; 98℃10sec, 60℃15sec, 68℃90sec, 31 cycles; 68℃5min. A fragment of about 2001bp was obtained, and the gel was cut after agarose gel electrophoresis, and the target fragment was recovered using EasyPure Quick Gel Extraction Kit.

[0026] The target fragment was cloned into the pMDC83 vector (described in the following document: A Gateway Cloning Vector Set for High-Throughput Functional Analysis of Genes in Planta. Plant Physiology. 2003, 133 (2): 462-469) between the Spe I and Kpn I restriction sites using the pEASY-Uni Seamless Cloning and Assembly Kit (Transgen, catalog number: CU101-01). The specific operation was as follows: 10 μL of the recombination reaction solution was prepared according to the instructions of the pEasy-Uni Seamless Cloning and Assembly Kit. The contents of each component in the recombination reaction solution were: 5 μL of 2×Assembly Mix, 3 μL of pMDC83 linear vector, and 2 μL of BnSIT3 gel recovery fragment. The reaction conditions were: 50°C for 15 min. After the recombination reaction was completed, the above-mentioned recombination reaction solution was transformed into Trans1-T1 competent cells, spread onto LB plates containing kanamycin resistance, and cultured overnight in a 37°C incubator.

[0027] Ten single clones were selected for colony PCR identification using 2×EsTaqMasterMix (Dye) (CW0690), and the primer sequences F2: CGCTTCATCATAAGGAGGAGGA (SEQ ID NO.5) and R2: GGTAACGGGAGAAGCACTG (SEQ ID NO.6) were amplified. The colonies identified correctly by PCR were transferred to LB liquid and shaken vigorously. Plasmids were extracted using the Plasmid Mini Kit I plasmid extraction kit (OMEGA, D6943-01) and sent to Yangling Tianrun Aoke Biotechnology Co., Ltd. for sequencing verification. After correct sequencing, the recombinant vector pMDC83-BnSIT3 was obtained.

[0028] Example 2

[0029] The recombinant vector pMDC83-BnSIT3 was transferred into Agrobacterium tumefaciens GV3101 competent cells (WEIDI Company, Catalog No.: AC1001) by chemical transformation to obtain recombinant Agrobacterium A containing the recombinant vector; the recombinant Agrobacterium A was used to infect Arabidopsis thaliana flowers at full flowering stage, and the BnSIT3 gene was transferred into the wild-type Arabidopsis thaliana Col-0, which was cultured in a greenhouse at 22°C and the T1 generation seeds were harvested.

[0030] The specific steps of the flower infection method are as follows: take the recombinant Agrobacterium A and inoculate it into LB liquid culture medium containing 50 mg / L kanamycin, 50 mg / L gentamicin and 40 mg / L rifampicin, and culture it at 28℃ and 180 rpm until OD600 reaches 2.0. Collect the bacteria by centrifugation at 5000 rpm at room temperature, resuspend the bacteria with infection solution (MS contains 2.36 g / L organic matter, 25 g / L sucrose, pH 5.8, and Silwet L-77 100 μL / L), and place it at room temperature away from light for 3 hours. Invert the Arabidopsis flower in the infection solution for 30 seconds, place it flat, and try to prevent the infection solution from getting on the leaves. Then place it for 15 minutes, repeat once, water it sufficiently after transformation, cover it with plastic wrap to keep it moist for 24 hours, and culture it normally until the seeds are harvested.

[0031] The harvested T1 generation seeds were screened using 1 / 2MS solid culture medium (2% sucrose, 0.7% agar powder) containing 33 mg / L hygromycin to obtain transgenic Arabidopsis plants; the transgenic plants were planted to obtain T2 generation seeds; the harvested T2 generation seeds were screened using 300 mg / L timentin and 33 mg / L hygromycin, the ratio of surviving seedlings to dead seedlings was counted, and transgenic resistant seedlings with hygromycin resistance that met the segregation ratio of 3:1 were selected, transplanted and cultured to obtain T3 generation seeds; the harvested T3 generation seeds were screened using 33 mg / L hygromycin resistance to obtain a T3 generation homozygous transgenic strain that no longer produces hygromycin resistance segregation.

[0032] Using wild-type seedlings as the control (CK), the expression level of the BnSIT3 gene in T3 transgenic plants was detected by RT-PCR using specific primers F2 / R2 and internal reference ACTIN2 primers (F3: TGTGCCAATCTACGAGGGTTT (SEQ ID NO.7)) and R3: TTTCCCGCTCTGCTGTTGT (SEQ ID NO.8)). The steps are as follows: wild-type and T3 generation homozygous BnSIT3 gene-transfected plants were taken, total RNA was isolated using EasyPure Plant RNA Kit, nucleic acid concentration was determined using an ultra-micro UV spectrophotometer, 2 μg RNA was taken and reverse transcribed using EasyScript One-Step gDNARemoval and cDNASynthesis SuperMix to obtain single-stranded cDNA; the cDNA of the gene BnSIT3 was PCR amplified using a specific primer pair F2 / R2 and 2×EsTaqMasterMix (Dye), the PCR reaction system was: 20 μL, the PCR reaction system was prepared according to the 2×Es TaqMasterMix instruction manual, and the reaction conditions were: 94°C 2min; 94°C 30sec, 58°C 30sec, 72°C 60sec, 31 cycles; 72°C 2min; the gene ACTIN2 in Arabidopsis thaliana was used as an internal reference, and the PCR amplification product was subjected to agarose gel electrophoresis, and the results were as follows: Figure 1 As shown, the expression level of the target gene BnSIT3 in the T3 generation Arabidopsis lines TL-1, TL-2, and TL-3 transformed with the BnSIT3 gene was significantly higher than that in the wild-type control CK.

[0033] Example 3

[0034] Wild-type Col-0 and the above homozygous transgenic Arabidopsis thaliana strain seeds (TL-2 and TL-3) were sterilized with 1% NaClO solution and spotted on 1 / 2MS (containing 1% sucrose and 0.7% agar) solid plates containing 0 or 100 mM NaCl. Seeds were sterilized with 1% NaClO for 15 min, washed 5 times with sterile ddH2O, and finally resuspended with 0.1% agarose solution.

[0035] The plates were placed vertically in a plant culture room (21°C, 16 hours of light / 8 hours of darkness) and cultured for 15 days to measure the taproot growth. The relative length of the taproot was used to characterize the growth performance. The method was as follows: 15 plants of each transgenic line and control treated with 0 or 100 mM NaCl were taken, and the taproot length was measured respectively to calculate the relative root length of the salt stress line. Relative root length = root length after salt stress / root length of control group × 100%. The results are shown in Figure 2 and Figure 3As shown, compared with the wild-type plant Col-0, the transgenic lines had longer taproot length under salt stress conditions, indicating that overexpression of the BnSIT3 gene in Arabidopsis can improve plant salt tolerance.

[0036] Example 4

[0037] The recombinant Agrobacterium A was used to transform the BnSIT3 gene into the Brassica napus inbred line K407 using the Agrobacterium-mediated hypocotyl transformation method, and the T0 generation transgenic positive plants were obtained by screening with 20 mg / L hygromycin resistance; the transgenic plants were self-pollinated to obtain T1 generation seeds; the harvested T1 generation seeds were screened with 150 mg / L hygromycin resistance, and the transgenic resistant seedlings with hygromycin resistance that met the segregation ratio of 3:1 were selected and harvested to obtain T2 generation seeds; the harvested T2 generation seeds were screened with 150 mg / L hygromycin resistance to obtain a T3 generation homozygous transgenic strain that no longer produced hygromycin resistance segregation.

[0038] Using wild-type rapeseed seedlings K407 as a control, RT-PCR was performed using specific primers F2 / R2, internal reference BnACTIN7 primers (F4: GCTGACCGTATGAGCAAAG (SEQ ID NO.9), R4: AAGATGGATGGACCCGAC (SEQ ID NO.10)) and 2×EsTaqMasterMix (Dye) to detect the expression level of the target gene BnSIT3 in the T3 transgenic strains. The PCR reaction system was: 20 μL, and the PCR reaction system and reaction conditions were the same as in Example 2. The results are shown in FIG. Figure 4 As shown, the expression level of the target gene BnSIT3 in the T3 generation BnSIT3 gene-transfected rapeseed lines OE-1, OE-2 and OE-3 was significantly higher than that in the wild-type control K407.

[0039] Example 5

[0040] Seeds of the T3 transgenic BnSIT3 rapeseed lines (OE-1, OE-2) and the control (K407) were sown in pots filled with 200 g of nutrient soil. After culturing in an incubator under normal conditions for 10 days, seedlings with consistent growth were selected and watered with an equal amount of 200 mM NaCl solution every 3 days for 15 days. The aboveground phenotypes of the control and transgenic plants were observed, such as Figure 5 and Figure 6 As shown, it can be seen that the transgenic rapeseed showed higher plant height and fresh weight, while the control plants were shorter, had smaller leaves, and were wilted and yellowed.

[0041] In summary, the present invention can quickly obtain relatively salt-tolerant Brassica napus by overexpressing the BnSIT3 gene, which is expected to enrich the germplasm resources of rapeseed and accelerate the breeding of salt-tolerant rapeseed.

[0042] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. BnSIT3 Gene or BnSIT3 The use of gene-related biological materials in improving plant salt tolerance is characterized in that: Said BnSIT3 The nucleotide sequence of the gene is shown in SEQ ID NO.1; Said BnSIT3 Gene-related biological materials include: BnSIT3 A recombinant vector of a gene, or a recombinant vector comprising the BnSIT3 Genetically recombinant microorganisms; The plants are rapeseed and Arabidopsis thaliana.

2. The use according to claim 1, characterized in that: The method for improving plant salt tolerance is: BnSIT3 Gene or BnSIT3 Gene-related biological materials are introduced into plants to construct BnSIT3 Gene overexpression in plants.

Images