A short fermentation agent lactobacillus and its application

Abstract

The present invention provides a short fermentation agent lactobacillus ( Levilactobacillus brevis )ibiome003, and provide pharmaceutical compositions, bacterial agent compositions and food compositions comprising the above-mentioned strains, and find that the above-mentioned bacterial agents can effectively prevent, treat and alleviate depression caused by various reasons.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a short fermentation agent lactobacillus and application thereof. Background Art

[0002] The brain-gut axis is a complex reflex network composed of the central nervous system (CNS), neuroendocrine and neuroimmune systems, sympathetic and parasympathetic nerves of the autonomic nervous system (ANS), enteric nervous system (ENS), and gut microbiota. Through a bidirectional regulatory network, brain signals can affect intestinal motility, perception, and secretion, while gut microbiota can also affect brain function. Studies have found that the composition of intestinal microbiota in patients with depression is changed and there is a correlation between intestinal microbiota and quality of life and depression. Germ-free mice have a depressive phenotype compared to SPF mice. More and more studies have confirmed that intestinal microbiota are closely related to depression and stress-related disorders. Intestinal bacteria provide a new target for the treatment of depression.

[0003] At present, the most common antidepressants mainly act on monoamine neurotransmitters, and improve mood and motivation by increasing the synaptic cleft to improve depression symptoms. They include monoamine oxidase inhibitors (MAOIs), norepinephrine and dopamine reuptake inhibitors (NDRIs), selective serotonin reuptake inhibitors (SSRIs), serotonin and norepinephrine reuptake inhibitors (SNRIs), serotonin antagonists and reuptake inhibitors (SARIs), tricyclic antidepressants (TCAs) and tetracyclic antidepressants, etc. In addition to obvious side effects such as headache, dizziness, gastrointestinal discomfort, sexual dysfunction, and addiction, the clinical remission of patients varies greatly. About 30% of patients cannot get relief, and even the same patient cannot maintain a stable drug effect at different times.

[0004] At present, there are a few patents and documents that report on probiotics improving depression. The Lactobacillus brevis (formerly known as short fermentation agent Lactobacillus) in patent CN110157647B has excellent GABA production ability, thereby relieving anxiety in mice and improving sleep. It has outstanding performance in experiments such as mine field tests, elevated crosses, and sodium pentobarbital to prolong sleep, but it is not clear whether it can relieve depression. Patent TW1750788B discloses a Lactobacillus brevis GKJOY and a composition, which also produces GABA and promotes nerve function by increasing the content of dopamine and / or serotonin in brain tissue, but does not disclose physiological functional data in mice and humans. Summary of the invention

[0005] The present invention relates to a short fermentation agent lactobacillus (Levilactobacillus brevis) ibiome003, which is deposited in the China Type Culture Collection Center, the address of which is the China Type Culture Collection Center of Wuhan University, Bayi Road, Wuchang District, Wuhan City, Hubei Province, the deposit date is March 21, 2023, and the deposit number is CCTCC NO: M 2023387. The present invention further provides a mixture of the short fermentation agent lactobacillus in any proportion.

[0006] The present invention also relates to a medicine, comprising the aforementioned short fermentation agent lactobacillus and pharmaceutically acceptable excipients, carriers, auxiliary materials and vehicles.

[0007] Examples of excipients, carriers, adjuvants, vehicles include, but are not limited to, antiadherents, binders, coatings, compression aids, disintegrants, dyes, lubricants, emulsifiers, fillers (diluents), film formers or coatings, flavoring agents, fragrances, glidants (flow enhancers), lubricants, adsorbents, suspending or dispersing agents, or sweeteners. Exemplary excipients, carriers, adjuvants, vehicles include, but are not limited to, butylated hydroxytoluene (BHT), calcium carbonate, calcium phosphate (monohydrogen), calcium stearate, cross-linked carboxymethylcellulose, cross-linked polyvinyl pyrrolidone, citric acid, cross-linked povidone, cysteine, ethylcellulose, gelatin, hydroxypropyl cellulose, hydroxypropyl methylcellulose, lactose, magnesium stearate, maltitol, mannitol, methionine, methylcellulose, methylparaben, microcrystalline cellulose, polyethylene glycol, povidone, pregelatinized starch, propylparaben, retinyl palmitate, shellac, silicon dioxide, sodium carboxymethylcellulose, sodium citrate, sodium starch glycolate, sorbitol, starch (corn), stearic acid, stearic acid, sucrose, talc, titanium dioxide, vitamin A, vitamin E, vitamin C, and xylitol.

[0008] The drug can be prepared in the form of an injection preparation or an oral preparation. The injection preparation includes liquid injection, injection powder, and injection tablet according to the physical state; and includes intradermal injection, subcutaneous injection, intramuscular injection, intravenous injection, and spinal cavity injection according to the injection part; preferably, the solvent of the injection preparation includes water for injection or physiological saline.

[0009] Formulations for oral use include tablets containing the active ingredient mixed with nontoxic pharmaceutically acceptable excipients. These excipients can be, for example, inert diluents or fillers (e.g., sucrose, sorbitol, sugar, mannitol, microcrystalline cellulose, starch including potato starch, calcium carbonate, sodium chloride, lactose, calcium phosphate, calcium sulfate or sodium phosphate); granulating agents and disintegrants (e.g., cellulose derivatives including microcrystalline cellulose, starch including potato starch, cross-linked carboxymethyl cellulose sodium, alginates or alginic acid); binders (e.g., sucrose, glucose, sorbitol, gum arabic, alginic acid, sodium alginate, gelatin, starch, pregelatinized starch, microcrystalline cellulose, magnesium aluminum silicate, sodium carboxymethyl cellulose, methylcellulose, hydroxypropyl methylcellulose, ethylcellulose, polyvinyl pyrrolidone or polyethylene glycol); and lubricants, glidants and anti-adherents (e.g., magnesium stearate, zinc stearate, stearic acid, silicon dioxide, hydrogenated vegetable oil or talc). Preparations for oral use may also be in the form of chewable tablets, or in the form of hard gelatin capsules in which the active ingredient is mixed with an inert solid diluent (e.g., potato starch, lactose, microcrystalline cellulose, calcium carbonate, calcium phosphate or kaolin), or in the form of soft gelatin capsules in which the active ingredient is mixed with water or an oil medium (e.g., peanut oil, liquid paraffin or olive oil). Powders, granules and pills can be prepared using the ingredients mentioned above under tablets or capsules in a conventional manner using, for example, a mixer, fluidized bed equipment or spray drying equipment.

[0010] Other pharmaceutically acceptable excipients for oral formulations include, but are not limited to, colorants, flavoring agents, plasticizers, humectants, and buffers. Formulations for oral use may also be in the form of chewable tablets, or in the form of hard gelatin capsules, wherein the active ingredient is mixed with an inert solid diluent (e.g., potato starch, lactose, microcrystalline cellulose, calcium carbonate, calcium phosphate, or kaolin), or in the form of soft gelatin capsules, wherein the active ingredient is mixed with water or an oil medium (e.g., peanut oil, liquid paraffin, or olive oil). Powders, granules, and pills may be prepared in a conventional manner using, for example, a mixer, a fluidized bed apparatus, or a spray drying apparatus using the ingredients mentioned above under tablets or capsules.

[0011] In some embodiments, administration comprises administering an agent described herein intramuscularly, intravenously (e.g., in the form of a sterile solution and in a solvent system suitable for intravenous use), intradermally, intraarterially, intraperitoneally, intralesionally, intracranially, intraarticularly, intraprostatically, intrapleurally, intratracheally, intranasally, intravitreally, intravaginally, intrarectally, topically, intratumorally, transperitoneally, subcutaneously, subconjunctivally, intracapsularly, transmucosally, intrapericardially, intraumbilically, intraocularly, orally (e.g., as a tablet, capsule, caplet, caplet-shaped tablet, or syrup), topically (e.g., in the form of a cream, gel, lotion, or ointment), topically, by inhalation, by injection, or by infusion (e.g., continuous infusion in the form of a cream or lipid composition, local perfusion, catheterization, lavage directly bathing target cells).

[0012] The present invention also relates to a pharmaceutical composition, comprising the aforementioned short fermentation agent lactobacillus and a combined drug, wherein the combined drug is other substances that have a synergistic effect with the short fermentation agent lactobacillus, including but not limited to other species of bacteria, such as: Lactobacillus casei, Lactobacillus acidophilus, Lactobacillus plantarum, Lactobacillus helveticus, Lactobacillus fermentum, Lactobacillus curvatus, Lactobacillus sake, Lactobacillus bulgaricus (L.bulgaricus), Streptococcus thermophilus, Streptococcus lactis, Streptococcus cremoris, Bifidobacterium longum, Bifidobacterium breve, Bifidobacterium bifidum, Bifidobacterium infantis, Bifidobacterium adolescentis, etc.; or other active pharmaceutical ingredients, such as serotonin reuptake inhibitors (SSRI), serotonin and norepinephrine reuptake inhibitors (SNRI), tricyclic antidepressants (TAC), monoamine oxidase inhibitors (MAOI), tetracyclic antidepressants (TeCA), norepinephrine and specific serotonergic antidepressants (NaSSA), etc.

[0013] Dosage

[0014] The dosage of the drug / drug composition is 10 7 ~10 12 CFU.

[0015] The medication cycle is based on the ability to achieve the desired effect, including but not limited to 1-3 times a day, 3-7 days a week, etc., and is also related to the effective concentration of the specific preparation.

[0016] Fermentation agent, functional bacterial agent

[0017] A fermentation composition or fermentation agent or functional bacterial agent comprising the aforementioned short fermentation agent lactobacillus comprises a bacterial liquid prepared from the aforementioned short fermentation agent lactobacillus bacterial liquid, or a powder or granule obtained by further treatment; the fermentation agent may further contain one or more non-antagonistic microbial agents, selected from one or more of acid-resistant lactobacillus, plantarum lactobacillus and bulgaricus lactobacillus to prepare a composite bacterial agent.

[0018] Effective bacterial concentration, viable bacteria count is 10 7 ~10 12 CFU.

[0019] Pharmaceutical and therapeutic uses

[0020] The present invention relates to the use of a short fermentation lactobacillus or a composition in the preparation of a medicine or fermentation agent for treating, alleviating, preventing, or treating depression and / or anxiety. The manifestations of depression include but are not limited to: a) giving up hope of escape; b) behavioral despair; c) being unable to escape from a hostile environment; d) lack of pleasure; e) lack of interest in reward stimulation; f) long-term low mood, feeling sad, empty, and hopeless; g) slow thinking, slow reaction, memory and attention loss; h) reduced self-evaluation, and a sense of uselessness, hopelessness, and worthlessness; i) feeling guilty and sick; j) hallucinations, auditory hallucinations, and visual hallucinations; k) having little interest in almost all activities, or finding them unfun; l ) Decreased consciousness, manifested as slow behavior, passive and lazy life, unwillingness to do things, unwillingness to interact with people around, often sitting alone, or staying in bed all day, living alone, alienating relatives and friends, and avoiding socializing; m) Symptoms such as nausea, vomiting, palpitations, chest tightness, sweating, etc.; n) Significant weight loss or gain without dieting, and a constant decrease or increase in appetite; o) Insomnia or excessive sleep; p) Frequent restlessness, frequent fatigue or lack of energy, including those caused by physical induced environmental factors, chemical factors, special foods, etc. Specifically, it may be caused by chronic restraint stress (CUMS), chronic unpredictable animal stress model (CUMS), learned helplessness (LH) model, social defeat (SD) model, amino acid food (AAD), corticosterone (Cort), or genetics (family history or genetic association, the risk of first-degree relatives of patients (parents, children, brothers and sisters) suffering from depression is about 2-10 times that of the general population, and the heritability is 31%-42%), medicine (suffering from other physiological diseases, trauma or taking certain medications, such as: Parkinson's syndrome, epilepsy, digestive system diseases, hypothyroidism, etc. Diseases may lead to depression), psychology (including how patients view others and themselves, how they establish connections with the outside world; several psychological traits that may induce depression include: weak stress resistance, helplessness, anger, despair, low self-confidence, etc.), environment (referring to external events or phenomena that may lead to depression. Among them, the more common social factors include: family problems, such as conflicts between husband and wife; life pressures, such as unemployment; traumatic events, such as traffic accidents, death of relatives; psychological trauma in childhood, such as neglect, abuse, early death of parents, etc.; in addition, cultural background factors can also lead to depression to a certain extent), but it is not limited to these reasons.

[0021] This strain of short fermentation lactobacillus is expected to have the same preventive or alleviating effect in other nervous system diseases, such as depression, anxiety, autism, autism, schizophrenia, obsessive-compulsive disorder, phobia, bipolar disorder, personality disorder, mania, paranoia, hypochondria, neurasthenia, mental retardation, dementia, insomnia, psychophysiological mental disorders, affective mental disorders, paranoid mental disorders, alcohol dependence mental disorders, substance dependence mental disorders, reactive mental disorders (acute stress response, post-traumatic stress disorder, adjustment disorders, sexual physiological disorders (sexual perversion, transsexualism, pedophilia, homosexuality, etc.), personality disorders, antisocial personality disorder, impulsive personality disorder, cognitive disorders, Alzheimer's disease, epilepsy, Parkinson's disease, etc.

[0022] Beneficial Effects

[0023] The present invention discloses a preparation method and application of short fermentation lactobacillus for alleviating depression-like symptoms in mice. The short fermentation lactobacillus strain is isolated from the intestine of a healthy person, has a safe and controllable source, is easy to culture in vitro, has a high colonization efficiency in the intestine, and can significantly improve depression-like behaviors in different depression models. It can be used to prepare drugs with anti-depressant functions, and provides new ideas for clinical intervention and control of mental illnesses such as depression, and has good and broad application prospects. At the same time, short fermentation lactobacillus is widely present in fermented foods and the human intestine. The present invention also proves that the strain has no side effects on body weight, internal organs, liver and intestinal tissue, and has high safety; it also has good tolerance in simulated gastric juice at pH 3.0 and simulated intestinal juice with 0.3% bile salt, indicating that it has good acid and bile salt resistance, which is more conducive to the efficacy of the drug after it is made into a medicine.

[0024] Biological Deposit Description

[0025] Levilactobacillus brevis ibiome003, deposited on March 21, 2023, at China Center for Type Culture Collection, China Center for Type Culture Collection, Wuhan University, Bayi Road, Wuchang District, Wuhan City, Hubei Province, with a deposit number of CCTCC NO: M 2023387. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 This is a photo of a single colony of the short fermentation agent Lactobacillus in Example 2;

[0027] Figure 2 The morphology of the colony of the short fermentation lactobacillus in Example 2 was examined by smear microscopy at 40X after Gram staining;

[0028] Figure 3This is the colonization ability test of short fermentation lactobacillus in Example 3. The numbers marked between the groups in the figure represent the P value between the two groups;

[0029] Figure 4 The effect of colonization with short fermentation agent Lactobacillus 1 (ibiome003) on forced swimming (A), tail suspension (B) and sugar water preference (C) of mice under the CUMS-induced depression model in Example 4, and the numbers marked between the groups in the figure represent the P value between the two;

[0030] Figure 5 This is a graph showing the weight change trend of mice in Example 5;

[0031] Figure 6 To study the effect of intraperitoneal injection of short fermentation lactobacillus on the morphological changes of mouse liver;

[0032] Figure 7 The effect of intraperitoneal injection of short fermentation agent Lactobacillus on intestinal morphology of mice;

[0033] Figure 8 The effect of short fermentation lactobacillus colonization on forced swimming (A), tail suspension (B) and sugar water preference (C) of mice in the AAD-induced depression model in Example 6. The numbers marked between the groups in the figure represent the P value between the two.

[0034] Fig. 9 The effect of colonization of short fermentation agent Lactobacillus 1 (ibiome003) on serotonin (A), acetylcholine (B), and dopamine (C) in the mouse brain under the AAD-induced depression model in Example 7;

[0035] Fig.10 The effect of short fermentation lactobacillus colonization on forced swimming (A), tail suspension (B) and sugar water preference (C) of mice under the Cort-induced depression model in Example 8. The numbers marked between the groups in the figure represent the P value between the two.

[0036] Fig.11 The effects of colonization with multiple strains of short-fermented lactobacillus on forced swimming (A) and tail suspension (B) in mice under the CUMS-induced depression model in Example 9. The numbers marked between groups in the figure represent the P value between the two. DETAILED DESCRIPTION

[0037] Example 1: Isolation and gene detection of short fermentation agent lactobacillus

[0038] Isolation of short fermentation lactobacillus from the intestines of healthy people:

[0039] Fecal samples of volunteers (donated by employees of Hefei Hanwei Biotechnology Co., Ltd.) were stored in 20% glycerol phosphate buffer and diluted to 10 -5 , 10-6 ，10 -7

[0040] Example 2: Identification of short fermentation agent lactobacillus

[0041] 2.1 Single colony photos

[0042] After culturing the short fermentation lactobacillus on MRS medium for 48 hours, take a photo of the single colony. Figure 1 As shown, the colonies are round, smooth, with neat edges, white in color and a moist surface.

[0043] 2.2 Smear microscopy

[0044] The short fermentation lactobacillus was smeared under a microscope at 40X and the results were as follows: Figure 2 As shown in the microscopic examination picture. It can be seen from the picture that the short fermentation agent lactobacillus is Gram-positive, has a short rod shape, and has no spores.

[0045] 2.3 Detection of sugar alcohol fermentation biochemical reaction

[0046] Take 300 μL of frozen short fermentation lactobacillus and resuscitate the strain in 1 mL MRS medium. Take the liquid cultured short fermentation lactobacillus and purify it in MRS solid medium. Pick a single colony and inoculate it in 1 mL MRS liquid medium and culture it for 24 hours. Take the liquid cultured strain, dilute it in gradients, apply it in MRS solid medium and culture it for 72 hours. Then perform the sugar alcohol fermentation biochemical reaction detection respectively.

[0047] Basic characteristics verification reaction of strains: detection of sugar alcohol fermentation biochemical reaction

[0048] Use a sterilized pipette tip to pick up a single colony into a commercial bacterial biochemical test ampoule (purchased from Qingdao Haibo Biotechnology, see the table for the product number), inoculate and place it in 37°C for anaerobic culture for 48 hours, and judge the test results according to the kit instructions, as shown in Table 1:

[0049] Table 1

[0050]

[0051]

[0052] The test results prove that the tested strain is confirmed to be a short fermentation lactobacillus species (Levilactobacillus brevis). The strain was named short fermentation lactobacillus (Levilactobacillus brevis) ibiome003 and preserved in the China Center for Type Culture Collection, the preservation address is: China Center for Type Culture Collection of Wuhan University, Bayi Road, Wuchang District, Wuhan City, Hubei Province; the preservation date is: March 21, 2023, and the preservation number is CCTCCNO: M 2023387.

[0053] Example 3 Colonization effect of short fermentation agent Lactobacillus 1 (ibiome003) in the mouse intestine

[0054] Ten 6-8 week old SPF grade C57 / B6j male mice (purchased from Jicui Pharmaceutical) were randomly divided into two groups: one group was normal mice + saline group (5 mice) and the other group was normal mice + short fermentation lactobacillus 1 group (5 mice). Short fermentation lactobacillus was cultured in MRS medium, centrifuged at 3000rpm for 10min, and resuspended in 1xPBS to OD1.0 (600nm). 200μL short fermentation lactobacillus ibiome003 suspension (10 mice) was given to the mice in the short fermentation lactobacillus 1 group by gavage. 7 The mice in the normal saline group were given 200 μL normal saline by intragastric administration once every two days for 2 weeks to detect the colonization ability of short fermentation agent Lactobacillus 1.

[0055] Specifically, mouse feces were collected in sterile Ep tubes, weighed, and the feces weight was counted. DNA in feces was extracted using organic solvents (20% SDS, phenol chloroform, white grinding beads), and the load of the strain in mouse feces was quantitatively analyzed by QPCR using 16s rDNA primers (upstream primers Levil-FAAACAACTGTGTATTCCCCA, Levil-RCAACTAATAGGATCACCCCC; internal reference primers, upstream primer 27F: AGAGTTTG ATCCTGGCTCAG, downstream primer 1492R: GGTTA CCTTGTTACGACTT, calculation formula POWER (2, -ΔC) * 100%, where Ct target gene – Ct internal reference gene = ΔC), and the results are shown in the figure. Figure 3 As shown in , this strain of short fermenter Lactobacillus 1 has a strong colonization ability in the intestines of mice, suggesting that it may help it to better perform its functions.

[0056] The QPCR program is as follows: (1). 95℃ for 2 min; (2). 95℃ for 5 s; (3). 60℃, 30 s; 4. GOTO step2, 40x; (5). 95℃, 10 s; (6). 65℃, 5 s; (7). 95℃, 5 min.

[0057] Example 4 Colonization with short fermentation agent Lactobacillus 1 (ibiome003) alleviates the depressive phenotype of mice induced by chronic unpredictable stress (CUMS)

[0058] Twenty 6-8 week old SPF grade C57 / B6j male mice (purchased from Jicui Yaokang) were randomly divided into four groups, one group was normal mice + saline group (5 mice), one group was normal mice + short fermentation agent Lactobacillus 1 group (5 mice), one group was CUMS mice + saline group (5 mice), and one group was CUMS mice + short fermentation agent Lactobacillus 1 group (5 mice). After adapting to the environment, from day 0, the CUMS mouse group was subjected to chronic, unpredictable mild stimulation for 21 days to simulate the chronic low-intensity stress received by humans in daily life. Every day, one stimulus was selected from the day and night to treat the mice, the order was random, and there was no repetition in succession, so that the mice could not predict the appearance of the stimulus. After 21 days of continuous modeling, the depression modeling was confirmed to be successful by forced swimming, tail suspension, and sugar water preference experiments. Depression in mice caused by chronic unpredictable stress is a type of depression caused by physical (environmental) factors.

[0059] The short-fermented Lactobacillus 1 was cultured in MRS medium, centrifuged at 3000 rpm for 10 min, and resuspended in 1xPBS to OD 1.0 (600 nm). The mice in the short-fermented Lactobacillus 1 group were given 200 μL of the short-fermented Lactobacillus ibiome003 suspension (10 7 CFU), the mice in the normal saline group were given 200 μL normal saline by intragastric administration once every two days for 2 weeks, and the mice were tested by forced swimming and tail suspension tests, and the immobility time of mice in each group in the forced swimming and tail suspension tests was compared. The specific experimental methods are as follows.

[0060] The forced swimming test apparatus is a transparent 20x30cm round bucket filled with pure water, with a diameter of 20cm and a water depth of 15cm. The temperature of the pure water is 23-25℃. A camera is installed in front of the instrument and is flush with the water surface. After the mouse is placed in the water, a video of its activities in the water for 6 minutes is collected. The immobility time of the mouse within 4 minutes after the video is analyzed. Immobility behavior is defined as the behavior of the mouse floating, not struggling, or relying only on occasional swinging to maintain floating. The longer the immobility time, the more severe the depression. The immobility time in the forced swimming test reflects giving up the hope of escape, that is, behavioral despair.

[0061] The tail suspension test uses tape to suspend the mice by their tails in a position where they cannot escape or grab a nearby surface. A camera is installed in front of the mouse to record the activity video of the mouse hanging for 6 minutes. The immobility time of the mouse within 4 minutes after the video is analyzed. This test is based on the fact that animals will develop an immobile posture when subjected to short-term unavoidable stress. The more severe the depressive phenotype, the less time they will try to escape. The tail suspension test is to induce depressive and desperate behavior by being unable to overcome the abnormal body position, that is, to use the inability to escape from the adverse environment to cause desperate behavior.

[0062] The sugar water preference experiment is used to evaluate the sugar water preference of mice, which can reflect the degree of lack of pleasure (pleasure) in mice. In the entire animal experiment, a total of two sugar water preference experiments were conducted. Before modeling, the sucrose preference coefficient of all mice was measured through the sugar water preference experiment to ensure that the mice in the experiment were in the same state. After the experiment, the sugar water preference experiment was formally carried out, including the adaptation training part and the test part. During the training, two bottles of 1% (w / v) sucrose solution were placed in each cage of mice for the first 24 hours, and one of the bottles was replaced with pure water in the next 24 hours. After the adaptation was completed, they were fasted and deprived of water for 24 hours, and then the sugar water preference coefficient was measured. In the test, mice can only choose two bottles weighed in advance, one bottle is 1% (w / v) sucrose solution, and the other bottle is pure water. Fasting, after 24 hours, the two bottles are taken away and weighed, and the total liquid consumption, sugar water consumption and pure water consumption of the mice are recorded. The calculation method of sugar water preference coefficient is: sugar water preference coefficient (%) = sugar water consumption / (sugar water consumption + pure water consumption) × 100%. Sugar water preference experiment can reflect the lack of pleasure (pleasure), that is, the individual cannot experience happiness from rewards or pleasant activities; or lack of interest in reward stimulation, which is a manifestation of emotional disorder / depression.

[0063] The results are as follows Figure 4 As shown, in the forced swim and tail suspension tests ( Figure 4 A and 4B), the immobility time of the CUMS mice + short fermentation agent Lactobacillus 1 group was significantly lower than that of the CUMS mice + saline group, which was basically the same as that of the normal mice group, indicating that short fermentation agent Lactobacillus 1 can significantly alleviate the depressive behavior of mice caused by CUMS. In the sugar water preference experiment ( Figure 4 C), the sugar water preference of the CUMS mice + short fermentation agent Lactobacillus 1 group was significantly higher than that of the CUMS mice + normal saline group (P<0.01), which was basically equivalent to that of the normal mouse group, indicating that short fermentation agent Lactobacillus 1 can significantly restore the anhedonia-like depressive behavior of mice caused by CUMS.

[0064] Example 5 Effect of short fermentation agent Lactobacillus 1 (ibiome003) on mice

[0065] The weight changes of the mice in Example 4 were monitored. Starting from the beginning of gavage with the short fermentation agent Lactobacillus 1, the weight data of the mice were recorded every day and a weight curve was drawn. Figure 5 As shown, the experimental results showed that there was no significant difference in the weight changes of the four groups of mice, indicating that short fermentation agent Lactobacillus 1 did not affect the weight gain of mice and had good safety. The observation results showed that the mice in the short fermentation agent Lactobacillus 1 group were in good condition, and no adverse reactions occurred during the observation period, and there was no significant difference in the condition of the mice in the normal group.

[0066] After the experiment, the internal organs of the mice in the short fermentation agent lactobacillus 1 group were healthy and full, without organ lesions and adhesions between organs. HE staining was performed on the liver and intestinal tissues. Figure 6 Figure 7 There was no difference in cell morphology. ALT and AST in the serum of mice were evaluated and no side effects were found.

[0067] Example 6 Colonization with short fermentation agent Lactobacillus 1 (ibiome003) alleviates the depressive phenotype of mice induced by amino acid diet (AAD)

[0068] Twenty 6-8 week old SPF grade C57 / B6j male mice (purchased from Jicui Yaokang) were randomly divided into four groups: one group was normal mice + saline group (5 mice), one group was normal mice + short fermentation agent Lactobacillus 1 group (5 mice), one group was AAD mice + saline group (5 mice), and one group was AAD mice + short fermentation agent Lactobacillus 1 group (5 mice). After adapting to the environment, from day 0, the normal mice group was fed with ordinary mouse feed, and the AAD mice group was fed with amino acid food (Trophy, amino acid diet) for 4 weeks. The depression model was successfully established through forced swimming, tail suspension, and sugar water preference experiments. Depression in mice caused by amino acid food is food-induced depression.

[0069] Similarly, the short fermentation agent Lactobacillus 1(10 9 CFU) for 2 weeks. The mice were tested by forced swimming and tail suspension tests, and the immobility time of mice in each group was compared. Figure 8 A and Figure 8 As shown in B, the immobility time of the AAD mice + short fermentation agent Lactobacillus 1 group was significantly lower than that of the AAD mice + normal saline group, and was basically the same as that of the normal mice group, indicating that the short fermentation agent Lactobacillus 1 can significantly alleviate the depressive-like behavior of mice caused by amino acid food. Figure 8 As shown in C, the sugar water preference of the AAD mice + short fermentation agent Lactobacillus 1 group was significantly higher than that of the AAD mice + normal saline group (P<0.01), which was basically equivalent to that of the normal mouse group, indicating that the short fermentation agent Lactobacillus 1 can significantly restore the anhedonia-like depressive behavior of mice caused by AAD.

[0070] Example 7 Detection of the Content of Serotonin, Acetylcholine and Dopamine

[0071] The inventors administered normal saline and short fermentation culture Lactobacillus 1 (ibiome003) to the depressed mice induced by amino acid diet (AAD) in Example 6, and detected the contents of serotonin, acetylcholine and dopamine in their brains. Fig. 9The results showed that the levels of serotonin, acetylcholine, and dopamine in the brains of depressed mice gavaged with short fermentation agent Lactobacillus 1 were similar to those in the brains of depressed mice gavaged with normal saline, with no significant changes.

[0072] Example 8 Colonization with short fermentation agent Lactobacillus 1 (ibiome003) alleviates the depressive phenotype of mice induced by corticosterone (Cort)

[0073] Twenty 6-8 week old SPF grade C57 / B6j male mice (purchased from Jicui Yaokang) were randomly divided into four groups, one group was normal mice + saline group (5 mice), one group was normal mice + short fermentation agent Lactobacillus 1 group (5 mice), one group was Cort mice + saline group (5 mice), and one group was Cort mice + short fermentation agent Lactobacillus 1 group (5 mice). After adapting to the environment, from day 0, the drinking water of the Cort mouse group (MCE, HY-B1618) was a corticosterone solution with a final concentration of 25 μg / mL (pH 7.0-7.4), and the normal mouse group received ordinary drinking water, which was changed every 2 days, and the model was established for 21 days. After the model was established, the successful modeling was confirmed by forced swimming, tail suspension, and sugar water preference experiments. Corticosterone (Cort)-induced depression in mice is a depression caused by chemical factors such as chemicals.

[0074] Similarly, the short fermentation agent Lactobacillus 1(10 12 CFU) for 2 weeks. The mice were tested by forced swimming and tail suspension tests, and the immobility time of mice in each group was compared. Fig.10 A and Fig.10 As shown in B, the immobility time of the Cort mice + short fermentation agent Lactobacillus 1 group was significantly lower than that of the Cort mice + normal saline group, which was basically the same as that of the normal mice group, indicating that the short fermentation agent Lactobacillus 1 can significantly alleviate the depressive-like behavior of mice caused by corticosterone. Fig.10 As shown in C, the sugar water preference of the Cort mouse + short fermentation agent Lactobacillus 1 group was significantly higher than that of the Cort mouse + normal saline group (P<0.01), which was basically equivalent to that of the normal mouse group, indicating that the short fermentation agent Lactobacillus 1 can significantly restore the anhedonia-like depressive behavior of mice caused by Cort.

[0075] Example 9 Not all short fermentation lactobacilli can relieve depression symptoms

[0076] We tested several strains of short fermentation lactobacillus from the intestines of healthy people. Here, a control short fermentation lactobacillus 2 was used as a comparison and test. 6-8 week-old SPF-grade C57 / B6j male mice (purchased from Jicui Yaokang) were randomly divided into three groups: one group was a depression group + saline group (5 mice), one group was a depression group + short fermentation lactobacillus 1 group (5 mice), and one group was a depression group + control short fermentation lactobacillus 2 group (5 mice). After adapting to the environment, from day 0, the mouse group was subjected to chronic, unpredictable mild stimulation for 21 days to simulate the chronic low-intensity stress received by humans in daily life. Every day, one stimulus was selected from the day and night to treat the mice, and the order was random and continuous without repetition, so that the mice could not predict the occurrence of the stimulus. After 21 days of continuous modeling, the depression modeling was confirmed to be successful by forced swimming, tail suspension, and sugar water preference experiments. Similarly, short fermentation lactobacillus was colonized in the intestines of mice by gavage for a period of 2 weeks. The mice were subjected to forced swimming and tail suspension tests, and the immobility time of the mice in each group was compared.

[0077] The results are as follows Fig.11 The results showed that there was no significant difference in the immobility time of forced swimming and tail suspension between mice gavaged with the control short-fermented Lactobacillus 2 and the control depressed mice, and the degree of depression was not relieved, proving that not all short-fermented Lactobacillus have the function of relieving depression.

[0078] Example 10 Short fermentation agent Lactobacillus 1 (ibiome003) has acid and bile resistance

[0079] (1) Experimental groups

[0080] Acid resistance test: A. Buffer control group; B. pH 3.0 simulated gastric fluid group

[0081] Bile salt tolerance test: A. Buffer control group; B. 0.3% bile salt simulated intestinal fluid group

[0082] (2) Reagent preparation

[0083] pH 3.0 simulated gastric fluid: Take 0.25g of pepsin and add it to 20ml of water, adjust the pH to 3, and add water to make up to 25ml.

[0084] Buffer solution: Weigh 6.8 g potassium dihydrogen phosphate and dissolve it in 500 mL pure water. Adjust the pH value to 6.8 with 0.1 mol / L sodium hydroxide solution.

[0085] Bile salt simulated intestinal fluid: Take bile salt solid and prepare 20 ml of 0.3% bile salt simulated intestinal fluid according to the proportion.

[0086] (3) Operation

[0087] Take 2 g of Lactobacillus 1 short fermentation agent powder and vortex it in 18 ml of sterile saline until it is completely dissolved to prepare the test solution.

[0088] Take 1mL of the test solution and add it to 9mL of buffer or pH3.0 simulated gastric fluid and mix well. Take samples after standing, sampling time points: 0h, 0.5h, 1h, 2h. Take 100μl of the sample and dilute it 10 times, select the appropriate gradient, and take 100μl to spread on the surface of MRS culture medium. Select four gradients according to the time change, and culture at 30℃ after coating, observe and record the growth of the colony.

[0089] Take 2mL of the test solution and add it to 18mL of buffer or 18mL of 0.3% bile salt simulated intestinal fluid, mix well, let it stand, take 100μl of samples at 0h, 1.5h, 3h, 4.5h, 6h, dilute it 10 times, select the appropriate gradient, and take 100μl to spread on the surface of MRS culture medium. Select four gradients according to the time change, and culture at 30℃ after spreading, observe and record the growth of colonies.

[0090] (4) Result Statistics

[0091] Table 1 Statistics of acid resistance results of short fermentation agent Lactobacillus 1 powder

[0092]

[0093] Table 2 Statistics of bile salt tolerance results of short fermentation agent Lactobacillus 1 powder

[0094]

[0095] The results showed that the short fermentation agent Lactobacillus 1 had good tolerance in the simulated gastric fluid solution of pH 3.0, and the number of viable bacteria decreased slowly. The decrease in the simulated intestinal fluid solution of 0.3% bile salt was not large, indicating that the short fermentation agent Lactobacillus 1 had good acid and bile salt resistance.

Claims

1. Short fermentation agent Lactobacillus ( Levilactobacillus brevis ) ibiome003, characterized in that: The short fermentation agent lactobacillus strain is deposited in the China Type Culture Collection Center, the address is China Type Culture Collection Center of Wuhan University, Bayi Road, Wuchang District, Wuhan City, Hubei Province, the preservation date is March 21, 2023, and the preservation number is CCTCC NO: M2023387.

2. A drug, characterized in that comprising the short fermentation agent lactobacillus ( Levilactobacillus brevis ) ibiome003 and a pharmaceutically acceptable excipient, carrier, auxiliary material or vehicle.

3. The drug according to claim 2, characterized in that: The medicine is a powder, a suspension, a granule, a capsule, a tablet, a pill, an oral solution, an injection or a powder injection.

4. A method comprising the short fermentation agent lactobacillus ( Levilactobacillus brevis )ibiome003 fermentation agent or functional bacterial agent.

5. The short fermentation agent lactobacillus according to claim 1 ( Levilactobacillus brevis ) ibiome003, or the drug according to any one of claims 2 to 3, in the preparation of a drug for treating or alleviating depression and / or anxiety.

6. The use according to claim 5, characterized in that The symptoms of depression include but are not limited to: a) give up hope of escape; b) acts of desperation; c) unable to escape from hostile environment; d) lack of pleasure; e) Lack of interest in rewarding stimuli.

7. The use according to claim 5, characterized in that: The depression is caused by physical environmental factors, chemical factors and / or special foods.

Images