A temperature-resistant type of Morchella liumei and its cultivation method

Abstract

The invention discloses a temperature-resistant Morchella sextelata and a cultivation method thereof. The Morchella sextelata is named Morchella sextelata JSD24-1, with a deposit number of CCTCC M 20232339, a deposit unit of China Center for Type Culture Collection, a deposit time of November 27, 2023, and a deposit address of Wuhan University, No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province. The Morchella sextelata JSD24-1 provided by the invention has strong adaptability to temperature, an increase of 5-6°C in high temperature tolerance during the fruiting stage, and an extension of 1-3°C in low temperature tolerance; it performs well in relatively simple or general conditions such as southern flat sheds and northern cold sheds, and can produce mushrooms stably.

Description

Technical Field

[0001] The invention relates to the field of Morchella, and in particular to a temperature-resistant Morchella liumei and a cultivation method thereof. Background Art

[0002] Morchella spp. belongs to the genus Morchella, which belongs to the class Discomycetes, the order Pezizales, the family Morchellaceae, and the subphylum Ascomycota. It is a kind of edible and medicinal fungus with high economic value. In recent years, the development of the morel industry has attracted much attention, the scale of cultivation has grown rapidly, and the market price is relatively good. However, the high risk of morel cultivation has not changed. Every year, a large number of bases suffer losses or even no harvest. In particular, in recent years, the overall performance of the southern production areas (Sichuan, Guizhou, Yunnan, etc.) has been sluggish. The northern production areas have better conditions for planting equipment and facilities, and the risk is slightly lower than that of the southern production areas, but there are still bases that suffer losses every year.

[0003] The quality of strains, facility conditions, whether to continue cropping, management techniques and other aspects will affect the yield, but one of the most important factors is that the temperature adaptability range of current conventional Morchella varieties is relatively narrow (5-20°C), and once the key fruiting node (primordium to 3-5cm small mushroom stage) encounters abnormal weather such as high temperature or low temperature, it is easy to cause large-scale mushroom death. Therefore, it is very urgent to develop new Morchella strains with strong temperature adaptability. Deeply aware of the limitations of current conventional Morchella varieties in temperature resistance, the present invention has selected a new temperature-resistant Morchella strain JSD24-1. Summary of the invention

[0004] In view of the deficiencies in the prior art, the present invention provides a new strain of Morchella liumei, which has strong adaptability to high and low temperatures, high yield, and resistance to repeated cropping.

[0005] To solve the above technical problems, the technical solution of the present invention is as follows: In the first aspect of the present invention, a temperature-resistant Morchella extelata is provided, and the Morchella extelata is named Morchella extelata JSD24-1, with a preservation number of CCTCC M 20232339, a preservation unit of China Center for Type Culture Collection, a preservation time of November 27, 2023, and a preservation address of Wuhan University, No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province.

[0006] In a second aspect of the present invention, a molecular marker of the high temperature resistant Morchella lilii is provided, and the nucleotide sequence of the molecular marker is shown in SEQ ID No.2.

[0007] The third aspect of the present invention provides the application of the molecular marker in the identification of Morchella varieties.

[0008] Preferably, the specific primer pair of the molecular marker is:

[0009] 568-F3:TGAAGAACCGAGGAACTAACAC;

[0010] 568-R3:GTGGCAGTTCGTTCGTAGC.

[0011] In a fourth aspect of the present invention, a method for culturing the temperature-resistant Morchella lilii mother strain is provided, and the method for culturing the mother strain is as follows:

[0012] Prepare PDA plate culture medium, pH 5.8-6.2, culture medium is sterilized by high temperature and high pressure wet heat at 0.11 MPa atmospheric pressure and 121°C for 25-35 min, pour the plate in a clean bench, inoculate six sister morel JSD24-1 under strict aseptic operation conditions after cooling, and culture in the dark at 18-23°C for 4-5 days. After the mycelium covers the plate, the six sister morel JSD24-1 mother strain is obtained.

[0013] In a fifth aspect of the present invention, a method for culturing the high temperature resistant Morchella lilii stock is provided, and the stock culturing method is as follows:

[0014] The formula of the original seed culture medium is as follows: 60-75% of wheat, 15-25% of sawdust, 8-12% of corn cobs, 0.5-1.5% of quicklime, 0.5-1.5% of gypsum, and a water content of 55% to 60%. It is packaged in 500-1000mL glass bottles or plastic bottles, 400-800g per bottle, and sterilized at 0.11MPa atmospheric pressure and 121°C high temperature and high pressure wet heat for 2-3h. After cooling, the mother seed of Morchella esculenta JSD24-1 is inoculated under strict aseptic operation conditions, and cultured at 14-18°C in the dark for 15-20 days. After the mycelium is fully fed with the material, the original seed of Morchella esculenta JSD24-1 is obtained for the preparation of cultivated seeds.

[0015] In a sixth aspect of the present invention, a cultivation method of the six-sister morel is provided, and the cultivation method is performed as follows:

[0016] Management during sowing and mycelium growth period

[0017] After soil pretreatment, when the ground temperature of the planting site is below 18℃ for a week, you can sow the seeds. First, water the soil, dry it and sprinkle quicklime. Plant ridges in the greenhouse. Sow 150-300 bags of cultivation seeds per mu. After spreading the fungus, cover the soil with 2-4cm. The soil moisture should be 18-25%; add external nutrient bags.

[0018] One week after sowing, fungus frost begins to form. 8-12 days after sowing, place nutrient bags, 2000-3000 bags per mu. Use a knife to make two holes on the side of the nutrient bag facing the ground to facilitate direct contact between the mycelium and the nutrient bag. Then the mycelium slowly grows into the nutrient bag, absorbs nutrients in the nutrient bag and transfers nutrients to the mycelium in the soil. After the nutrient bags are placed, cover with black mulch.

[0019] Mushroom Management

[0020] About 30-50 days after sowing, when the nutrient bag begins to shrink, the primordium is formed, and the temperature is suitable for the next 7-10 days, light stimulation begins. Sunlight enters the greenhouse during the day. After 4-5 days, water heavily for mushroom management. Subsequently, young mushrooms will grow one after another. Keep the temperature / humidity in the greenhouse constant and harvest when the fruiting bodies are mature.

[0021] Preferably, the cultivar cultivation process is as follows:

[0022] Cultivated seed formula: 60-75% wheat, 15-25% sawdust, 8-12% corn cobs, 0.5-1.5% quicklime, 0.5-1.5% gypsum, water content of 60% to 65%, packed in polyethylene bags, 600-1200g per bag, sterilized by wet heat at 0.11MPa atmospheric pressure and 121℃ high temperature and high pressure for 2-3h, inoculated under strict aseptic operating conditions after cooling, cultured in the dark at 14-18℃ for 20-25d, and prepared as cultivated seeds after the mycelium has eaten all the materials.

[0023] Preferably, the nutrition bag formula is as follows:

[0024] Wheat 50-60%, corn cob 38-45%, quicklime 0.5-1.5%, gypsum 0.5-1.5%, potassium dihydrogen phosphate 0.15-0.35%, the moisture content of the nutrients is 65%-70%, packed in polyethylene bags, 600-1000g per bag, sterilized at 0.11MPa atmospheric pressure, 121℃ high temperature and high pressure wet heat for 2-3h, and set aside after cooling.

[0025] As a preferred method, the soil is pretreated before sowing as follows: the pH of the soil for growing morels is preferably 6.5-7.8. In order to reduce the impact of diseases and pests during the cultivation of morels, deep plowing, film covering and shrouding the shed are carried out during the idle period of the shed, and the high temperature in the shed is used to kill the pathogens and pests in the soil, effectively preventing the invasion of bacteria and pests on the morels;

[0026] The prevention and control of diseases and pests are as follows: If pathogen infection is found during the cultivation of morels, the infected parts must be removed in time and disinfected; at the same time, the planting shed should be well ventilated to reduce the humidity of the soil and air and inhibit the reproduction and spread of pathogens. If snails and slug pests appear, they must be controlled with appropriate pesticides in time; at the same time, yellow boards must be hung in the shed during the mushroom period to prevent damage by mushroom mosquitoes and mushroom flies.

[0027] The characteristics of the present invention are as follows: the six-sister Morchella JSD24-1 provided by the present invention has strong adaptability to temperature, and its high temperature tolerance in the fruiting stage is improved by 5-6°C, and its low temperature tolerance is extended by 1-3°C; it has good high temperature and low temperature resistance, high yield, and can resist repeated cropping. In addition, the present invention also develops a molecular marker specific to the six-sister Morchella JSD24-1, which can specifically identify the high temperature resistant six-sister Morchella.

[0028] Compared with the prior art, the present invention has the following beneficial effects: the six-sister morel JSD24-1 provided by the present invention has strong adaptability to temperature, its high temperature tolerance during the fruiting stage is increased by 5-6°C, and its low temperature tolerance is extended by 1-3°C; it performs excellently under relatively simple or general conditions such as flat sheds in the south and cold sheds in the north, and can produce mushrooms stably. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 Results of electrophoresis of ITS gene amplification of Morchella liumei JSD24-1; M: DNA marker DL2000; CK: negative control;

[0030] Figure 2 Phylogenetic tree of Morchella japonica JSD24-1 constructed by NJ method;

[0031] Figure 3 The results of mating type gene amplification and electrophoresis of Morchella liumei JSD24-1; M: DNA marker DL2000; CK1: negative control; CK2: Mat1-1-1 positive control; CK3: Mat1-2-1 positive control;

[0032] Figure 4 The fruiting body color changes of Morchella liumei JSD24-1; left: early stage of fruiting body development; right: fruiting body maturity;

[0033] Figure 5 Fruiting body growth of common Morchella and Morchella edulis JSD24-1 under low temperature conditions; left: common Morchella; right: Morchella edulis JSD24-1;

[0034] Figure 6 Fruiting body growth of common Morchella and Morchella edulis JSD24-1 under high temperature conditions; left: common Morchella; right: Morchella edulis JSD24-1;

[0035] Figure 7 The growth of common Morchella and Morchella edulis JSD24-1 in the continuous cropping plot; left: common Morchella; right: Morchella edulis JSD24-1;

[0036] Figure 8Electrophoresis results of PCR products with specific primers of Morchella liumei strain JSD24-1; M: DNA marker DL2000; CK: negative control. DETAILED DESCRIPTION

[0037] The technical solution of the present invention is further described in detail below in conjunction with the accompanying drawings and specific embodiments, but the present invention is not limited to the following technical solution.

[0038] Example 1 Collection, purification and identification of Morchella sutchuenensis JSD24-1

[0039] Wild fruiting body collection

[0040] A wild Morchella fruiting body was collected in Linzhi, Tibet in May 2019. The collected wild Morchella fruiting body was naturally air-dried and stored for later use.

[0041] Strain isolation and purification

[0042] ⑴ Place the prepared PDA culture medium in a microwave oven to heat and melt, and pour it into a plate in a clean bench for later use.

[0043] ⑵ Take some tissue blocks in the clean bench and place them in 10ml centrifuge tubes;

[0044] ⑶ Add about 5 ml of sterile water to the centrifuge tube and let it stand for 3 minutes to allow the dry tissue to absorb water and swell; then shake the centrifuge tube up and down for 3-5 minutes to clean the tissue and pour the waste liquid into the waste liquid tank; repeat the cleaning steps 4-5 times;

[0045] (4) Use pointed tweezers to pick up the tissue block, place it on clean sterile filter paper, and use tweezers to turn the tissue block over so that the filter paper absorbs the surface moisture;

[0046] ⑸ Use a scalpel to cut the tissue blocks into small pieces the size of silkworm eggs on sterile filter paper, and place them on flat culture media for culture. Place 5-8 small pieces on each plate. The inoculated plates are placed in a constant temperature incubator at 23°C for dark culture.

[0047] (6) When the hyphae sprouted from the tissue block on the plate grow to 1-1.5 cm, pick out fresh hyphae and transfer them to a new PDA plate medium, and place it in a 23℃ constant temperature incubator for dark culture. The grown plates are stored at 4℃ for later use.

[0048] Species identification

[0049] A pure culture plate of wild fruiting bodies was obtained by tissue separation. Fresh mycelium was taken from the plate and genomic DNA was extracted using a polysaccharide and polyphenol plant genomic DNA extraction kit (Tian Gen, DP360). The obtained DNA solution was stored at -20°C for future use.

[0050] The ITS sequence was amplified using the universal primers ITS1 / ITS4 for the fungal ribosomal intergenic region (the primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.), and sequencing analysis was performed to determine the species.

[0051] Primers:

[0052] ITS1 TCCGTAGGTGAACCTGCGG

[0053] ITS4 TCCTCCGCTTATTGATATGC

[0054] Table 1 PCR reaction system

[0055]

[0056] Table 2 PCR reaction program

[0057]

[0058]

[0059] According to the reaction system in Table 1 and the reaction procedure in Table 2, PCR reaction was performed to obtain PCR amplification products. The PCR products were run on agarose gel for detection of specific banding (see Figure 1 ) and sent to Shanghai Biotechnology Co., Ltd. for sequencing.

[0060] After the sequencing results were returned, the target ITS sequence with accurate sequencing was spliced ​​as shown in SEQ ID No. 1. The ITS sequence of the strain was downloaded from NCBI by BLAST. The strain was tested and the ITS gene sequence of the species with the highest homology was used to construct a phylogenetic tree using the Neighbor-Joining method of MEGA6.0, and it was identified as Morchella sextelata, which was named Morchella sextelata JSD24-1 ( Figure 2 ). It was deposited in the China Center for Type Culture Collection on November 27, 2023, with the accession number: CCTCC M20232339. Mating type gene (MAT1-1-1, MAT1-2-1) detection

[0061] The mating type gene is a gene cluster site that controls development. It is believed in the art that Morchella is a heterothallic fungus, and its two mating type sites are located in different nuclei. The completion of sexual reproduction requires the interaction of two different mating type (MAT1-1-1, MAT1-2-1) nuclei. The absence of the mating type gene is not conducive to production. Therefore, mating type gene detection is an important step before producing Morchella strains.

[0062] The mating type gene was detected using the genomic DNA of Morchella liumei JSD24-1 as a template. The size of the amplified product of the primer pair Mat1-1-1F / R was 705bp, and the size of the amplified product of the primer pair Mat1-2-1F / R was 557bp. The primer sequences are as follows:

[0063] Mat1-1-1F: CCACCTTCTGAGTCCGTTATG

[0064] Mat1-1-1R:CCGCAGTTGTGTAGGAATGAG

[0065] Mat1-2-1F:GGTTGCGTCCGAAGAATAGC

[0066] Mat1-2-1R: CCTTCATCTCTGTGTTGCGATA

[0067] Table 3 Reaction system

[0068]

[0069]

[0070] Table 4 Reaction procedure

[0071]

[0072] According to the reaction system in Table 3 and the reaction procedure in Table 4, PCR reaction was performed to obtain PCR amplification products. The PCR reaction products were run on agarose gels, showing that Morchella sextelata JSD24-1 had two mating types ( Figure 3 ).

[0073] Embodiment 2 The artificial cultivation method of six sister Morchella JSD24-1

[0074] Bacteria culture medium formula and strain preparation

[0075] (1) Mother stock culture

[0076] PDA plate culture medium, formula: potato powder 5g / L, glucose 20g / L, agar 15g / L, pH 5.8-6.2. 0.11MPa atmospheric pressure, 121℃ high temperature and high pressure wet heat sterilization for 30min, pour the plate in the clean bench. After cooling, inoculate under strict aseptic operation conditions, and culture in the dark at 23℃ for 4-5 days. After the mycelium fills the plate, it can be used as a mother strain for stock preparation.

[0077] (2) Original seed culture

[0078] Original seed formula: 68% wheat, 20% sawdust, 10% corn cob, 1% quicklime, 1% gypsum. Water content is 55% to 60%. Packed in 750mL glass bottles or plastic bottles, 600g per bottle. Sterilize at 0.11MPa atmospheric pressure, 121℃ high temperature and high pressure wet heat for 2h. After cooling, inoculate under strict aseptic operation conditions. Cultivate at 18℃ in the dark for 15d. After the mycelium has eaten all the materials, it can be used as original seed for cultivation seed preparation.

[0079] (3) Cultivation of cultivars

[0080] Cultivation formula: 68% wheat, 20% sawdust, 10% corncob, 1% quicklime, 1% gypsum. Water content is 60% to 65%. Packed in 14cm×28cm polyethylene bags, 900g per bag. Sterilize at 0.11MPa atmospheric pressure, 121℃ high temperature and high pressure wet heat for 2h. Inoculate under strict aseptic operation conditions after cooling. Cultivate at 18℃ in the dark for 20d. After the mycelium has eaten all the materials, it can be prepared as cultivation seeds.

[0081] (4) Nutrition bag formula

[0082] Wheat 55%, corn cob 42.75%, quicklime 1%, gypsum 1%, potassium dihydrogen phosphate 0.25%. The water content of the nutrient is 65% to 70%. Packed in 15cm×30cm polyethylene bags, 800g per bag. Sterilize at 0.11MPa atmospheric pressure, 121℃ high temperature and high pressure for 2h, and set aside after cooling.

[0083] Soil preparation before sowing

[0084] Testing and adjustment of soil pH: The soil pH for morel cultivation should be between 6.5 and 7.8. If the soil pH is less than 6.0, quicklime can be used to adjust the soil pH to the appropriate range.

[0085] Soil pretreatment: In order to reduce the impact of pests and diseases during the cultivation of morels, physical methods are often used to pretreat the soil. During the idle period of the greenhouse, deep plowing and film covering are carried out to kill pathogens and pests in the soil using the high temperature in the greenhouse, effectively preventing bacteria and pests from invading morels.

[0086] Sowing and cultivation management

[0087] (1) Management during sowing and mycelium growth period

[0088] It can be planted in most parts of the country from October to December every year. When the ground temperature of the planting site is below 18℃ for a week, it can be sown. First, water it heavily, dry it and sprinkle quicklime (100 kg per mu), plant it in ridges in the shed, sow 200 bags of cultivation seeds per mu, spread the fungus seeds and cover them with about 3cm of soil, and the soil moisture is about 20%.

[0089] (2) Add external nutrition bag

[0090] One week after sowing, fungus frost begins to form. About 10 days later, nutrient bags are placed, 2,500 bags per mu. Two holes are made on the side of the nutrient bag facing the ground with a knife to facilitate direct contact between the mycelium and the nutrient bag. Then the mycelium slowly grows into the nutrient bag, absorbs nutrients from the nutrient bag and transfers nutrients to the mycelium in the soil. After the nutrient bags are placed, cover with black mulch.

[0091] (3) Mushroom production management

[0092] About 30-50 days after sowing, when the nutrient bag begins to shrink (nutrients are transported to the mycelium), the primordium is formed, and the temperature is suitable for the next 7-10 days (the soil temperature is continuously above 5℃, and there is no cold current / high temperature), light stimulation (sunlight enters the greenhouse during the day) is started at this time, and 4-5 days later, water heavily for mushroom management. Later, young mushrooms will grow one after another, and the temperature / humidity in the greenhouse should be kept constant, and the fruiting bodies will be harvested after they mature.

[0093] (4) Pest and disease control

[0094] During the cultivation of morels, various diseases and pests may invade. Common diseases include red foot disease, white mold disease, spider web disease, etc. If pathogens are found, the infected parts should be removed and disinfected in time; at the same time, the planting shed should be well ventilated to reduce the humidity of the soil and air and inhibit the reproduction and spread of pathogens. If snails, slugs and other pests appear, they should be controlled with appropriate pesticides in time; at the same time, yellow boards should be hung in the shed during the fruiting period to prevent the harm of mushroom mosquitoes, mushroom flies, etc.

[0095] 3Collection of agronomic traits of Morchella siliqua JSD24-1

[0096] The fruiting body color of Liumei Morchella JSD24-1 can be seen Figure 4 , it is yellowish in the early stage (left picture), and turns brown to black in the later stage (right picture, which is largely related to light intensity).

[0097] The fruiting body size of Liumei Morchella JSD24-1: The commercial mushroom (with a 2cm handle under the mushroom cap) is 13-18cm long.

[0098] Yield per mu of Liumei Morchella JSD24-1: Different planting pattern tests have been completed in many locations in China (Table 1).

[0099] (1) Southern flat-shed model (Yunnan): Sowing in late November, 3-5 cm small mushrooms appear 60 days after planting, peak mushroom picking at 90 days, and harvesting is completed at 100 days. The highest temperature during the fruiting period is 23°C, the lowest temperature is 3°C, and the fruiting body grows normally. The yield per mu reaches 300-500g.

[0100] (2) Northern cold greenhouse model (Shandong): Sowing in early December, considering ground temperature, nutrient absorption, weather changes, etc. according to specific conditions, generally watering with mushroom-inducing water 70-90 days after planting, and harvesting is completed 120 days. On April 20, 2023, the temperature at the Shandong base was 25.7℃ at a height of 10cm from the soil surface, and the fruiting body grew normally. The yield per mu reached 400-600kg.

[0101] (3) Off-season planting (Shangri-La, Yunnan): Planting from May to July. In July, under the high temperature and rainy conditions (the measured temperature in the planting shed was 27.3°C), the mushroom production was excellent, with an acreage yield of 364 kg.

[0102] (4) Anti-repetitive cropping mode: It also performs well in repetitive cropping bases. In the flat greenhouse in Shangri-La, Yunnan, the yield per mu of the repetitive cropping plot in the second year reached 300 kg. In the cold greenhouse in Weihai, Shandong, the yield per mu of the repetitive cropping plot in the fifth year reached 320 kg.

[0103] Table 5 Yield of Morchella liumei JSD24-1 under different planting modes

[0104]

[0105]

[0106] Temperature adaptability of Liumei Morchella JSD24-1: Strong adaptability to temperature. The high temperature tolerance during the fruiting stage is increased by 4-5℃ (measured at 25.7℃ at 10cm from the soil surface), and the low temperature tolerance is extended by 2℃ (measured at 3℃ at 10cm from the soil surface). It performs well in relatively simple or general conditions such as flat greenhouses in the south and cold greenhouses in the north, and can produce mushrooms stably.

[0107] Example 3 Comparison of high temperature resistance and resistance to repeated cropping

[0108] (1) In the fruiting period, when the temperature is below 4°C, the fruiting bodies of common Morchella species are frozen and cannot grow normally, resulting in a total crop failure or extremely low yields. Figure 5 Left picture). Six-sister Morchella JSD24-1 has a certain resistance to low temperatures, and its fruiting bodies can grow normally ( Figure 5 right).

[0109] (2) During the fruiting period, when the temperature is higher than 25°C, the common Morchella varieties have weak high temperature resistance, the fruiting bodies grow slowly, and the wild growth of foreign bacteria becomes the dominant bacterial flora in the field and infects the Morchella fruiting bodies, resulting in a total crop failure ( Figure 6 Left picture). Liumei Morchella JSD24-1 has a certain ability to resist high temperature, and its fruiting body can grow normally ( Figure 6 right).

[0110] (3) Liumei Morchella JSD24-1 has a certain ability to resist repeated cropping. The mycelium of common Morchella varieties grows weakly and the primordium differentiation is less in the repeated cropping field. In the later stage, the fruiting body is easily infected by foreign bacteria and stops growing. Figure 7 Left picture). Liumei Morchella JSD24-1 can produce mushrooms normally and has excellent performance ( Figure 7 right).

[0111] Example 4 Molecular marker development of Morchella liumei JSD24-1

[0112] In order to better protect the strain, the present invention develops a molecular marker specific to Morchella liliifolia JSD24-1.

[0113] Whole genome resequencing

[0114] The mycelia of the thermotolerant Morchella liumei strain JSD24-1 and the six commonly used control Morchella strains (Kunzhi No. 1, Kunzhi No. 2, Chuan Morchella No. 6, G5, G8, and Liumei No. 13) were transferred to PDA plates covered with cellophane and cultured in the dark at 23°C for 5-6 days to obtain fresh mycelia. The fresh plates were sent to Xi'an Haorui Gene Technology Co., Ltd., and the PacBio HiFi platform's circular consistency sequencing (CCS) scheme was used to extract DNA, build libraries, and sequence samples. After fastp was used to filter the data from the machine, an average of 2.2G of Clean Data data was obtained for each sample, with an average sequencing depth of 41x. The Clean Data was aligned to the reference genome sequence (GCA_024713665.1) using bwa software to obtain the position information of the sequence on the genome (i.e., SAM file). The InDel marker information of the genome was then obtained using bcftools software. We also used hifiasm to perform denovo assembly on Clean Data. After obtaining the preliminary third-generation assembly results, we used blast to reconfirm the InDels obtained by bcftools in the genome obtained by hifiasm to obtain the final InDel detection results.

[0115] Specific primer design

[0116] Based on the InDel detection results of whole genome resequencing, the specific InDel site of Morchella japonica JSD24-1 was screened according to the sequencing depth and the number of bases of insertion / deletion fragments. The Scaffold number of the site is: JAMGYU010000011.1, and the bases 244219-244224 (ATTGTG) are replaced by a 284bp base fragment, and the sequence is shown in SEQ ID No.2.

[0117] Based on the specific InDel, the corresponding specific primers were designed, and PCR screening and verification were performed using the genomic DNA of the thermotolerant Morchella japonica strain JSD24-1 and 10 commonly used control Morchella strains (Kunzhi No. 1, Kunzhi No. 2, Chuan Morchella No. 6, G5, G8, G18, Yang Guifei, Jinqiu 52, G10, and Liumei No. 13) as templates. Finally, a pair of specific primers with strong specificity and specificity for the Morchella japonica strain JSD24-1 were obtained. The primers are:

[0118] 568-F3:TGAAGAACCGAGGAACTAACAC

[0119] 568-R3: GTGGCAGTTCGTTCGTAGCPCR identification

[0120] Using the genomic DNA of the six-sister Morchella strain JSD24-1 and 10 control Morchella strains as templates, PCR amplification was performed using specific primers 568-F3 and 568-R3 under the conditions shown in Tables 6 and 7 to obtain PCR products.

[0121] Table 6 Specific primer PCR system of Morchella liumei strain JSD24-1

[0122]

[0123] Table 7 PCR amplification program with specific primers of Morchella lilii strain JSD24-1

[0124]

[0125] Take 10 μL of PCR product and DNA Marker and spot it on 1% (mass volume ratio) agarose gel, electrophoresed at 150V for 25 minutes, and then observe it on a gel imager. Figure 8 Only the Morchella liumei strain JSD24-1 had a specific band at about 400 bp, while the 10 control strains had no band.

[0126] The specific primer PCR product was sent to Shanghai Biotech Co., Ltd. for sequencing. The specific primer pair 568-F3 / R3 amplified sequence of the six-sister Morchella strain JSD24-1 was obtained by sequencing as shown in SEQ ID No. 3. The specific nucleic acid sequence is 398 bp in total, which is consistent with the size of the electrophoresis band. The reason why the sequence has more bases than the molecular marker sequence is that the reverse primer of the specific primer pair is located downstream of the molecular marker.

[0127] The above embodiments are merely examples for the purpose of clear explanation, and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived therefrom are still within the scope of protection of the present invention.

Claims

1. A high temperature resistant Morchella liumei, characterized in that: The Morchellasextelata is named Morchellasextelata JSD24-1, with a preservation number of CCTCC NO: M 20232339, a preservation unit of China Center for Type Culture Collection, a preservation time of November 27, 2023, and a preservation address of Wuhan University, No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province.

2. A molecular marker of the temperature-resistant Morchella lilii according to claim 1, characterized in that: With reference to the genome sequence GCA_024713665.1, based on the InDel detection results of the whole genome resequencing of Morchella liliifolia, the specific InDel site of Morchella liliifolia JSD24-1 was screened according to the sequencing depth and the number of bases of the insertion / deletion fragments. The Scaffold number of the site is: JAMGYU010000011.1, and the bases ATTGTG at positions 244219-244224 are replaced by a base fragment of 284 bp, and the sequence is shown in SEQ ID No.

2.

3. An application of the molecular marker according to claim 2 in the identification of the variety of Morchella japonica JSD24-1.

4. The use of the molecular marker according to claim 3 in the identification of the variety of Morchella liumei JSD24-1 is characterized in that: The specific primer pair of the molecular marker is: 568-F3:TGAAGAACCGAGGAACTAACAC; 568-R3:GTGGCAGTTCGTTCGTAGC.

5. A method for culturing the temperature-resistant Morchella liumei mother strain according to claim 1, characterized in that: The mother seed culture method is as follows: Prepare PDA plate culture medium, pH 5.8-6.2, culture medium is sterilized by high temperature and high pressure wet heat at 0.11 MPa atmospheric pressure and 121°C for 25-35 min, pour the plate in a clean bench, inoculate six sister morel JSD24-1 under strict aseptic operation conditions after cooling, and culture in the dark at 18-23°C for 4-5 days. After the mycelium covers the plate, the six sister morel JSD24-1 mother strain is obtained.

6. A method for culturing the high temperature resistant Morchella liumei stock according to claim 1, characterized in that: The original seed culture method is as follows: The formula of the original seed culture medium is as follows: 60-75% of wheat, 15-25% of sawdust, 8-12% of corn cobs, 0.5-1.5% of quicklime, 0.5-1.5% of gypsum, and a water content of 55% to 60%. It is packaged in 500-1000mL glass bottles or plastic bottles, 400-800g per bottle, and sterilized at 0.11MPa atmospheric pressure and 121°C high temperature and high pressure wet heat for 2-3h. After cooling, the mother seed of Morchella esculenta JSD24-1 is inoculated under strict aseptic operation conditions, and cultured at 14-18°C in the dark for 15-20 days. After the mycelium is fully fed with the material, the original seed of Morchella esculenta JSD24-1 is obtained for the preparation of cultivated seeds.

7. A cultivation method of the temperature-resistant Morchella liumei according to claim 1, characterized in that: The cultivation method is operated as follows: Management during sowing and mycelium growth period After soil pretreatment, when the ground temperature of the planting site is below 18℃ for a week, you can sow the seeds. First, water the soil, dry it and sprinkle quicklime. Plant ridges in the greenhouse. Sow 150-300 bags of cultivation seeds per mu. After sowing the fungus, cover the soil with 2-4cm. The soil moisture should be 18-25%; Add foreign aid nutrition bag One week after sowing, fungus frost begins to form. 8-12 days after sowing, place nutrient bags, 2000-3000 bags per mu. Use a knife to make two holes on the side of the nutrient bag facing the ground to facilitate direct contact between the mycelium and the nutrient bag. Then the mycelium slowly grows into the nutrient bag, absorbs nutrients in the nutrient bag and transfers nutrients to the mycelium in the soil. After the nutrient bags are placed, cover with black mulch. Mushroom Management About 30-50 days after sowing, when the nutrient bag begins to shrink, the primordium is formed, and the temperature is suitable for the next 7-10 days, light stimulation begins. Sunlight enters the greenhouse during the day. After 4-5 days, water heavily for mushroom management. Subsequently, young mushrooms will grow one after another. Keep the temperature / humidity in the greenhouse constant and harvest when the fruiting bodies are mature.

8. The method for cultivating the temperature-resistant Morchella liumei according to claim 7, characterized in that: The cultivar cultivation process is as follows: Cultivated seed formula: 60-75% wheat, 15-25% sawdust, 8-12% corn cobs, 0.5-1.5% quicklime, 0.5-1.5% gypsum, water content of 60% to 65%, packed in polyethylene bags, 600-1200g per bag, sterilized by wet heat at 0.11MPa atmospheric pressure and 121℃ high temperature and high pressure for 2-3h, inoculated under strict aseptic operating conditions after cooling, cultured in the dark at 14-18℃ for 20-25d, and prepared as cultivated seeds after the mycelium has eaten all the materials.

9. The method for cultivating the temperature-resistant Morchella liumei according to claim 7, characterized in that: The nutrition bag formula is as follows: Wheat 50-60%, corn cob 38-45%, quicklime 0.5-1.5%, gypsum 0.5-1.5%, potassium dihydrogen phosphate 0.15-0.35%, the moisture content of the nutrients is 65%-70%, packed in polyethylene bags, 600-1000g per bag, sterilized at 0.11MPa atmospheric pressure, 121℃ high temperature and high pressure wet heat for 2-3h, and set aside after cooling.

10. The method for cultivating the temperature-resistant Morchella liumei according to claim 7, characterized in that: Soil pretreatment before sowing is as follows: the pH of the soil for morel cultivation is preferably 6.5-7.

8. In order to reduce the impact of diseases and pests during the cultivation of morels, deep plowing and film covering are carried out during the idle period of the greenhouse, and the high temperature in the greenhouse is used to kill the pathogens and pests in the soil, effectively preventing the invasion of bacteria and pests on morels; The prevention and control of diseases and pests are as follows: If pathogen infection is found during the cultivation of morels, the infected parts must be removed in time and disinfected; at the same time, the planting shed should be well ventilated to reduce the humidity of the soil and air and inhibit the reproduction and spread of pathogens. If snails and slug pests appear, they must be controlled with appropriate pesticides in time; at the same time, yellow boards must be hung in the shed during the mushroom period to prevent damage by mushroom mosquitoes and mushroom flies.

Images