A method for simultaneous detection of soybean protein and wheat protein allergen genes by droplet digital PCR

Abstract

The present invention relates to the field of gene detection technology, and in particular to a method for synchronously detecting soybean protein and wheat protein allergen genes by droplet digital PCR. The method comprises: extracting DNA of the sample to be tested, performing PCR amplification using a primer and probe combination, and judging whether the sample to be tested contains soybean protein allergens or wheat protein allergens according to the amplification result. The primer and probe combination comprises a primer pair shown in SEQ ID NO.1‑2, 4‑5 and a probe shown in SEQ ID NO.3, 6. The present invention designs specific primers and probes for specific targets of soybean allergen protein gene β‑conglycinin and wheat allergen protein gene α / β‑gliadin. The two sets of primers and probes can be used in an amplification system, and the soybean protein and wheat protein allergen genes in the sample can be detected by one reaction, which is of great significance in the allergen detection system.

Description

Technical Field

[0001] The present invention relates to the technical field of gene detection, and in particular to a method for synchronously detecting soybean protein and wheat protein allergen genes using droplet digital PCR. Background Art

[0002] Food allergy refers to an adverse reaction in the intestines after the human body ingests certain foods. The types of food that cause allergies are mainly: milk, nuts, rapeseed, beans, eggs, seafood, etc. Among them, soybeans and their derivatives are rich in protein and oil, and are widely used in various foods; wheat, as the raw material for the production of flour and gluten, is an important raw material for staple foods in daily life. However, soybeans and wheat are widely considered to be foods that are prone to allergic reactions, and in most cases such allergies cannot be fundamentally resolved. The only way to prevent food allergies is to avoid their intake.

[0003] Allergens are glycoproteins in food that can cause abnormal reactions in the body's immune system, usually water-soluble or salt-soluble proteins. The main allergens of soybeans can be divided into three categories: storage proteins, structural proteins, and defense-related proteins. Many studies have shown that storage proteins are the main components that trigger allergic reactions. β-conglycinin is the most important allergen in soybean storage proteins, and its gene is β-conglycinin; the main allergen of wheat is the alcohol-soluble protein in grain storage proteins, which can be divided into four types: α, β, γ, and ω according to the descending order of their electrophoretic mobility. Among them, sulfur-rich α / β-alcohol-soluble protein is the main allergen in wheat storage proteins, and its gene is α / β-gliadin.

[0004] At present, common allergen detection technologies include: enzyme-linked immunosorbent assay (ELISA), immunoblotting, mass spectrometry, polymerase chain reaction (PCR), etc. These detection technologies have important practical significance for the prevention and control of food allergies and have achieved remarkable application results. However, each of the above methods has its own advantages and disadvantages. For example, ELISA cannot effectively deal with false negatives caused by changes in the primary structure of proteins after heating; mass spectrometers are relatively expensive and require standard samples as characteristic spectra of amino acid peptides during detection. In contrast, polymerase chain reaction (PCR) detection of sample DNA can effectively avoid false negative test results caused by high-temperature heating, and after technical iterations (real-time fluorescence quantitative PCR technology, digital PCR technology, etc.), the test results can be more intuitively determined by fluorescent signals. Summary of the invention

[0005] In order to solve the problems existing in the prior art, the present invention provides a method for synchronously detecting soybean protein and wheat protein allergen genes by droplet digital PCR.

[0006] The present invention develops corresponding primer pairs and probes for specific targets on the soybean allergen protein gene β-conglycinin and the wheat allergen protein gene α / β-gliadin. On the one hand, the primer pairs and probes have high specificity and sensitivity, and can realize accurate detection of soybean and wheat allergen genes. On the other hand, the two sets of primer pairs and probes can use one reaction system without mutual interference and will not affect the amplification results, so as to realize simultaneous detection of soybean and wheat allergen genes.

[0007] In a first aspect, the present invention provides a primer combination, comprising a primer pair one and a primer pair two;

[0008] The primer pair 1 comprises:

[0009] DD-BF: 5'-TCCTGGCTTCAGTTTCTGTCT-3', and

[0010] DD-BR: 5'-CTCTCGCTATTGCAACTCTGG-3';

[0011] The primer pair 2 comprises:

[0012] XM-AB-F: 5'-CAGTTAGAGTTCCAGTGCCAC-3', and

[0013] XM-AB-R: 5' - TGCGGCTGCGGATATGGTAGT -3'.

[0014] In a second aspect, the present invention provides a primer and probe combination, including the primer combination and the probe combination; the probe combination includes:

[0015] DD-BP: 5'-ATTGCTTACTGGGAAAAAGAGAAC-3', and,

[0016] XM-AB-P: 5' - CCAGGGCAGCAACAACAAATTTCCACCACAA -3'.

[0017] Furthermore, the DD-BP and XM-AB-P carry different fluorescent markers; the fluorescent markers include: one or more of FAM, TET, HEX, ROX, Cy3, Cy5, Alexa Fluor, SYBR Green, DAPI, FITC or Texas Red.

[0018] Furthermore, the 5' end of the DD-BP is connected to FAM, and the 3' end is connected to BHQ1; the 5' end of the XM-AB-P is connected to HEX, and the 3' end is connected to BHQ2.

[0019] In a third aspect, the present invention provides a kit, comprising the primer combination, or the primer and probe combination.

[0020] In a fourth aspect, the present invention provides a method for synchronously detecting soybean protein and wheat protein allergen genes, comprising:

[0021] The primer combination, or the primer and probe combination, or the kit is used to detect the sample to be tested, and whether the sample to be tested contains soybean protein allergen gene or wheat protein allergen gene is determined according to the test result.

[0022] Furthermore, the DNA of the sample to be tested is extracted, and PCR amplification is performed using the primer and probe combination, and whether the sample to be tested contains soybean protein allergen gene or wheat protein allergen gene is determined according to the amplification result.

[0023] Furthermore, the PCR amplification is a droplet digital PCR amplification, and each 20 μL amplification system contains: 20~30 ng of DNA template, 8~15nmol of each primer shown in SEQ ID NO.1-2, 8~15nmol of each primer shown in SEQ ID NO.4-5, 2~10nmol of the probe shown in SEQ ID NO.3, 2~10nmol of the probe shown in SEQ ID NO.6, 10~15μL of digital PCR amplification enzyme Mix premix, and the balance is water.

[0024] Furthermore, the reaction procedure of the PCR amplification includes:

[0025] (1) Pre-denaturation: 94~96℃, 10~20min; (2) Denaturation: 94~96℃, 15~20s; Annealing + extension: 59~62℃, 45~60s, cooling rate of 1.8~2.4℃ / s, 35~50 cycles; (3) Cool down to 0~4℃ and maintain.

[0026] Furthermore, the droplet digital PCR amplification further includes: droplet generation before amplification.

[0027] Furthermore, judging whether the sample to be tested contains soybean protein allergen gene or wheat protein allergen gene according to the amplification result includes:

[0028] The amplified product is subjected to fluorescence signal detection, and whether the sample to be tested contains soybean protein allergen gene or wheat protein allergen gene is determined according to the fluorescence signal detection result.

[0029] Furthermore, the copy numbers of the soybean protein allergen gene and the wheat protein allergen gene in the sample to be tested are identified and quantitatively calculated by detecting the readings of the positive droplets.

[0030] The present invention has the following beneficial effects:

[0031] The present invention designs a primer and probe combination for specific regions on the soybean allergen protein gene β-conglycinin and the wheat allergen protein gene α / β-gliadin, which has high specificity and sensitivity, and can simultaneously complete the amplification of the two genes in a reaction system without mutual interference between the two, and does not affect the accuracy of the detection. The primer and probe combination provided by the present invention can be used for simultaneous and efficient detection of soybean and wheat allergens, which has important application value in the field of allergen detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] In order to more clearly illustrate the technical solutions in the present invention or the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0033] Figure 1 It is the detection result of the simultaneous detection of soybean protein and wheat protein allergen genes by droplet digital PCR provided in Example 2 of the present invention; wherein, sample 1 is soybean protein isolate (positive control), sample 2 is wheat protein isolate (positive control), sample 3 is sample a to be tested containing only soybean components, sample 4 is sample b to be tested containing only wheat components, sample 5 is sample c to be tested containing both soybean and wheat components, and sample 6 is a negative control containing neither soybean nor wheat components.

[0034] Figure 2 It is the detection result of the real-time fluorescence quantitative PCR synchronously detecting the allergen genes of soybean protein and wheat protein provided in Example 3 of the present invention; wherein, sample 1 is soybean protein isolate (positive control), sample 2 is wheat protein isolate (positive control), sample 3 is the test sample a containing only soybean components, sample 4 is the test sample b containing only wheat components, sample 5 is the test sample c containing both soybean and wheat components, and sample 6 is the negative control containing neither soybean nor wheat components.

[0035] Figure 3It is the Ct value standard curve and fitting formula for relative quantitative calculation of the real-time fluorescence quantitative PCR method provided in Example 3 of the present invention; wherein, the 4 groups of Ct values ​​used to prepare the soybean positive standard curve in the upper figure are soybean protein isolate (20ng / μL), 10-fold gradient dilution (2ng / μL), 100-fold gradient dilution (0.2ng / μL), and 1000-fold gradient dilution (0.02ng / μL); the 4 groups of Ct values ​​used to prepare the wheat positive standard curve in the lower figure are wheat protein isolate (20ng / μL), 10-fold gradient dilution (2ng / μL), 100-fold gradient dilution (0.2ng / μL), and 1000-fold gradient dilution (0.02ng / μL).

[0036] Figure 4 It is the agarose gel electrophoresis result of the PCR amplification product of multiple primer combinations provided in Comparative Example 1 of the present invention; Lanes 1-8 in the left figure are the results of the primer pair and the probe combination (DD-BF, DD-BR, DD-BP) amplifying soybean, peanut, wheat and blank control with DNA template amounts of 20 ng and 50 ng respectively; Lanes 9-16 are the results of the primer pair and the probe combination (XM-AB-F, XM-AB-R, XM-AB-P) amplifying wheat, peanut, soybean template with DNA template amounts of 20 ng and 50 ng respectively and blank control; Lane 1 in the right figure is the result of the primer pair and the probe combination (DD-BF, DD-B-R2, DD-BP) amplifying soybean with a DNA template amount of 20 ng; Lane 2 is the result of the primer pair and the probe combination (DD-B-F2 Lane 1 shows the results of amplifying 20 ng of DNA template for soybean using primer pairs and probe combinations (DD-BR, DD-BP); Lane 2 shows the results of amplifying 20 ng of DNA template for soybean using primer pairs and probe combinations (DD-B-F3, DD-B-R3, DD-B-P3); Lane 3 shows the results of amplifying 20 ng of DNA template for soybean using primer pairs and probe combinations (DD-B-F3, DD-B-R3, DD-B-P3); Lane 5 shows the results of amplifying 20 ng of DNA template for wheat using primer pairs and probe combinations (XM-AB-F, XM-AB-R2, XM-AB-P); Lane 6 shows the results of amplifying 20 ng of DNA template for wheat using primer pairs and probe combinations (XM-AB-F2, XM-AB-R, XM-AB-P); Lane 7 shows the results of amplifying 20 ng of DNA template for wheat using primer pairs and probe combinations (XM-AB-F3, XM-AB-R3, XM-AB-P3).

[0037] Figure 5It is the agarose gel electrophoresis result of the amplification products of the multiple groups of PCR reaction systems and PCR reaction procedures provided in Comparative Example 2 of the present invention; the first row of lanes 1-8 are the amplification product results of soybean primers (3nmol) and probes (1nmol) at gradient annealing + extension temperature (62°C~55°C); lanes 9-16 are the amplification product results of soybean primers (6nmol) and probes (2nmol) at gradient annealing + extension temperature (62°C~55°C); lanes 17-24 are the amplification product results of soybean primers (9nmol) and probes (3nmol) at gradient annealing + The results of amplification products at the extension temperature (62℃~55℃); the second row lanes 1-8 are the results of amplification products of wheat primers (3nmol) and probes (1nmol) at gradient annealing + extension temperature (62℃~55℃); lanes 9-16 are the results of amplification products of wheat primers (6nmol) and probes (2nmol) at gradient annealing + extension temperature (62℃~55℃); lanes 17-24 are the results of amplification products of wheat primers (9nmol) and probes (3nmol) at gradient annealing + extension temperature (62℃~55℃). DETAILED DESCRIPTION

[0038] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be clearly and completely described below in conjunction with the drawings of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0039] The experimental methods involved in the following examples, unless otherwise mentioned, are all conventional methods in the art, for example, reference may be made to experimental manuals in the art, or the conditions recommended in the manufacturer's instructions.

[0040] Unless otherwise specified, the experimental materials and reagents involved in the following examples can be obtained from commercial sources.

[0041] The main instruments and equipment in the following examples include: droplet digital PCR system (Biorad QX200 droplet generator, C1000 PCR instrument, QX200 droplet reader analyzer), high-speed desktop centrifuge (Eppendorf 5417R), micropipettes (2.5 μL, 10 μL, 100 μL, 1000 μL), fluorescent microplate reader (Bio teksynergy H4), etc.

[0042] Main reagents: High-efficiency plant genomic DNA extraction kit (DP350, Tiangen), digital PCR amplification enzyme Mix premix ddPCR TMsupermix for Probes (no dUTP) (Bio-Rad, USA), digital PCR droplet generation oil Droplet Generation Oil for probes (Bio-Rad, USA), etc.

[0043] Example 1

[0044] The present invention provides a method for synchronously detecting soybean protein and wheat protein allergen genes by droplet digital PCR, which specifically includes the following process:

[0045] 1. Sample preparation

[0046] Weigh appropriate amounts (according to the requirements of the DNA extraction method) of soy protein isolate and wheat protein isolate as positive controls; weigh appropriate amounts (according to the requirements of the DNA extraction method) of foods containing soy ingredients or wheat ingredients, or both of these two plant-derived ingredients, as samples to be tested; weigh appropriate amounts (according to the requirements of the DNA extraction method) of foods that do not contain these two plant-derived ingredients, soy ingredients and wheat ingredients, as negative controls.

[0047] The final sample a to be tested contains only soybean ingredients; the sample b to be tested contains only wheat ingredients; the sample c to be tested contains both soybean ingredients and wheat ingredients.

[0048] 2. DNA extraction method

[0049] The above sample DNA was extracted using a high-efficiency plant genomic DNA extraction kit, and the operation was performed according to the kit instructions, or other recognized extraction methods with the same effectiveness. The extracted DNA was measured by a fluorescence microplate reader at 260nm and 280nm absorbance to calculate the DNA concentration and purity.

[0050] 3. Primer and probe sequences

[0051] According to the nucleotide sequences of two pairs of specific primers SEQ ID NO.1-2 and SEQ ID NO.4-5 of the present invention, primers (DD-BF, DD-BR; XM-AB-F, XM-AB-R) are synthesized; according to the nucleotide sequences of two probes SEQ ID NO.3 and SEQID NO.6 of the present invention, probes (DD-B-Fam-P, XM-AB-Hex-P) are synthesized, wherein the fluorescent group at the 5' end of the probe DD-B-Fam-P is FAM, and the quenching group at the 3' end is BHQ1; the fluorescent group at the 5' end of the probe XM-AB-Hex-P is HEX, and the quenching group at the 3' end is BHQ2.

[0052] 4. Droplet digital PCR reaction

[0053] (1) The optimized PCR reaction system is shown in Table 1 below:

[0054] Table 1 Droplet digital PCR reaction system (total volume 20 μL)

[0055]

[0056] (2) Droplet generation and PCR reaction conditions

[0057] Add the PCR reaction system mixture (the above reaction system) to the digital PCR droplet generation chip, add the digital PCR droplet generation oil Droplet Generation Oil for probes and place it in the droplet generator to generate droplets, then transfer it to a 96-well plate and heat seal it, and then perform the PCR amplification reaction. The optimized PCR amplification program parameters are set as follows: (1) pre-denaturation: 95℃, 10min; (2) denaturation: 95℃, 15~20s; annealing + extension: 59℃, 45~60s, cooling rate of 2℃ / s, 40 cycles; (3) cool to 4℃, hold.

[0058] 5. Test results

[0059] The 96-well plate with completed PCR amplification reaction was placed in the digital PCR droplet fluorescence signal detection system (droplet reader analyzer). The detection results were as follows: Figure 1 As shown: in the positive control, the soy protein isolate sample only has positive target fragment droplets (blue scattered dots) in the FAM channel, and no positive target fragment droplets in the HEX channel (all gray scattered dots); similarly, the wheat protein isolate sample only has positive target fragment droplets (green scattered dots) in the HEX channel, and no positive target fragment droplets in the FAM channel (all gray scattered dots); the negative control sample has no positive target fragment droplets in both the FAM channel and the HEX channel (all gray scattered dots); among the samples to be tested, the sample a to be tested containing only soybean ingredients has positive target fragment droplets (blue scattered dots) only in the FAM channel, and no positive target fragment droplets in the HEX channel (all gray scattered dots); similarly, the sample b to be tested containing only wheat ingredients has positive target fragment droplets (green scattered dots) only in the HEX channel, and no positive target fragment droplets in the FAM channel (all gray scattered dots); the sample c to be tested containing both soybean and wheat ingredients has positive target fragment droplets in both the FAM channel (blue scattered dots) and the HEX channel (green scattered dots).

[0060] Example 2

[0061] The present invention quantitatively calculates the content of soybean protein and wheat protein allergen genes based on the method provided in Example 1 above, including the following process:

[0062] The Read readings of the positive control (soy protein isolate, wheat protein isolate) were used as standard values, and the percentages of the soybean allergen gene β-conglycinin and the wheat allergen gene α / β-gliadin in the samples to be tested containing soybean components or wheat components, or both of these two plant-derived components, were directly calculated according to the Read readings in the digital PCR droplet fluorescence signal detection results of Example 1 (Table 2).

[0063] Table 2 Quantitative calculation of droplet digital PCR

[0064]

[0065] Example 3

[0066] The present invention provides a real-time fluorescence quantitative PCR probe method for determining soybean protein and wheat protein allergen genes as a comparison between droplet generation and PCR methods, using the same sample template, primer probe, and PCR amplification program for detection and quantitative calculation of soybean protein and wheat protein allergen genes.

[0067] 1. Template preparation method

[0068] The sample preparation and DNA extraction method in Example 1 were referred to: soy protein isolate and wheat protein isolate were used as positive controls; foods containing soy ingredients or wheat ingredients, or both of these two plant-derived ingredients, were used as samples to be tested; foods that did not contain these two plant-derived ingredients, soy ingredients and wheat ingredients, were used as negative controls.

[0069] Soy protein isolate and wheat protein isolate positive controls were diluted to 20 ng / μL as initial templates, and then the initial templates were diluted 10 times to 10 -3 spare.

[0070] 2. Real-time fluorescence quantitative PCR reaction

[0071] The fluorescence quantitative PCR instrument used in this comparative example is the Roche LightCycler® 480 II from Roche, USA, and the reagents and consumables of this brand. This method does not limit the brand of the instrument and reagent consumables, nor does it limit the scope of the present invention.

[0072] Referring to the PCR reaction system (replacing the brand-matched amplification enzyme Mix) and reaction conditions in Example 1, the primers and probes in Example 1 were used to perform real-time fluorescence quantitative PCR reaction.

[0073] 3. Test results

[0074] The Ct value curves of the samples in different fluorescence channels are used to determine whether the samples contain soybean and wheat allergen genes. The test results are as follows: Figure 2 As shown: in the FAM fluorescence channel (Abs / Em=492 / 518nm), the positive control of soy protein isolate, the sample a containing only soy ingredients, and the sample c containing both soy and wheat ingredients all produced fluorescence signals; in the HEX fluorescence channel (Abs / Em=535 / 556nm), the positive control of wheat protein isolate, the sample b containing only wheat ingredients, and the sample c containing both soy and wheat ingredients all produced fluorescence signals; the negative control sample had no fluorescence signals in both the FAM fluorescence channel and the HEX fluorescence channel.

[0075] 4. Positive control standard curve

[0076] Referring to the above real-time fluorescence quantitative PCR reaction steps, digital PCR detection was performed on the positive control initial template of the above soy protein isolate and wheat protein isolate and the template after gradient dilution. According to the Ct value reading in the above template fluorescence quantitative PCR detection result, a standard curve was prepared to obtain the fitting formula ( Figure 3 ).

[0077] 5. Quantitative calculation of soy protein and wheat protein allergen gene content

[0078] Substitute the Ct value reading of the sample to be tested in the test results into the fitting formula of the above standard curve to calculate the percentage of soybean allergen gene β-conglycinin and wheat allergen gene α / β-gliadin in the sample to be tested containing soybean components or wheat components, or both of these two plant-derived components (Table 3).

[0079] Table 3 Quantitative calculation of fluorescent quantitative PCR probe method

[0080]

[0081] The quantitative calculation results of this Example 3 are roughly similar to those of Example 2. Compared with droplet digital PCR, the fluorescent quantitative PCR probe method has higher requirements for the specificity of primers and probes. This result shows that the primer pair and probe combination for detecting soybean protein and wheat protein allergen genes provided by the present application has high specificity and accuracy.

[0082] Comparative Example 1

[0083] The present invention uses multiple sets of primer combinations in the research process to screen the primer pairs with the best specificity and amplification efficiency. The specific combinations are as follows:

[0084] 1. As shown in Example 1, soybean β-conglycinin gene: primer pair shown in SEQ ID NO.1-2, probe shown in SEQ ID NO.3; wheat α / β-gliadin gene: primer pair shown in SEQ ID NO.4-5, probe shown in SEQ ID NO.6.

[0085] 2. Soybean β-conglycinin gene: primer pair shown in SEQ ID NO.1 and 7, probe shown in SEQ ID NO.3; wheat α / β-gliadin gene: primer pair shown in SEQ ID NO.4 and 8, probe shown in SEQ ID NO.6.

[0086] DD-B-R2 (SEQ ID NO.7): 5'- CGCTATTGCAACTCTGGAGAC -3',

[0087] XM-AB-R2 (SEQ ID NO. 8): 5'-ATGGTTGCGGCTGCGGATAT-3'.

[0088] 3. Soybean β-conglycinin gene: primer pair shown in SEQ ID NO.2 and 9, probe shown in SEQ ID NO.3; wheat α / β-gliadin gene: primer pair shown in SEQ ID NO.4 and 10, probe shown in SEQ ID NO.6.

[0089] DD-B-F2 (SEQ ID NO.9): 5'-GCTGGGACTTGTTTTCCTG -3',

[0090] XM-AB-F2 (SEQ ID NO. 10): 5'-CATTGGTACAACAACAACAAT-3'.

[0091] 4. Soybean β-conglycinin gene: primer pair shown in SEQ ID NO.11 and 12, probe shown in SEQ ID NO.13; wheat α / β-gliadin gene: primer pair shown in SEQ ID NO.14 and 15, probe shown in SEQ ID NO.16.

[0092] DD-B-F3 (SEQ ID NO.11): 5'-GAGGGAACCTCAGCAACCC-3',

[0093] DD-B-R3 (SEQ ID NO.12): 5'- TCTTCTTCTTGACGAGGTTGTG -3',

[0094] DD-B-P3 (SEQ ID NO.13): 5'- AGGAAGACGAAGATGAGCAACC -3',

[0095] XM-AB-F3 (SEQ ID NO.14): 5'-CTGATTCCATGCAGGGATGTT-3',

[0096] XM-AB-R3 (SEQ ID NO.15): 5'-GCGCATGCAAGCTCACAAGTTTTGC-3',

[0097] XM-AB-P3 (SEQ ID NO. 16): 5'-TGTTGCAATAGCTGGTAAGT-3'.

[0098] The same PCR method as in Example 1 / Example 3 was used for detection, and the results were as follows: Figure 4 As shown, the results show that the amplification products of the primer combinations used in combination 2-4 have more obvious dragging and more miscellaneous bands, indicating that the specificity and amplification efficiency of the primer pairs used are poor when amplified in the same system. Therefore, after screening, DD-BF, DD-BR, and DD-BP were found to be the best primer pair and probe combination for soybean β-conglycinin gene amplification; XM-AB-F, XM-AB-R, and XM-AB-P were the best primer pair and probe combination for wheat α / β-gliadin gene amplification.

[0099] Comparative Example 2

[0100] The present invention adopts the optimization of primer concentration and PCR program annealing temperature in the research process to determine the content of each component of the PCR reaction system and the setting of the PCR reaction program. The specific method is the same as that of Example 1, except that:

[0101] The PCR reaction system refers to Table 4, and the primer addition amount is set to 3nmol / 6nmol / 9nmol, and the corresponding probe addition amount is set to 1nmol / 2nmol / 3nmol.

[0102] Table 4 Droplet digital PCR reaction system (total volume 20 μL)

[0103]

[0104] The PCR amplification program parameters were set as follows: (1) pre-denaturation: 95°C, 10 min; (2) denaturation: 95°C, 15-20 s; annealing + extension: gradient 62°C-55°C (adjacent gradients differed by 1°C), 45-60 s, cooling rate of 2°C / s, 40 cycles; (3) cooling to 4°C, hold.

[0105] The results are as follows Figure 5 As shown in the agarose gel electrophoresis diagram, when the template amount is the same, when the primer addition amount is 9 nmol and the corresponding probe addition amount is 3 nmol, the amplification product band is the brightest and there is no dragging or obvious non-specific amplification (primer dimer, etc.); when the gradient annealing + extension temperature is between 62°C and 59°C, the amplification product bands of soybean and wheat are the brightest and there is no dragging or non-specific amplification.

[0106] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A primer and probe combination, characterized in that: Including primer combinations, and probe combinations; The primer combination includes primer pair one and primer pair two; The primer pair one is: DD-BF: 5'-TCCTGGCTTCAGTTTCTGTCT-3', and DD-BR: 5'-CTCTCGCTATTGCAACTCTGG-3'; The primer pair 2 is: XM-AB-F: 5'-CAGTTAGAGTTCCAGTGCCAC-3', and XM-AB-R: 5'- TGCGGCTGCGGATATGGTAGT -3'; The probe combination is: DD-BP: 5'-ATTGCTTACTGGGAAAAAGAGAAC-3', and, XM-AB-P: 5' - CCAGGGCAGCAACAACAAATTTCCACCACAA -3'.

2. The primer and probe combination according to claim 1, characterized in that: The DD-BP and XM-AB-P carry different fluorescent labels; the fluorescent labels include: one or more of FAM, TET, HEX, ROX, Cy3, Cy5, Alexa Fluor, SYBR Green, DAPI, FITC or Texas Red.

3. A kit, characterized in that: The kit comprises the primer and probe combination of claim 1.

4. A method for synchronously detecting soybean protein and wheat protein allergen genes, characterized in that: include: The primer and probe combination of claim 1 or the kit of claim 3 is used to detect the sample to be tested, and whether the sample to be tested contains soybean protein allergen gene or wheat protein allergen gene is determined according to the test result.

5. The method according to claim 4, characterized in that include: Extract the DNA of the sample to be tested, perform PCR amplification using the primer and probe combination of claim 1, and determine whether the sample to be tested contains soybean protein allergen gene or wheat protein allergen gene based on the amplification result.

6. The method according to claim 5, characterized in that The PCR amplification is a droplet digital PCR amplification, and each 20 μL amplification system contains: 20-30 ng of DNA template, 8-15 nmol of each primer shown in SEQ ID NO.1-2, 8-15 nmol of each primer shown in SEQ ID NO.4-5, 2-10 nmol of the probe shown in SEQ ID NO.3, 2-10 nmol of the probe shown in SEQ ID NO.6, 10-15 μL of digital PCR amplification enzyme Mix premix, and the balance is water.

7. The method according to claim 6, characterized in that The reaction procedure of the PCR amplification includes: (1) Pre-denaturation: 94~96℃, 10~20min; (2) Denaturation: 94~96℃, 15~20s; Annealing + extension: 59~62℃, 45~60s, cooling rate of 1.8~2.4℃ / s, 35~50 cycles; (3) Cool down to 0~4℃ and maintain.

8. The method according to claim 5, characterized in that The method of judging whether the sample to be tested contains soybean protein allergen gene or wheat protein allergen gene according to the amplification result comprises: The amplified product is subjected to fluorescence signal detection, and whether the sample to be tested contains soybean protein allergen gene or wheat protein allergen gene is determined according to the fluorescence signal detection result.

9. The method according to claim 8, characterized in that The copy numbers of the soybean protein allergen gene and the wheat protein allergen gene in the sample to be tested are determined and quantitatively calculated by detecting the readings of the positive droplets.

Images