A method for rapid detection of O-type foot-and-mouth disease virus

Abstract

The purpose of the present invention is to provide a method for detecting O-type foot-and-mouth disease virus, that is, on the basis of screening a group of RT-RAA primer probes for highly efficient and specific detection of O-type foot-and-mouth disease virus, RT-RAA technology and CRISPR / Cas13a technology are combined to achieve high sensitivity, high specificity and low complexity visual detection of FMDV-O clinical samples. The present invention also provides a detection method with simple operation, sensitive detection, visual results and low auxiliary equipment requirements, so as to improve the detection of O-type foot-and-mouth disease virus in the pig breeding industry, solve the key technical problem that it is difficult to diagnose FMDV at the disease and quarantine site due to the similar clinical symptoms of vesicular epidemics, and need to be sent to the laboratory for differential diagnosis, reduce biosafety risks, provide technical means, and provide a basis for early diagnosis and timely prevention and control of epidemics in grassroots veterinary departments, which is of great significance for preventing and controlling the occurrence and spread of the epidemic.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biological gene diagnosis, and in particular relates to a method for rapidly detecting O-type foot-and-mouth disease virus. Background Art

[0002] Foot-and-mouth disease is an acute, febrile, contact and highly contagious vesicular disease caused by foot-and-mouth disease virus (FMDV) that can infect more than 70 domestic or wild even-toed ungulates such as pigs, cattle and sheep. It is considered one of the most important diseases that endanger even-toed ungulates. Foot-and-mouth disease virus FMDV is a non-enveloped, positive-sense single-stranded RNA virus belonging to the genus Foot-and-mouth disease virus of the family Picornaviridae.

[0003] There are seven different serotypes of FMDV, including O, A, C, Asian 1 and South African Territories (SAT) serotypes SAT1, SAT2 and SAT3, as well as multiple subtypes, each of which includes multiple subtypes, totaling more than 80. FMDV is extremely unstable and prone to mutation, and there is no cross-protection between different serotypes, and even only partial protection between different subtypes of the same serotype.

[0004] FMDV is prevalent around the world, seriously endangering the pig farming industry in various countries. Since the blister symptoms caused by the disease are similar to those caused by pathogens such as SVA and SVDV, it is easy to misdiagnose the disease after the onset of the disease, causing farmers to be nervous and then panic to sell pigs. Therefore, how to quickly identify and diagnose the FMDV pathogen at the scene of the disease is a pain point that the pig farming industry urgently needs to solve.

[0005] With the development of diagnostic technology, a variety of detection technologies have been applied to swine diseases, but the detection of FMDV is still mainly based on fluorescent quantitative PCR, enzyme-linked immunosorbent assay, indirect immunofluorescence and immunohistochemistry. These methods require good laboratory conditions, expensive professional instruments and experienced technicians, which are time-consuming and labor-intensive and difficult to apply to field testing.

[0006] CRISPR / Cas (Clustered Regulatory Interspaced Short palindromic repeats / CRISPR-associate) is an acquired immune system of prokaryotes, used to resist the invasion of exogenous genetic elements present in bacteriophages or plasmids. It is a defense mechanism present in most bacteria and all archaea, and has powerful gene editing functions. Proteins such as Cas12a and Cas13a in the CRISPR system have been widely used in the field of virus detection. Compared with the Cas12a enzyme, the Cas13a enzyme does not need to rely on the PAM (protospaceradjacent motif) motif when recognizing the target sequence. Cas13a binds to the paired crRNA and target RNA to form a complex and undergo conformational changes, activating RNA enzyme cleavage activity, and can non-specifically cleave single-stranded RNA probes to generate fluorescent signals. The detection results can be determined by collecting the fluorescent signal through a fluorescent quantitative instrument, or by only using a blue light transmission instrument to observe the product after the reaction. Studies have shown that the side branch cleavage activity of Cas protein is significantly reduced when the target concentration is too low. Therefore, increasing the amount of target nucleic acid is an important prerequisite for improving the application of this method. RT-RAA detection technology amplifies the target RNA sequence and has the characteristics of room temperature reaction, rapid detection, simple operation, and high sensitivity, but it is also prone to false positives. When RT-RAA detection technology is used in conjunction with CRISPR detection technology, the RT-RAA method can be used to improve sensitivity and the CRISPR detection technology can be used to increase the specificity of the detection technology, so that the sensitivity and specificity of the detection method can reach a high level. However, in actual operation, false positives or false negatives often occur in RT-RAA-CRISPR / Cas13a-based detection. Summary of the invention

[0007] The object of the present invention is to provide a method for detecting O-type foot-and-mouth disease virus, that is, a method for detecting FMDV-O based on RT-RAA-CRISPR / Cas13a, which is established on the basis of screening a group of RT-RAA primer probes for highly efficient and specific detection of O-type foot-and-mouth disease virus.

[0008] The present invention first provides an RT-RAA primer pair for detecting type O foot-and-mouth disease virus, wherein the sequence of the nucleic acid fragment detected by the primer pair is as follows:

[0009] GAAATTAATACGACTCACTATAGGGTTAAATCTCTTGGTCAAACATTACTCCAGCTGACAAAAGCGACAGAGGTTTTGTTCTTGGTCACTCCTTTACTGACTTCACTTTCCTCAAATGACACTTCCACATGGATTATGGAACTGGGTTTTACAAAC (SEQ ID NO: 1).

[0010] As a specific record of the embodiment, the sequence information of the upstream and downstream primer pairs of the RT-RAA primer pair is as follows:

[0011] Upstream primer FMDV-F6: 5′-GAAATtaatacgactcactatagggTTAAATCTCTTGGTCAAACCATTACTCCAG-3′ (SEQ ID NO: 2),

[0012] Downstream primer FMDV-R6:

[0013] 5′-GTTTGTAAAACCCAGTTCCATAATCCATGT-3′ (SEQ ID NO: 3).

[0014] The RT-RAA primer pair screened and obtained by the present invention is used to prepare an RT-RAA-CRISPR / Cas13a detection preparation for detecting type O foot-and-mouth disease virus;

[0015] Furthermore, the detection preparation also includes RNA fluorescent probe, Cas13a protein and crRNA;

[0016] The RNA fluorescent probe has a sequence of 5′-UUUUUUUUUUU-3′, and both ends of the probe are respectively labeled with a fluorescent group FAM and a quenching group BHQ1.

[0017] The sequence of the crRNA is as follows:

[0018] AAGTGAAGTCAGTAAAGGAGTGACCAAGGTTTTAGTCCCTCGTTTTTGGGGTAGTCTAAATCCCCTATAGTGAGTCGTATTAATTTC (SEQ ID NO: 4).

[0019] The present invention also provides a method for detecting O-type foot-and-mouth disease virus by RT-RAA-CRISPR / Cas13a, comprising using the cRNA of the sample to be tested as a template, using the above-mentioned RT-RAA primer pair to perform an RT-RAA reaction to obtain an amplification product; using the above-mentioned fluorescent probe and the above-mentioned crRNA to perform a CRISPR / Cas13a reaction on the amplification product to obtain a reaction product; and determining whether the sample to be tested contains O-type foot-and-mouth disease virus according to the fluorescence and fluorescence value of the reaction product.

[0020] The fluorescence of the reaction product determines whether the sample to be tested contains type O foot-and-mouth disease virus. The reaction product is observed under a blue light lamp / ultraviolet lamp (wavelength of 440-460nm / 400nm). If the reaction product produces green fluorescence, the sample to be tested contains type O foot-and-mouth disease virus. If the reaction product does not produce color fluorescence, the sample to be tested does not contain type O foot-and-mouth disease virus.

[0021] The present invention combines RT-RAA technology with CRISPR / Cas13a technology to achieve high-sensitivity, high-specificity, and low-complexity visual detection of FMDV-O clinical samples. The present invention also provides a detection method with simple operation, sensitive detection, visual results, and low auxiliary equipment requirements, thereby improving the detection of O-type foot-and-mouth disease virus in the pig farming industry, solving the key technical problem that it is difficult to diagnose FMDV at the disease and quarantine site due to the similar clinical symptoms of vesicular diseases, and needs to be sent to the laboratory for differential diagnosis, and reduces biosafety risks. Provides a technical means, provides a basis for grassroots veterinary departments to conduct early diagnosis and timely prevention and control of diseases, and is of great significance for preventing and controlling the occurrence and spread of the disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is a diagram showing the results of RT-RAA primer screening in Example 1.

[0023] Figure 2 , Figure 3 This is the crRNA screening result diagram in Example 1, Figure 2 Middle 1: crRNA1+; 2: crRNA2+; 3: crRNA3+; 4: crRNA4+; 5: crRNA5+; 6: crRNA6+; 7: NC;

[0024] Figure 4 , Figure 5 This is a diagram showing the specificity verification results of the method for detecting type O foot-and-mouth disease virus provided in Example 2. Figure 4 Medium 1: FMDV+; 2: CSFV+; 3: PEDV+; 4: PCV2+; 5: PRV+; 6: PRRSV+; 7: ASFV+; 8: NC.

[0025] Figure 6 , Figure 7 This is a graph showing the sensitivity verification results of the method for detecting type O foot-and-mouth disease virus provided in Example 2. Figure 6 1:10 0 ; 2:10 -1 ; 3:10 -2 ; 4:10 -3 ; 5:10 -4 ; 6:10 -5 ; 7:10 -6 . DETAILED DESCRIPTION

[0026] The applicant found in actual operation that when the RT-RAA amplification efficiency is not strong, it will cause low template amplification and produce false negatives; when the crRNA sequence specificity is poor, it will cause non-specific binding of crRNA to non-target templates, and then non-specifically initiate Cas enzyme cleavage activity, resulting in false positive signals. To avoid these shortcomings, the present invention will first analyze the pathogen sequence and design 6 pairs of RT-RAA amplification primers, and screen out the primer pairs with the strongest amplification efficiency and the strongest specificity as RT-RAA reaction primers to ensure the amplification efficiency and specificity of the RT-RAA reaction. At the same time, 6 crRNAs are designed for the amplified sequence, and their specificity of binding to the target is detected one by one to avoid false positives and ensure the reliability of the test results.

[0027] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0028] Example 1: Establishment of FMDV-O detection method

[0029] 1. Design and screening of RT-RAA primers

[0030] According to the FMDV-O gene sequence (GenBank: MN389541.1), the gene sequence was analyzed, and 12 conserved region gene primers were designed according to the RT-RAA design principle. The T7 promoter sequence (lowercase English) was added to the front end of the upstream primer to facilitate in vitro transcription (as shown in Table 1).

[0031] Table 1: FMDV-O RT-RAA primer sequence list

[0032]

[0033] 2. Screening of the best primer pairs

[0034] Using FMDV-O nucleic acid (preserved by the Animal Disease Monitoring Office of the China Animal Health and Epidemiology Center) as a template, the 6 pairs of primers shown in Table 1 were used to perform RT-RAA reactions. The kit was purchased from Jiangsu Qitian Gene Biotechnology Co., Ltd. (the system is shown in Table 2). The reaction temperature was 37°C and the reaction time was 40 min. After the reaction, 5 μL of the reaction product was subjected to 2% agarose gel electrophoresis, and the results were observed on a gel imaging system ( Figure 1 ).

[0035] Table 2: RT-RAA reaction system

[0036]

[0037]

[0038] The results showed that the target band of the primer pair (FMDV-F6 / R6) was single, bright and clear, and was the best primer pair for detecting FMDV-O. The sequence of the amplified fragment was as follows:

[0039] GAAATTAATACGACTCACTATAGGGTTAAATCTCTTGGTCAAACCATTACTCCA GCTGACAAAAGCGACAGAGGTTTTGTTCTTGGTCACTCCTTTACTGACTTCACTTT CCTCAAATGACACTTCCACATGGATTATGGAACTGGGTTTTACAAAC.

[0040] 3. Design, transcription and purification of FMDV-O crRNA

[0041] 1. Six crRNAs were designed based on the target fragment sequence amplified by RT-RAA and the characteristics of LwaCas13a recognizing crRNA (the sequences are shown in Table 3).

[0042] 2. The oligonucleotide T7-crRNA-F synthesizing the crRNA transcription template was combined with crRNA-R (1-6) respectively, and the dry powdered synthetic oligonucleotide chain combination was dissolved in 1x annealing buffer to a concentration of 10 μmol / L. The mixture was mixed in equal volumes, denatured at 95°C for 2 min, and slowly cooled to 25°C for no less than 45 min to anneal to form double-stranded DNA (annealing system is shown in Table 4).

[0043] 3. Using the above double-stranded DNA as a template, in vitro transcription (T7 RNA Polymerase, Vazyme) was performed and crRNA1-6 was purified (the transcription system is shown in Table 5), the crRNA concentration was determined, and the crRNA was aliquoted and frozen at -80°C for later use.

[0044] Table 3: crRNA, fluorescent probe sequence information

[0045]

[0046]

[0047] Table 4: Composition of annealing system

[0048]

[0049] Table 5: crRNA in vitro transcription system

[0050]

[0051] 4. Screening of FMDV-O crRNA

[0052] Using FMDV-O nucleic acid as a template, primer pair FMDV-F6 / R6 was used to perform RT-RAA reaction to obtain the amplified product, and ddH2O was set as a negative control for the template (the reaction system is shown in Table 2). The amplified products were added to the CRISPR Cas13a reaction system respectively (as shown in Table 6). Cas13a protein was purchased from GenScript Biotech Co., Ltd., and the 5′ and 3′ ends of the fluorescent RNA probe were modified with a fluorescent group (FAM) and a quenching group (BHQ1), respectively, and synthesized by Sangon Biotech (Shanghai) Co., Ltd. (sequence is shown in Table 3). After the reaction is completed, the fluorescence intensity is observed and the fluorescence value is detected, and one optimal crRNA is screened out. The reaction was carried out in a constant temperature metal bath at 37°C for 20 minutes, and the fluorescence results were observed using blue light irradiation. The fluorescence intensity value was detected and read using a multifunctional microplate reader. The results are shown in Table 3. Figure 3 , Figure 4 .

[0053] The experimental results showed that crRNA6 had the highest fluorescence intensity value, so crRNA6 was selected for subsequent experiments ( Figure 2 , Figure 3 ).

[0054] Table 6: CRISPR Cas13a reaction system

[0055]

[0056] Example 2. Specificity of the RT-RAA-CRISPR / Cas13a method for detecting FMDV-O 1. Common swine disease virus nucleic acids such as classical swine fever virus (CSFV), porcine epidemic diarrhea virus (PEDV), porcine circovirus type 2 (PCV2), pseudorabies virus (PRV), porcine reproductive and respiratory syndrome virus (PRRSV), African swine fever virus (ASFV) and FMDV-O nucleic acid were reverse transcribed into cDNA as templates, and ddH2O was used as a negative control.

[0057] 2. The method for screening FMDV-0 crRNA in Example 1 was used for detection. The results are as follows: Figure 4 , Figure 5 As shown, the results showed that only the reaction product of the FMDV-O positive control showed obvious green fluorescence, while the samples of other control viruses and the negative control did not produce green fluorescence, thereby proving that the detection method designed by the present invention has a high specificity.

[0058] Example 3: Sensitivity of the FMDV-O Detection Method

[0059] 1. Connect the target fragment sequence (primer pair FMDV-F6 / R6 amplification sequence) with the cloning vector (bioengineering), and transform it into DH5α competent cells. According to the conventional transformation operation steps, after full combination, place it in a shaker at 37°C, 200rpm for 1 hour, and evenly spread it on the LB solid culture medium plate containing ampicillin antibiotics, and culture it overnight. Pick a single colony grown on the plate and culture it for 5-6 hours, then expand the bacterial solution to 150mL, and use a plasmid DNA extraction kit to extract the plasmid.

[0060] 2. Use the selected optimal primers to perform PCR amplification on the standard plasmid, and configure the reaction system according to the 2×Phanta Max MasterMix manual (see Table 7). The reaction procedure is: pre-denaturation at 95°C for 3 minutes, denaturation at 95°C for 15 seconds, annealing and extension at 56°C for 15 seconds, 72°C for 3 minutes, 35 cycles, and complete extension at 72°C for 5 minutes. The amplified product is used for in vitro transcription, and the transcription product is purified to prepare the FMDV-O cRNA standard.

[0061] 3. Dilute the FMDV-O cRNA standard 10-fold and take 1×10 -1 —1×10 -9A total of 9 serial dilutions of FMDV-O cRNA standard were used. The diluted FMDV-O cRNA standard was calibrated with a digital PCR instrument. The reaction program was set as follows: reverse transcription at 50°C for 20 min, pre-denaturation at 95°C for 5 min, amplification at 95°C for 15 s, 60°C for 30 s, 45 cycles, and the reaction system was: 2×MP Buffer 10 μL, Enzyme mix 1 μL ( V C58P2 Multiplex One StepRT-qPCR Probe Kit, YEASEN), 0.5 μL each of upstream and downstream primers and fluorescent probe (10 μM) (primer and probe sequences are shown in Table 8), 5 μL of diluted FMDV-O cRNA standard, and ddH2O was added to 20 μL.

[0062] 4. Use the calibrated 10 0 —10 -6 The dilution of FMDV-O cRNA standard was used as template, and the copy number was 3618.26copy / μL (10 -1 )、672.9.3copy / μL(10 -2 )、117.10copy / μL(10 -3 )、15.44copy / μL(10 -4 )、3.71copy / μL(10 -5 )、0.95copy / μL(10 -6 ), perform RT-RAA-CRISPR / Cas13a reaction, observe and detect the fluorescence intensity value, and determine the sensitivity.

[0063] Table 7: Plasmid PCR amplification system table

[0064]

[0065] Table 8: FMDV-O plasmid amplification primers and fluorescent probe sequence information

[0066]

[0067] The results are as follows Figure 6 , Figure 7 As shown, the dilution of FMDV cRNA standard was 10 -4 When the fluorescence intensity value was observed and detected, it showed that the detection limit of this method for FMDV was 15.44 copy / μL.

[0068] In summary, the present invention combines RT-RAA technology with CRISPR / Cas13a technology to achieve high-sensitivity, high-specificity, and low-complexity visual detection of FMDV-O clinical samples.

Claims

1. An RT-RAA-CRISPR / Cas13a detection kit for detecting type O foot-and-mouth disease virus, characterized in that: The kit comprises an RT-RAA primer pair for detecting type O foot-and-mouth disease virus, wherein the sequence of the upstream primer of the primer pair is SEQ ID NO: 2, and the sequence of the downstream primer is SEQ ID NO: 35; the kit also comprises an RNA fluorescent probe, a Cas13a protein and crRNA; the sequence of the RNA fluorescent probe is 5′-UUUUUUUUUUU-3′, and the two ends of the probe are respectively labeled with a fluorescent group FAM and a quenching group BHQ1; the sequence of the crRNA is SEQ ID NO:

4.

2. Use of the detection kit according to claim 1 in detecting O-type foot-and-mouth disease virus for purposes other than disease diagnosis and treatment.

3. A method for detecting type O foot-and-mouth disease virus for purposes other than disease diagnosis and treatment, characterized in that: The method is to use the detection kit described in claim 1 for detection, including using the cRNA of the sample to be tested as a template, using an RT-RAA primer pair to perform an RT-RAA reaction to obtain an amplification product; using a fluorescent probe and crRNA to perform a CRISPR / Cas13a reaction on the amplification product to obtain a reaction product; and determining whether the sample to be tested contains type O foot-and-mouth disease virus based on the fluorescence and fluorescence value of the reaction product.

4. The method according to claim 3, characterized in that The method of determining whether the sample to be tested contains O-type foot-and-mouth disease virus based on the fluorescence and fluorescence value of the reaction product is to observe the reaction product under a blue light / ultraviolet light. If the reaction product produces green fluorescence, the sample to be tested contains O-type foot-and-mouth disease virus. If the reaction product does not produce color fluorescence, the sample to be tested does not contain O-type foot-and-mouth disease virus.

Images