A humpback seabass antimicrobial peptide IFNi-18 and its application

Abstract

The present invention discloses a humpback seabass antimicrobial peptide IFNi‑18 and its application, and belongs to the field of biotechnology. The amino acid sequence of the antimicrobial peptide is SEQ ID NO.1, and the nucleotide sequence of its encoding gene is shown in SEQ ID NO.2. The present invention performs in vitro chemical synthesis on the humpback seabass antimicrobial peptide IFNi‑18, and finds that the antimicrobial peptide has low cytotoxicity and has broad-spectrum and strong antimicrobial activity against a variety of Gram-positive and Gram-negative bacteria. The SEM image of bacteria treated with IFNi‑18 shows that holes appear in the bacterial cell membrane and the cells are dissolved. Due to its broad-spectrum resistance, small molecular weight, low difficulty in chemical synthesis, and possible antimicrobial activity against other aquatic animal pathogens, IFNi‑18 has broad application prospects as an antibacterial agent.

Description

Technical Field

[0001] The invention belongs to the field of molecular biotechnology, and specifically relates to a humpback seabass antibacterial peptide IFNi-18 and an application thereof. Background Art

[0002] With the continuous development of aquaculture and the continued abuse of antibiotics, more and more bacteria may develop into strains resistant to traditional antibiotics. Diseases caused by resistant strains are difficult to cure with existing antibiotics, which not only brings great harm to the health of aquatic animals, but also causes huge economic losses to the aquaculture industry. Therefore, seeking efficient and green alternatives to antibiotics has become an important issue that needs to be solved urgently.

[0003] Antimicrobial peptides (AMPs) are a class of small peptide substances widely found in organisms in nature. They are an important part of the body's innate immune system. Unlike traditional antibiotics, AMPs have good hydrophobicity and amphiphilicity. After contacting the lipid membrane of microorganisms, their positively charged hydrophilic parts can bind to the negatively charged phosphate groups in the cell membrane through electrostatic interactions, and the hydrophobic parts can be inserted into the lipid bilayer through hydrophobic interactions, thereby causing leakage of intracellular substances or disintegration of transmembrane potential, affecting the normal physiological processes of cells, and thus leading to cell death. It is difficult for bacteria to change their own cell membrane components in a short period of time, so it is not easy for bacteria to develop resistance to antimicrobial peptides.

[0004] Humpback perch ( Chromileptes altivelis ) is one of the precious marine economic fish mainly cultivated along the southern coast of my country. Its meat is tender and fresh, and it has always been listed as a precious edible fish. Summary of the invention

[0005] The purpose of the present invention is to provide a humpback seabass antimicrobial peptide IFNi-18.

[0006] Another object of the present invention is to provide the application of the humpback seabass antimicrobial peptide IFNi-18.

[0007] In order to solve the above technical problems, the present invention is implemented by the following technical solutions:

[0008] A humpback seabass antimicrobial peptide IFNi-18, wherein the amino acid sequence of the humpback seabass antimicrobial peptide IFNi-18 is as shown in SEQ ID NO.2: KFALQKHYHTCFTWRHHA.

[0009] The nucleotide sequence of the gene encoding the antimicrobial peptide IFNi-18 is shown in SEQ ID NO.1: aagttcgccctgcagaagcactaccacacctgtttcacctggagacaccacgcc.

[0010] Disclosed is an application of a humpback seabass antimicrobial peptide IFNi-18, and application of the humpback seabass antimicrobial peptide IFNi-18 or a gene encoding the antimicrobial peptide IFNi-18 in the preparation of a drug for treating or preventing Gram-negative bacteria or Gram-positive bacteria.

[0011] Furthermore, the invention discloses an application of the invention in the preparation of drugs for inhibiting and killing Streptococcus agalactiae, Streptococcus dolphinus, Staphylococcus aureus, Escherichia coli, Edwardsiella piscicidalis, Vibrio alginolyticus, Vibrio harveyi and Vibrio parahaemolyticus.

[0012] The present invention also provides a biological preparation, wherein the biological preparation comprises the humpback sea bass antimicrobial peptide IFNi-18.

[0013] The beneficial effects of the present invention compared with the prior art are as follows:

[0014] 1. The present invention is composed of 18 amino acids, with the molecular formula C 108 H 151 N 33 O 23 S1, with a molecular weight of 2311.65 Daltons, contains three positively charged amino acid residues. Its isoelectric point is predicted to be 9.79 based on the charge of the amino acid residues, and its average hydrophilicity coefficient is -0.928. It has strong water solubility and is a positively charged cationic polypeptide.

[0015] 2. The humpback sea bass antibacterial peptide IFNi-18 of the present invention has a significant antibacterial effect on both Gram-positive bacteria and Gram-negative bacteria, and exerts its bactericidal effect by forming holes in the bacterial cell membrane and dissolving the bacterial cells;

[0016] 3. The humpback sea bass antimicrobial peptide IFNi-18 of the present invention has no cytotoxic effect on normal mammalian cells such as mouse mononuclear macrophage RAW264.7;

[0017] 4. The humpback seabass antimicrobial peptide IFNi-18 of the present invention is expected to be used for the prevention and treatment of aquatic animal diseases in later research due to its advantages of high water solubility, good antibacterial effect, broad antibacterial spectrum, and low cytotoxicity, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 The antibacterial zone experimental diagram of the humpback seabass antimicrobial peptide IFNi-18 in the embodiment of the present invention: A is Streptococcus agalactiae, B is Staphylococcus aureus, C is Streptococcus iniae, D is Escherichia coli, E is Edwardsiella piscicida, F is Vibrio alginolyticus, G is Vibrio harveyi, and H is Vibrio parahaemolyticus; wherein, a, 1 mg / mL IFNi-18 solution, b, PBS solution, c, 1 mg / mL kanamycin solution;

[0019] Figure 2 This is a scanning electron microscope observation diagram of the humpback sea bass antimicrobial peptide IFNi-18 in the embodiment of the present invention after the reaction with Streptococcus agalactiae, Streptococcus iniae, Vibrio harveyi and Vibrio parahaemolyticus;

[0020] Figure 3 This is a graph showing the cytotoxicity of humpback sea bass antimicrobial peptide IFNi-18 on mouse mononuclear macrophage RAW264.7 cells using the CCK8 method according to an embodiment of the present invention; wherein the abscissa is the concentration of IFNi-18 (μM), and the ordinate is the cell proliferation rate (%). DETAILED DESCRIPTION

[0021] The technical solution of the present invention is further explained below by examples, but the technical solution of the present invention is not limited in any form by the examples. Example

[0022] The nucleotide sequence of the humpback seabass antimicrobial peptide IFNi-18 is as shown in SEQ ID NO.1, and the amino acid sequence of the humpback seabass antimicrobial peptide IFNi-18 is as shown in SEQ ID NO.2: KFALQKHYHTCFTWRHHA.

[0023] The humpback sea bass antimicrobial peptide IFNi-18 in this example was synthesized by solid phase synthesis method commissioned by Gill Biochemical (Shanghai) Co., Ltd., with a purity higher than 95%, and provided peptide molecular weight, HPLC and other detection information.

[0024] The physicochemical parameters of humpback sea bass antimicrobial peptide IFNi-18 are shown in Table 1:

[0025] Table 1 Physicochemical parameters of humpback sea bass antimicrobial peptide IFNi-18

[0026] .

[0027] It can be seen from Table 1 that IFNi-18 has a small molecular weight, good stability, strong water solubility, and is a cationic polypeptide with a positive charge.

[0028] Experimental Example 2: Inhibition Zone Experiment of Humpback Seabass Antimicrobial Peptide IFNi-18

[0029] The strains involved are: Streptococcus agalactiae ( Streptococcus agalactiae )、Streptococcus iniae( S . iniae ), Staphylococcus aureus ( Staphylococcus aureus ), Escherichia coli ( Escherichia coli ), Edwardsiella piscicida ( Edwardsiella piscicida )、Vibrio alginolyticus( Vibrio alginolyticus harveyi ( V . harveyi ), Vibrio parahaemolyticus (V . Parahaemolyticus ).

[0030] The specific method is as follows:

[0031] (1) Streak the preserved Staphylococcus aureus, Escherichia coli, Vibrio alginolyticus, Vibrio harveyi, Vibrio parahaemolyticus, Edwardsiella piscicida on LB plates, Streptococcus agalactiae and Streptococcus indioides on BHI plates. Then place them in an incubator at 30°C and invert for 12 hours. Staphylococcus aureus and Escherichia coli should be placed in an incubator at 37°C and inverted for 12 hours.

[0032] (2) Pick colonies from each plate and inoculate them into the corresponding LB or BHI liquid culture medium. After culturing for 12 h, adjust the concentration of the bacterial suspension to 1×10 with 10 mM PBS (pH=7.4). 6 CFU / mL;

[0033] (3) Pipette 200 μL of bacterial suspension and drop it onto the corresponding LB or BHI solid medium. Spread it evenly with a coating rod. After the bacterial liquid on the surface of the plate is dry, use tweezers to place the sterilized filter paper on the surface of the LB or BHI solid medium.

[0034] (4) After adding 20 μL of 1 mg / mL IFNi-18 and kanamycin solution and PBS onto the filter paper, place the plate upright for 1 h, then invert it horizontally in an incubator at 30 °C or 37 °C for 12 h. Then, take it out and observe whether an inhibition zone is formed, and take photos to record it.

[0035] The experimental results are as follows Figure 1 As shown, IFNi-18 has a significant inhibitory effect on Staphylococcus aureus, Escherichia coli, Vibrio alginolyticus, Vibrio harveyi, Vibrio parahaemolyticus, Edwardsiella piscicidalis, Streptococcus agalactiae and Streptococcus iniae.

[0036] Experimental Example 3: Determination of the minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of the humpback sea bass antimicrobial peptide IFNi-18

[0037] The specific method is as follows:

[0038] (1) Use the corresponding culture medium to adjust the concentration of bacterial suspension to 2×10 6 CFU / mL, 100 μL was added to a 96-well plate, and 100 μL of IFNi-18 solution of different concentrations (final concentrations were 128, 64, 32, 16, 8, 4, 2, and 1 μM) was added to each well. Positive and negative control groups were set up, and three parallel groups were set up for each group;

[0039] (2) After culturing in a suitable constant temperature incubator for 16 h, measure the absorbance of each well at 600 nm, and take the lowest concentration at which the growth of the strain is completely inhibited as the MIC value of IFNi-18;

[0040] (3) After mixing the experimental group, pipette 100 μL of the bacterial solution onto the corresponding LB or BHI solid culture medium plate, incubate it upside down at 30°C or 37°C for 16 h, and take the lowest concentration corresponding to no bacterial growth on the plate as the MBC value of IFNi-18.

[0041] The MIC and MBC observation results of humpback sea bass antimicrobial peptide IFNi-18 are shown in Table 2:

[0042] Table 2 Antimicrobial activity of humpback sea bass antimicrobial peptide IFNi-18

[0043] .

[0044] Example 3: Scanning electron microscopic observation of the effect of humpback sea bass antimicrobial peptide IFNi-18 on bacteria

[0045] Streptococcus agalactiae, Streptococcus iniae, Vibrio harveyi, and Vibrio parahaemolyticus were selected as the test bacteria; the preparation steps of the scanning electron microscope sample are as follows:

[0046] (1) After the above four bacteria were cultured to the logarithmic growth phase, 0.9% NaCl was used to adjust the bacterial concentration to 1× 10 8 CFU / mL;

[0047] (2) Mix 150 μL of bacterial solution and 150 μL of IFNi-18 solution in a centrifuge tube to make the final concentration of the antimicrobial peptide reach 5 × MIC. Incubate at room temperature for 1 h. The control group is added with an equal amount of 0.9% NaCl solution.

[0048] (3) After the incubation time is reached, add 0.9% NaCl, centrifuge at 8000 rpm for 5 min, wash the precipitate three times, then add 200 μL of electron microscopy fixative (the main component is 2.5% glutaraldehyde), and fix at 4°C in the dark for 4 h;

[0049] (4) After fixation, the sample was centrifuged to collect the bacterial precipitate, and the bacterial precipitate was washed again three times with 0.9% NaCl solution;

[0050] (5) Dehydrate the samples with 30%, 50%, 70%, 90% and 100% anhydrous ethanol for 15 min, and then resuspend the bacterial pellet with 50 μL of 100% anhydrous ethanol;

[0051] (6) Pipette 10 μL of the sample and drop it onto a flat piece of tin foil, mark it accordingly, and place it in a culture dish;

[0052] (7) Place the culture dish in a vacuum freeze dryer and freeze-dry for 12 h;

[0053] (8) The freeze-dried sample was then placed in a low vacuum coating machine and subjected to vacuum high pressure gold spraying for 30 min before being observed and photographed under a scanning electron microscope.

[0054] The experimental results are as follows Figure 2 As shown, the bacteria in the control group had normal morphology, intact structure and smooth surface; the bacteria treated with the antimicrobial peptide IFNi-18 had obvious changes in morphology, with wrinkles and holes appearing on the membrane surface, and even cells lysing.

[0055] Example 4: Cytotoxicity assay of humpback sea bass antimicrobial peptide IFNi-18

[0056] The specific method is as follows:

[0057] (1) Collect mouse mononuclear macrophage RAW264.7 cells in good growth condition and adjust the cell concentration to 1×10 5 The cells were evenly dispersed, and 100 μL of cell suspension was added to each well of a 96-well cell culture plate. The plate was placed in a 37°C incubator and cultured until more than 80% of the cells adhered to the wall.

[0058] (2) Carefully aspirate the culture medium and add 100 μL of DMEM culture medium containing different concentrations (2, 4, 8, 16, 32, 64, 128 μM) of IFNi-18. Set up a control group with an equal amount of DMEM culture medium and culture in a 37 °C incubator for 24 h. Each group has three replicates.

[0059] (3) RAW264.7 cell viability was detected using a CCK8 kit (Beyotime, China) at 450 nm on a microplate reader. The culture medium without cells was mixed with an equal volume of CCK8 solution as a blank group.

[0060] (4) The formula for cell proliferation rate (%) is:

[0061] Cell proliferation rate (%) = (experimental group - blank group) / (control group - blank group) × 100%;

[0062] The results are as follows Figure 3 As shown, IFNi-18 at concentrations up to 128 μM was not toxic to RAW264.7 cells.

Claims

1. An application of humpback seabass antimicrobial peptide IFNi-18, characterized in that: The use of the humpback seabass antimicrobial peptide IFNi-18 or the gene encoding the humpback seabass antimicrobial peptide IFNi-18 in the preparation of a drug for inhibiting and killing Gram-negative bacteria or Gram-positive bacteria, the amino acid sequence of the humpback seabass antimicrobial peptide IFNi-18 is shown in SEQ ID NO.2, the nucleotide sequence of the gene is shown in SEQ ID NO.1, and the Gram-negative bacteria or Gram-positive bacteria are Streptococcus agalactiae, Streptococcus dolphinus, Staphylococcus aureus, Escherichia coli, Edwardsiella piscicidal, Vibrio alginolyticus, Vibrio harveyi and / or Vibrio parahaemolyticus.

Images