A non-small cell lung cancer target and its application

Abstract

The present invention belongs to the technical fields of crude drug medicine and molecular biology, and specifically relates to a non-small cell lung cancer target and application. The present invention first discovered that the expression level of CRABP2 is closely related to non-small cell lung cancer and mitochondrial metabolism. Further studies have confirmed that CRABP2 is related to the proliferation, invasion and metastasis mechanisms of tumor cells in non-small cell lung cancer, and it is clarified that CRABP2 promotes mitochondrial metabolism by directly inhibiting the degradation of PGC-1α and stabilizing its expression, providing a complete pathway study. The present invention also discovered shRNA targeting the CRABP2 gene and the inhibitor paeonol; finally, the present invention confirmed that knocking out CRABP2 is effective in treating non-small cell lung cancer by knocking out CRABP2, and it is expected to be developed into a new therapeutic drug to make up for the shortcomings of current drug selection.

Description

Technical Field

[0001] The invention belongs to the technical field of crude drug medicine and molecular biology, and specifically relates to a non-small cell lung cancer target and application. Background Art

[0002] Lung cancer has always been a serious threat to human life and health. Based on histological classification, lung cancer is divided into two subtypes: non-small cell lung cancer (NSCLC) and small cell lung cancer, of which NSCLC accounts for 85% of the total number of lung cancer cases. Current treatment options for NSCLC include surgical resection, traditional or stereotactic radiotherapy, chemotherapy, targeted therapy, and immunotherapy. With the continuous innovation of treatment methods, the treatment of NSCLC has achieved revolutionary results. However, due to the large individual differences among patients and the different tumorigenesis mechanisms of different subtypes of NSCLC, most patients still face the outcome of treatment insensitivity and eventual drug resistance, resulting in a 5-year survival rate of less than 20% for patients with advanced NSCLC. Exploring new therapeutic targets is of great clinical significance for improving the current treatment dilemma of lung adenocarcinoma.

[0003] In recent years, the role of mitochondrial metabolic reprogramming in the occurrence and development of tumors has attracted much attention. Tumor cells obtain the energy and substances they need through mitochondrial metabolic reprogramming, and many signal transduction pathways are changed to affect the biological behavior of cells. Mitochondrial metabolic reprogramming involves processes such as glycolysis, tricarboxylic acid cycle and oxidative phosphorylation, and is considered a new target for tumor treatment.

[0004] Cellular retinoic acid binding protein 2 (CRABP2) is a nucleocytoplasmic shuttling protein whose main physiological function is to transport retinoic acid to the cell nucleus so that it can bind to retinoic acid receptors. Studies have found that abnormal expression of CRABP2 in many tumors can affect tumor invasion, metastasis and poor prognosis of patients through various pathways such as growth and apoptosis. It is reported that CRABP2 is abnormally highly expressed in many types of tumors and is closely related to the prognosis of patients. Researchers believe that CRABP2 can be used as a biomarker for the diagnosis and prognosis of various tumors such as breast cancer. Studies have found that the expression level of CRABP2 in the plasma of NSCLC patients is significantly increased and positively correlated with the TNM stage of patients. Summary of the invention

[0005] In view of the above-mentioned prior art, the present invention provides the application of CRABP2 in the diagnosis and treatment of non-small cell lung cancer. The present invention first discovered that the expression of CRABP2 is closely related to the mitochondrial metabolism of non-small cell lung cancer. At the same time, studies have confirmed that CRABP2 promotes the mitochondrial metabolism of non-small cell lung cancer by stabilizing peroxisome proliferator-activated receptor γ coactivator 1-alpha (PGC-1α). Therefore, CRABP2 serves as a predictive diagnostic marker and potential therapeutic target for mitochondrial metabolism of non-small cell lung cancer. Based on the above research results, the present invention is completed.

[0006] Specifically, the present invention relates to the following technical solutions:

[0007] The first aspect of the present invention provides the use of CRABP2 as a predictive diagnostic marker or drug target for mitochondrial metabolism in non-small cell lung cancer.

[0008] Furthermore, CRABP2 is used as a predictive diagnostic marker or drug target in screening diagnostic products or drugs that inhibit the PGC-1α signaling pathway.

[0009] The second aspect of the present invention provides the use of CRABP2 as a target in the preparation of non-small cell lung cancer treatment and / or screening of non-small cell lung cancer drugs.

[0010] Furthermore, the drugs include but are not limited to pharmaceutically acceptable carriers and pharmaceutical carriers.

[0011] Furthermore, the pharmaceutically acceptable carrier may be a buffer, an emulsifier, a suspending agent, a stabilizer, a preservative, an excipient, a filler, a coagulant and a regulator, a surfactant, a dispersant or a defoaming agent.

[0012] Furthermore, the pharmaceutical carrier is a virus, a microcapsule, a liposome, a nanoparticle or a polymer and any combination thereof.

[0013] The third aspect of the present invention provides an inhibitor, which is shRNA and targets the CRABP2 gene and consists of SEQ ID No.1 or SEQ ID No.2.

[0014] The fourth aspect of the present invention provides an inhibitor, which is paeonol. Paeonol inhibits the proliferation and metastasis of non-small cell lung cancer cells PC-9 and HCC827 through the CRABP2 / PGC-1α pathway.

[0015] Compared with the prior art, the present invention has the following beneficial effects:

[0016] The present invention discovered for the first time that the expression of CRABP2 is closely related to non-small cell lung cancer and mitochondrial metabolism. Further studies confirmed that CRABP2 is related to the proliferation, invasion and metastasis mechanisms of tumor cells in non-small cell lung cancer, and clarified that CRABP2 promotes mitochondrial metabolism by directly inhibiting the degradation of PGC-1α and stabilizing its expression, providing a complete pathway study. The present invention also discovered shRNA targeting the CRABP2 gene and the inhibitor paeonol; finally, the present invention confirmed that knocking out CRABP2 is effective in treating non-small cell lung cancer by knocking out CRABP2, and it is expected to be developed into a new type of therapeutic drug to make up for the shortcomings of current drug selection. In summary, CRABP2 plays an important role in the diagnosis and treatment of non-small cell lung cancer as a predictive diagnostic marker and potential therapeutic target for non-small cell lung cancer, and therefore has good practical application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] The accompanying drawings, which constitute a part of this specification, are included to provide a further understanding of the present invention.

[0018] Figure 1 The expression of CRABP2 and mitochondrial metabolism in non-small cell lung cancer in the embodiment; wherein, Figure 1 A in the middle is a volcano plot analysis showing that CRABP2 is highly expressed in non-small cell lung cancer. The CRABP2 expression data comes from tissue proteomics analysis of clinical samples. Figure 1 Middle B is a volcano plot analysis showing that the expression of mitochondrial-related proteins is particularly increased in non-small cell lung cancer. The data comes from tissue proteomics analysis of clinical samples. Figure 1 C and D in the middle are GESA enrichment analysis, which are mitochondrial and mitochondrial-related proteins, respectively, indicating that most of the differentially expressed genes are mitochondrial-related proteins. The data are derived from tissue proteomics analysis of clinical samples.

[0019] Figure 2 For heat map analysis of the high expression of CRABP2 in non-small cell lung cancer, CRABP2 expression data were obtained from tissue proteomic analysis of clinical samples;

[0020] Figure 3 A in the middle indicates that CRABP2 expression is significantly upregulated in lung adenocarcinoma tissues compared with healthy controls; Figure 3 Middle B shows that the expression of CRABP2 in lung adenocarcinoma tissues was higher than that in the corresponding adjacent cancer tissues in the paired samples; Figure 3 C in the middle is the Kaplan-Meier survival curve analysis, which shows that high expression of CRABP2 is significantly positively correlated with poor survival of patients. The above data are all from the TCGA database;

[0021] Figure 4 In the embodiment, CRABP2 is significantly overexpressed in clinical samples of non-small cell lung cancer; wherein, Figure 4 A and B in the figure are the expression of CRABP2 in normal tissues and non-small cell lung cancer tumor tissues evaluated by IHC and the bar graph comparison; Figure 4 C and D in the middle are Western blot evaluation of CRABP2 protein expression in normal tissues and non-small cell lung cancer tumor tissues and bar graph comparison; Figure 4 Middle E is qRT-PCR evaluation of CRABP2 mRNA expression in normal tissues and non-small cell lung cancer tumor tissues;

[0022] Figure 5 To evaluate the relationship between CRABP2 expression and gender, age, case type, and grade in tissue microarray by IHC;

[0023] Figure 6 In the embodiment, knocking down CRABP2 inhibits the growth and proliferation of non-small cell lung cancer cells; wherein, Figure 6 A in the middle shows the effect of shRNA inhibiting the expression of CRABP2 in non-small cell lung cancer cells PC-9 and HCC827; Figure 6 B and C in the figure are CCK-8 experiments to evaluate the effect of knocking down CRABP2 on the proliferation of non-small cell lung cancer cells PC-9 and HCC827;

[0024] Figure 7 Middle A is a cloning experiment to evaluate the effect of knocking down CRABP2 on the proliferation of non-small cell lung cancer cells PC-9 and HCC827; Figure 7 B and C in the figure are the comparison of PC-9 and HCC827 clone numbers, respectively;

[0025] Figure 8 Middle A is a subcutaneous nude mouse experiment evaluating the effect of knocking down CRABP2 on non-small cell lung cancer tumorigenesis; Figure 8 Middle B is a subcutaneous nude mouse experiment evaluating the effect of knocking down CRABP2 on the changes in tumor volume of non-small cell lung cancer;

[0026] Fig. 9 The effect of CRABP2 on the migration and invasion of non-small cell lung cancer in the embodiment; wherein, Fig. 9 Middle A is a scratch assay to evaluate the inhibition of migration of non-small cell lung cancer cells A549 by knocking down CRABP2; Fig. 9 Middle B is a scratch assay to evaluate the inhibition of migration of non-small cell lung cancer cells HCC827 by knocking down CRABP2; Fig. 9 Middle C is a Transwell assay to evaluate the inhibition of migration of non-small cell lung cancer cells PC-9 and HCC827 by knocking down CRABP2; Fig. 9 Middle D is a Transwell experiment evaluating the inhibition of invasion of non-small cell lung cancer cells PC-9 and HCC827 by knocking down CRABP2; Fig. 9Middle E is a scratch assay to evaluate the effect of overexpression of CRABP2-Flag on the migration of non-small cell lung cancer cells A549; Fig. 9 Middle F is a scratch assay to evaluate the effect of overexpression of CRABP2-eGFP on the migration of non-small cell lung cancer cells A549; Fig. 9 Middle G is a Transwell experiment evaluating the effect of overexpression of CRABP2 on the migration and invasion of non-small cell lung cancer A549 cells;

[0027] Fig.10 In the embodiment, knocking down CRABP2 inhibits mitochondrial metabolism in non-small cell lung cancer cells; wherein, Fig.10 Middle A is an immunofluorescence experiment to evaluate the knockdown of CRABP2, and the expression of mitochondrial marker proteins is also reduced; Fig.10 B and C in the figure are flow cytometry experiments to evaluate the knockdown of CRABP2, and the expression of mitochondrial marker proteins is also reduced;

[0028] Fig.11 Middle A is a Seahorse experiment evaluating the knockdown of CRABP2, which reduced mitochondrial oxygen consumption in non-small cell lung cancer cells; Fig.11 B and C in the Seahorse experiment evaluate the knockdown of CRABP2, which weakens the mitochondrial maximum respiration and reserve respiration metabolism in non-small cell lung cancer;

[0029] Fig.12 A and B in the middle are protein stability experiments, showing that knocking down CRABP2 significantly inhibited the stability of PGC-1α in PC-9 cells; Fig.12 Middle C: CRABP2 silencing reduced PGC-1α protein levels, while the proteasome inhibitor MG132 rescued the reduction of PGC-1α protein;

[0030] Figure 13-16 In the example, paeonol inhibits non-small cell lung cancer cells via the CRABP2 / PGC-1α pathway; wherein, Fig.13 A and B are CCK-8 experiments to evaluate the effects of low-dose and high-dose paeonol on the proliferation of non-small cell lung cancer cells PC-9 and HCC827;

[0031] Fig.14 Middle A is a cloning experiment evaluating the effects of low-dose and high-dose paeonol on the proliferation of non-small cell lung cancer cells PC-9 and HCC827; Fig.14 B and C are statistical graphs of cloning experiments to evaluate the effects of low-dose and high-dose paeonol on the proliferation of non-small cell lung cancer cells PC-9 and HCC827;

[0032] Fig.15A in the middle is a Western blot experiment verifying that low-dose and high-dose paeonol down-regulate the protein expressions of CRABP2, PGC-1α and TFAM in PC-9 cells; Fig.15 B, C, and D are statistical graphs of Western blot experiments verifying that low-dose and high-dose paeonol down-regulate the protein expression of CRABP2, PGC-1α, and TFAM in PC-9 cells;

[0033] Fig.16 A in the middle is a scratch test to evaluate the effects of low-dose and high-dose paeonol on the metastasis of non-small cell lung cancer cells PC-9 and HCC827; Fig.16 B and C are statistical graphs of the effects of low-dose and high-dose paeonol on the metastasis of non-small cell lung cancer cells PC-9 and HCC827 evaluated by scratch assay. DETAILED DESCRIPTION

[0034] It should be noted that the following detailed descriptions are illustrative and are intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present application belongs.

[0035] It should be noted that the terms used here are only for describing specific embodiments, and are not intended to limit the exemplary embodiments according to the present application. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should also be understood that when the terms "comprising" and / or "including" are used in this specification, it indicates the presence of features, steps, operations, devices, components and / or combinations thereof. If the experimental methods of specific conditions are not indicated in the following specific embodiments, the conventional methods and conditions of molecular biology in the art are usually followed, and such techniques and conditions are fully explained in the literature. See, for example, Sambrook et al., the techniques and conditions described in "Molecular Cloning: Laboratory Manual", or according to the conditions recommended by the manufacturer.

[0036] The present invention is further described in conjunction with specific examples. The following examples are only for explaining the present invention and are not intended to limit the content thereof. If the specific experimental conditions are not specified in the examples, they are usually carried out under conventional conditions or under conditions recommended by the sales company; the materials and reagents used in the examples, unless otherwise specified, can be purchased through commercial channels.

[0037] Example 1

[0038] 1. Materials and Methods

[0039] 1.1 Cell culture

[0040] The PC-9, A549, and HCC827 cell lines of non-small cell lung cancer used in the experiment were purchased from American Type Culture Specimens. PC-9 and A549 cells were cultured in a medium containing 10% fetal bovine serum (Gibco) and 100 U mL -1 HCC827 cells were cultured in RPMI-1640 (R8758, Sigma) supplemented with penicillin / streptomycin (Invitrogen). -1 The cells were cultured in DMEM medium (D6429, Sigma) supplemented with penicillin / streptomycin and kept in a cell culture incubator at 37°C and 5% CO2.

[0041] 1.2 Nude mouse xenograft tumor model

[0042] Stable knockdown PC-9, HCC827 or overexpression A549 cell lines were constructed. Approximately 1×10 6 Tumor cells and Matrigel solution were added. Tumor size was measured every 7 days. After 6 weeks, mice were sacrificed, and tumors were removed, weighed, and photographed. The experiment was performed under a protocol approved by the Ethics Committee of the Second Hospital of Shandong University.

[0043] 1.3 Plasmid transfection

[0044] The CRABP2 cDNA of human non-small cell lung cancer cells was inserted into the pCMV-Script vector to construct FLAG-CRABP2 and EGFP-CRABP2 overexpression plasmids. HA-tagged ubiquitin plasmid and HA-K48 Ubi plasmid were purchased from Addgene (#17608, #17605). Lipofectamine 2000 (1662298, Invitrogen) was used for plasmid transfection.

[0045] 1.4 Extraction of cellular RNA

[0046] To prevent RNA degradation, the entire operation was performed on ice. Take out the cells that are growing logarithmically, discard the culture medium, and rinse the cells with ice-cold PBS that does not contain RNase, repeat once; for tissues, grind them into powder with a pestle under liquid nitrogen. 6Add 1 mL Trizol (Quanshijin, Shanghai, China) to each cell, let stand for 5 min, repeatedly blow the cells with a pipette, and after the cells are lysed, transfer them to a pre-labeled RNAse-free EP tube. Add 20 μL chloroform to each 1 mL Trizol, cover the EP tube tightly and shake thoroughly until the liquid turns pink. Centrifuge at 4°C, 12,000 r for 15 min, and you can see that the liquid is divided into three layers: upper, middle and lower. Take the upper aqueous phase and record the volume. This layer contains RNA. Do not touch the middle DNA layer and the lower organic phase to avoid RNA contamination. Add isopropanol equal to the volume of the supernatant, mix gently, and let stand on ice for 5 min. Centrifuge at 4°C, 12,000 r for 15 min, and you can see a white precipitate at the bottom of the EP tube, which is the total RNA. Discard the supernatant, add 75% ethanol equal to the volume of isopropanol, gently blow and wash the RNA precipitate, and centrifuge at 4°C, 12,000 r for 3 min. Repeat this step once. Discard the supernatant, open the EP tube, and dry the RNA. Add appropriate amount of DEPC water to completely dissolve the RNA precipitate. Measure RNA concentration using NanoDrop2000 spectrophotometer, label, and store at -80℃.

[0047] 1.5 qRT-PCR

[0048] cDNA was synthesized using the PrimeScript RT kit (Takara). Reagents and instruments used for qRT-PCR: SYBR Green PCR kit (Applied Takara, Japan), ABI 7300 (Applied Biosystems, Carlsbad, CA, USA). qRT-PCR was performed according to the two-step PCR amplification procedure. Pre-denaturation reaction: single cycle was 95℃30sec; PCR reaction: 95℃5sec-60℃20sec, number of cycles: 40. Data processing. According to the CT value of each sample, the average of three replicate wells was taken as the CT value of the sample. Calculate △CT=CT(target)-CT(internal reference), △△CT=SCT(experimental group)-△CT(control group). Calculate the relative amount of the target gene, and then use the t-test to analyze the relative expression results, with P<0.05 as statistically significant.

[0049] 1.6 Protein extraction

[0050] After collecting the adherent cells, they were resuspended and washed once with PBS, centrifuged, added with an appropriate amount of RIPA cell and tissue lysis buffer, and added with 1% volume of protease inhibitors, lysed on ice for 30 min, centrifuged at 12000 rpm and 4°C for 15 min, and the supernatant was taken to measure the protein concentration by BCA method (Vazyme, Jiangsu, China). The remaining supernatant was added with loading buffer and heated at 98°C in a metal bath for 10 min and placed in a -20°C refrigerator for use.

[0051] 1.7 Western blot

[0052] Extract total cell protein, take 10% gel preparation reagent, use 1.0mm glass plate to prepare gel for electrophoresis, place gel in electrophoresis tank after gel solidification, add electrophoresis solution, remove comb, add protein marker and sample to be tested. Soak in methanol for 20s to activate PVDF membrane, cut the required gel fragment according to the marker band, place it on the transfer clip according to the standard of black gel and white film, cover the activated PVDF membrane on the gel, and transfer at 300mA. Wash the transferred PVDF membrane with 1xTBST shaker for 3min, block with 5% skim milk, and incubate at room temperature shaker for 1.5h. Prepare primary antibodies according to the instructions: CRABP2, TFAM, MT-CO2, PGC-1α and β-Actin antibodies were purchased from Cell Signaling Technology. MG132 protein inhibitor (HY-13259) was purchased from MCE. Cycloheximide (CHX, 01810) was purchased from Sigma-Aldrich. Then, the prepared primary antibody was covered with the PVDF membrane and incubated overnight on a shaker at 4°C. Washed with 1×TBST and washed on a shaker at room temperature for 5min×3 times. The secondary antibody corresponding to the primary antibody was prepared with 5% milk at a ratio of 1:1000 and incubated on a shaker at room temperature for 1h. Discarded the secondary antibody and washed with 1×TBST for 5min×3 times. Amersham ECL luminescent solution was prepared at a ratio of 1:1, and 200μL luminescent solution was evenly applied to the protein side of each membrane. The PVDF membrane was placed in a gel imager for imaging and recording.

[0053] 1.8 CCK-8 assay

[0054] Stably knocked-down PC-9, HCC827 or overexpressed A549 cells were cultured, and 5,000 cells were seeded into 96-well plates and cultured for 2 hours. The absorbance at 450 nm was measured with a microplate reader at 24 hours, 48 ​​hours, and 72 hours. Data were collected and analyzed for cell proliferation.

[0055] 1.9 Cell scratch assay

[0056] First, use a marker pen and a ruler to evenly draw horizontal lines on the back of the 6-well plate, about every 0.5~1cm, and cross the holes horizontally. Draw at least 5 lines in each hole, and add about 5×10 5 The specific number of cells varies from cell to cell, and the goal is to make the cells fully confluent overnight. The next day, use the tip of the gun to measure the ruler and scratch the cells perpendicular to the horizontal line on the back as much as possible. Wash the cells three times with PBS, remove the scratched cells, add serum-free culture medium, and culture in a cell culture incubator. Take samples and take photos at 0, 6, 12, and 24 hours.

[0057] 1.10 Transwell chamber for detecting cell invasion and metastasis

[0058] The cells were starved of serum for 12 h, and the cell suspension was prepared and the cell density was adjusted to 5 × 10 5 . Take 200 μL of cell suspension and seed it in the upper chamber of the pre-treated Transwell chamber. Add 500 μL of complete culture medium containing serum to the lower chamber. Continue to culture cells routinely for 8 hours. Discard the upper and lower culture medium, wipe off the matrix gel and upper cells with a cotton swab, rinse twice with PBS, stain with 0.1% crystal violet for 10 minutes, discard the crystal violet, and wash twice with PBS for 10 minutes. Take out the chamber and take pictures under an inverted microscope.

[0059] 1.11 Immunofluorescence

[0060] Cells were seeded into a culture dish with a pre-treated coverslip. When the cells were close to growing into a monolayer, the coverslip was removed and washed twice with PBS. The cells were fixed with 4% paraformaldehyde. Before adding antibodies for incubation, the cells were permeabilized with Triton X-100 to ensure that the antibodies could reach the antigen site. The permeabilization time was generally 5-15 minutes. After permeabilization, the cells were washed with PBS for 3 minutes and repeated 5 times. The cells were blocked with 5% BSA blocking solution for 30 minutes. The diluted primary antibody (CRABP2 and Mitotracker-red primary antibodies were diluted 1:200, and the antibodies were from Abcam, USA) and incubated at room temperature for 1 hour or at 4°C overnight. Rinse 3 times with PBST, 5 minutes each time. Indirect immunofluorescence requires the use of fluorescent conjugated secondary antibodies (Invitrogen, Carlsbad, CA). Incubate at room temperature for 1 hour in the dark. Rinse 3 times with PBST, 5 minutes each time, and then rinse once with distilled water. Cells were counterstained with DAPI (Life Technology) and images were captured using confocal laser scanning microscopy after treatment with putative quenching agents.

[0061] 1.12 CHX Experiment

[0062] A 1 mg / mL cycloheximide (CHX) working solution was prepared, and the cells in the logarithmic growth phase were digested, centrifuged, and inoculated in a 6 cm culture dish. After the cells were cultured in the incubator for 24 h, the original culture medium was removed and replaced with DMEM complete culture medium with 0.1 mg / mL CHX for continued culture. At different time points (0 h, 3 h, 6 h, and 9 h) after the addition of CHX culture medium, the protein of each group of samples was extracted. The expression of PGC-1α protein in different groups was detected by Western blot technology.

[0063] 1.13 Bioinformatics analysis

[0064] RNAseq data of the STAR process of the lung adenocarcinoma project were obtained from the TCGA database (https: / / portal.gdc.cancer.gov), and data in TPM format were extracted from them, and data without clinical information matching were excluded. The data were analyzed and processed using R language (version 4.2.1). The difference in CRABP2 expression between lung adenocarcinoma and paired adjacent tissues was analyzed using the stats package, and the data were visualized using the ggplot2 package. The survival package was used to perform proportional hazard hypothesis testing and survival regression fitting, and the results were visualized using the survminer package and ggplot2 package.

[0065] 1.14 Statistical analysis

[0066] Data were analyzed using GraphPad Prism 9 software. The differences between two independent groups were analyzed using the t test. Survival analysis was performed using Kaplan-Meier analysis and log-rank test. All data are presented as the mean ± SD of three independent experiments. p <0.05 was considered statistically significant. (* P <0.05;** P <0.01;*** P <0.001; **** P <0.0001)

[0067] Example 2

[0068] 2.1 CRABP2 expression is closely related to mitochondrial metabolism in non-small cell lung cancer tissues

[0069] First, the present invention collected paired clinical samples of non-small cell lung cancer for non-targeted mass spectrometry analysis. The volcano plot indicated that CRABP2 was significantly overexpressed in non-small cell lung cancer tissues ( Figure 1 A). Mitochondrial-related proteins are also significantly overexpressed in non-small cell lung cancer tissues ( Figure 1 B). Heat map analysis further verified the significant high expression of CRABP2 in non-small cell lung cancer tissues ( Figure 2 ). GESA enrichment analysis showed that most of the differentially expressed genes were mitochondrial-related proteins ( Figure 1 C. Figure 1 D). GO enrichment analysis showed that differentially expressed genes were enriched in signaling pathways such as cellular redox homeostasis, aerobic respiration, and metabolic processes. Data from the TCGA database showed that CRABP2 was significantly increased in non-small cell lung cancer tissues compared with healthy controls ( Figure 3A). In paired tissue samples, the expression of CRABP2 in non-small cell lung cancer samples was significantly higher than that in adjacent adjacent tissues ( Figure 3 B).

[0070] 2.2 CRABP2 is significantly overexpressed in clinical samples of non-small cell lung cancer

[0071] The present invention collected more clinical samples of non-small cell lung cancer, some of which were fixed with formalin to make wax blocks, and some of which were frozen in a -80 refrigerator. IHC experiments showed that compared with normal tissues, the expression of CRABP2 in non-small cell lung cancer tumor tissues was significantly increased ( Figure 4 A). Western blot experiments showed that CRABP2 and mitochondrial-related proteins TFAM and MT-CO2 were significantly overexpressed in clinical tumor samples. Similarly, qRT-PCR also verified this phenomenon at the mRNA level ( Figure 4 BC). The results of IHC tissue microarrays suggest that CRABP2 expression is not closely associated with gender, age, or grade, but is significantly positively correlated with case classification ( Figure 5 ).

[0072] 2.3 Knockdown of CRABP2 inhibits the growth of non-small cell lung cancer cells

[0073] CRABP2 knockdown in non-small cell lung cancer PC-9 cells and HCC827 cells was constructed ( Figure 6 A). CCK-8 experiments revealed that knocking down CRABP2 could significantly inhibit the growth of PC-9 and HCC827 cells ( Figure 6 BC); Cloning experiments showed that knocking down CRABP2 could significantly inhibit the proliferation of PC-9 and HCC827 cells ( Figure 7 ); PC-9 cells with CRABP2 knockdown were inoculated subcutaneously into nude mice. The results showed that CRABP2 silencing significantly inhibited the tumorigenicity of non-small cell lung cancer cells ( Figure 8 ).

[0074] 2.4 Knockdown of CRABP2 inhibits migration and invasion of non-small cell lung cancer cells

[0075] The scratch assay was used to detect the effect of CRABP2 on the migration ability of non-small cell lung cancer PC-9 cells and HCC827 cells. The results showed that CRABP2 silencing could significantly inhibit the migration ability of non-small cell lung cancer cells PC-9 and HCC827 ( Fig. 9 AB). In addition, the Transwell assay evaluated the inhibition of migration and invasion of non-small cell lung cancer cells PC-9 and HCC827 by knocking down CRABP2 ( Fig. 9CD); Scratch experiments showed that overexpression of CRABP2-Flag and CRABP2-eGFP could significantly enhance the migration ability of non-small cell lung cancer cells A549 ( Fig. 9 EF); Transwell experiments showed that overexpression of CRABP2-Flag and CRABP2-eGFP significantly enhanced the invasion ability of non-small cell lung cancer cells A549 ( Fig. 9 G).

[0076] 2.5 Knockdown of CRABP2 inhibits mitochondrial metabolism in non-small cell lung cancer cells

[0077] Immunofluorescence experiments showed that the expression of mitochondrial marker protein Mitrotracker-red was also reduced in PC-9 cells with CRABP2 knockdown ( Fig.10 A); Flow cytometry experiments also verified this phenomenon ( Fig.10 BC); Seahorse experimental results showed that knocking down CRABP2 reduced mitochondrial oxygen consumption in non-small cell lung cancer cells PC-9 ( Fig.11 A); At the same time, the mitochondrial maximum respiration and reserve respiration metabolism of PC-9 cells were significantly weakened ( Fig.11 BC). Protein stability experiments showed that knocking down CRABP2 significantly inhibited the stability of PGC-1α in PC-9 cells ( Fig.12 AB); knockdown of CRABP2 significantly reduced the level of PGC-1α protein, while the proteasome inhibitor MG132 was able to rescue the reduction of PGC-1α protein level ( Fig.12 C).

[0078] 2.6 Paeonol inhibits the development of non-small cell lung cancer cells via the CRABP2 / PGC-1α pathway

[0079] Using CCK-8 experiments, it was found that high and low doses of paeonol had a significant inhibitory effect on the proliferation of non-small cell lung cancer cells PC-9 and HCC827, and the effect was dose-dependent ( Fig.13 AB); Cloning experiments evaluated the effects of low-dose and high-dose paeonol on the proliferation of non-small cell lung cancer cells PC-9 and HCC827, and the results showed the same trend as the CCK-8 experiment ( Fig.14 ); Western blot experiments verified that low-dose and high-dose paeonol could inhibit the protein expression of CRABP2, PGC-1α and TFAM in PC-9 cells ( Fig.15 ); The results of the scratch test showed that low-dose and high-dose paeonol had a significant inhibitory effect on the metastasis of non-small cell lung cancer cells PC-9 and HCC827 ( Fig.16 ), where the low and high doses were 0.2mM and 0.4mM.

[0080] Example 3

[0081] The expression data of CRABP2 protein and mRNA known in the art should be understood to be from the TCGA database.

[0082] The term "expression level" refers to the amount of a gene product present in vivo or in a sample at a specific time point. The expression level can be measured / quantified / detected, for example, by a protein or mRNA expressed by a gene. The expression level can be quantified, for example, as follows: the amount of the target gene product present in a normalized sample of the total amount (total protein or mRNA) of the same type of gene product in the same sample or reference sample (for example, a sample obtained from the same individual at the same time or a portion of the same size (weight, volume) of the same sample), or the sample size (weight, volume, etc.) of the amount / limitation of the target gene product is determined. The expression level can be measured or detected by any method known in the art, such as a method (such as mass spectrometry) for direct detection and quantification of the target gene product, or a method for indirect detection and measurement of the target gene product that is usually combined with one or more different molecules or detection devices (such as primers, probes, antibodies, protein scaffolds) that are specific to the target gene product. It is also known to the skilled person to determine the level of gene copies, which also includes determining the absence or presence of one or more fragments (e.g., by nucleic acid probes or primers, such as quantitative PCR, Multiplex ligation-dependent probe amplification (MLPA) PCR).

[0083] The term "protein level" refers to the amount of protein in a substance; protein levels can be detected by Western Blot. Western Blot is a commonly used experimental method to detect the molecular weight and expression level of proteins. It can identify target proteins using specific antibodies based on the migration behavior of proteins after electrophoretic separation. Western Blot is widely used in the fields of molecular biology, cell biology, immunology, etc., and can be used to detect protein expression, identification, quantification, purification, and subcellular localization.

[0084] The terms "indicator" and "marker" are used interchangeably in the present invention and refer to a sign or signal of a disease or are used to monitor a disease. Such a "disease" refers to a biological state of a cell, tissue or organ, or refers to the health and / or disease state of an individual. An indicator can be the presence or absence of a molecule including but not limited to peptides, proteins and nucleic acids, or can be a change in the expression level or pattern of such a molecule in a cell, or tissue, organ or individual. An indicator can be a sign of the occurrence, development or presence of a disease in an individual or the further progression of such a disease. An indicator can also be a sign of the risk of developing a disease in an individual.

[0085] The terms "up-regulated", "increased" or "increased" in the level of an indicator refer to a decrease in the level of such indicator in a sample compared to a reference.

[0086] The terms "down-regulated", "reduced" or "decreased" in the level of an indicator refer to a decrease in the level of such indicator in a sample compared to a reference.

[0087] In principle, a reference amount can be calculated for a given group or cohort of subjects according to the invention based on the mean or median value of CRABP2 by applying standard statistical methods.

[0088] The term "kit" as used in the present invention refers to a collection of the above-mentioned components preferably provided separately or provided in a single container. The container also preferably contains instructions for implementing the inventive method. Examples of these components of the kit and methods of use thereof have been given in this specification. Preferably, the kit contains the above-mentioned components in a ready-to-use formulation. Preferably, the kit may additionally include instructions, such as a user's manual for adjusting components (e.g., the concentration of the detection agent) and for explaining the results of any determination of the diagnosis provided by the inventive method. In particular, such a manual may include information for determining that the amount of the gene product is assigned to the diagnosis type. Details are found elsewhere in this specification. In addition, such a user's manual may provide instructions for correctly using the kit components for determining the amount of the corresponding biomarker. The user's manual may be provided in paper or electronic form (e.g., stored on a CD or CD ROM). The present invention also relates to the purposes of the kit in any method according to the present invention.

[0089] The term "system" as used in the present invention relates to a system of devices comprising at least the above-mentioned devices that are effectively interconnected to allow diagnosis. Preferred devices for determining the methylation state or amount of a gene product and devices for comparison are disclosed above in conjunction with the method of the present invention. How to contact the device in an operational manner will depend on the type of device included in the device. For example, in the case of applying a device for automatically determining the methylation state or amount of a gene product, the data obtained by the automated operation device can be processed by, for example, a computer program to establish a diagnosis. Preferably, in this case, the device is contained in a single device. Therefore, the device can include an analytical unit for determining the methylation state or amount of a gene product in a sample and an evaluation unit for processing the resulting data for diagnosis. Preferred detection devices are disclosed above in conjunction with embodiments related to the method of the present invention. In this case, the device is effectively connected so that the user of the system combines the determination results of the amount and its diagnostic value together due to the instructions and explanations given in the manual. In such an embodiment, the device can be presented as a separate device and is preferably packaged together as a kit. Those skilled in the art will understand how to contact the device without further creative skills. Preferred devices are those that can be applied without the specific knowledge of a professional clinician, such as test strips or electronic devices that only require loading samples. The result can be used as the output of parameter diagnosis raw data, preferably provides as absolute or relative amount.Should be understood that these data will need to be explained by clinicians.Yet, also envision expert system equipment, wherein output comprises processed diagnosis raw data, and its explanation does not need professional clinicians.Other preferred equipment comprises analysis unit / equipment (for example, biosensor, array, with the solid support of the ligand coupling of specific recognition polypeptide, plasma surface resonance equipment, NMR spectrometer, mass spectrometer etc.) or the assessment unit / equipment mentioned above according to the inventive method.

[0090] In a specific embodiment of the present invention, CRABP2 is used as a marker in the preparation of a diagnostic or auxiliary diagnostic product for non-small cell lung cancer.

[0091] The bioinformatics analysis of non-small cell lung cancer in the present invention found that the expression level of CRABP2 in non-small cell lung cancer tissue was significantly higher than that in normal brain tissue, and the results of cell experiments also confirmed this phenomenon. Therefore, CRABP2 can be used as a diagnostic marker for non-small cell lung cancer.

[0092] In another specific embodiment of the present invention, a product is provided, wherein the product comprises the above-mentioned substance for detecting CRABP2, and the product is used for diagnosing or assisting in the diagnosis of non-small cell lung cancer.

[0093] The substances for detecting CRABP2 include, but are not limited to, substances used for detecting the expression level of CRABP2 by RT-PCR, real-time quantitative PCR, in situ hybridization, gene chip and gene sequencing.

[0094] The product includes but is not limited to primers, probes, chips, nucleic acid membrane strips, preparations or kits for detecting the expression level of CRABP2 in a sample to be tested.

[0095] The sample to be tested may be a human sample, more specifically, the sample to be tested includes a subject (non-small cell lung cancer cells and / or non-small cell lung cancer tissue. At the same time, by combining with other non-small cell lung cancer markers, the specificity and sensitivity of the detection can be further improved.

[0096] Furthermore, in addition to the above-mentioned CRABP2 biomarker, the product may also include other biomarkers currently suitable for detecting non-small cell lung cancer and combinations thereof.

[0097] In another specific embodiment of the present invention, a system for diagnosing or assisting in the diagnosis of non-small cell lung cancer is provided, the system comprising:

[0098] i) an analysis unit, the analysis unit comprising: a detection substance for determining the expression level of the lncRNA selected from the above in a test sample of a subject, and;

[0099] ii) an evaluation unit, comprising: judging whether the subject suffers from non-small cell lung cancer according to the CRABP2 expression level determined in i).

[0100] In another specific embodiment of the present invention, the above-mentioned sample to be tested includes non-small cell lung cancer cells and / or non-small cell lung cancer tissues of the subject.

[0101] In another specific embodiment of the present invention, the above-mentioned detection substances include but are not limited to substances used for detecting the expression level of CRABP2 by RT-PCR, real-time quantitative PCR, in situ hybridization, gene chip and gene sequencing.

[0102] In another specific implementation of the present invention, the specific evaluation process of the evaluation unit includes:

[0103] If the CRABP2 expression level in the test sample of the subject is upregulated compared with the reference, the subject is or is a candidate for being a patient with non-small cell lung cancer; otherwise, the subject is not or is not a candidate for being a patient with non-small cell lung cancer.

[0104] Wherein, "reference" can be a suitable control sample, such as a sample from a normal healthy subject, which has no symptoms related to non-small cell lung cancer and no abnormal physiological and pathological findings, and the reference can also be a sample from the same subject before the onset of symptoms of the disease or disease or before the diagnosis of non-small cell lung cancer. The reference can be a standardized sample, for example, a sample containing materials or data from samples of several healthy subjects, who have no symptoms of non-small cell lung cancer and no related physiological and pathological findings.

[0105] The system for diagnosing or assisting in the diagnosis of non-small cell lung cancer of the present invention may be a virtual device, as long as it can realize the functions of the analysis unit and the evaluation unit. The analysis unit may include various detection reagent materials and / or detection instruments and equipment, etc.; the evaluation unit may be any computing instrument, module or virtual device that can analyze and process the detection results of the analysis unit to obtain the risk assessment status of non-small cell lung cancer. For example, it may be possible to prepare corresponding data charts for various possible detection results and corresponding risk conditions in advance, and compare the detection results of the detection unit with the data chart to obtain the risk assessment results of non-small cell lung cancer.

[0106] In another specific embodiment of the present invention, a method for diagnosing or assisting in the diagnosis of non-small cell lung cancer is provided, the method comprising:

[0107] a) separating the sample to be tested from the subject;

[0108] b) detecting the expression level of the above-mentioned CRABP2 in the test sample of the subject, and;

[0109] c) comparing the expression level in the sample to the expression level in a reference;

[0110] If the expression level in the sample is upregulated compared to the level in the reference, the subject is or is a candidate for being a patient with non-small cell lung cancer; otherwise, the subject is not or is not a candidate for being a patient with non-small cell lung cancer.

[0111] Wherein, "reference" can be a suitable control sample, such as a sample from a normal healthy subject, which has no symptoms related to non-small cell lung cancer and no abnormal physiological and pathological findings, and the reference can also be a sample from the same subject before the onset of symptoms of the disease or disease or before the diagnosis of non-small cell lung cancer. The reference can be a standardized sample, for example, a sample containing materials or data from samples of several healthy subjects, who have no symptoms of non-small cell lung cancer and no related physiological and pathological findings.

[0112] In another specific embodiment of the present invention, there is provided the use of the above-mentioned CRABP2 as a target in the treatment of non-small cell lung cancer and / or the screening of non-small cell lung cancer drugs.

[0113] In another specific embodiment of the present invention, the non-small cell lung cancer drug is a drug for preventing and / or treating non-small cell lung cancer.

[0114] In another specific embodiment of the present invention, the method for screening non-small cell lung cancer drugs comprises:

[0115] 1) treating a system expressing and / or containing the CRABP2 with a candidate substance; and setting up a parallel control without treatment with the candidate substance;

[0116] 2) After completing step 1), detecting the expression level of CRABP2 in the system; if the expression level of the protein in the system treated with the candidate substance is significantly reduced compared with the parallel control, the candidate substance can be used as a candidate non-small cell lung cancer drug.

[0117] In another embodiment of the present invention, the system can be a cell system, a subcellular system, a solution system, a tissue system, an organ system or an animal system.

[0118] In another specific embodiment of the present invention, the cells in the cell system may be non-small cell lung cancer cells;

[0119] In another specific embodiment of the present invention, the tissue in the tissue system may be non-small cell lung cancer tissue;

[0120] In another specific embodiment of the present invention, the organ in the organ system may be a lung;

[0121] In another specific embodiment of the present invention, the animal in the animal system may be a non-human mammal, including but not limited to rats, mice, guinea pigs, rabbits, monkeys, gorillas, and the like.

[0122] In another specific embodiment of the present invention, there is provided use of a substance that inhibits the expression level of CRABP2 in preparing a product;

[0123] The functions of the product are any one or more of the following:

[0124] (a1) Inhibit the proliferation of non-small cell lung cancer cells;

[0125] (a2) inhibiting the invasion and / or migration of non-small cell lung cancer cells;

[0126] (a3) inhibiting mitochondrial metabolism in non-small cell lung cancer cells;

[0127] (a4) inhibiting the PGC-1α signaling pathway;

[0128] (a5) inhibiting the growth of non-small cell lung cancer;

[0129] (a6) Prevention and / or treatment of non-small cell lung cancer.

[0130] In another specific embodiment of the present invention, a product is provided, wherein the active ingredient includes a substance that inhibits the expression level of CRABP2; the functions of the product are any one or more of the following:

[0131] (a1) Inhibit the proliferation of non-small cell lung cancer cells;

[0132] (a2) inhibiting the invasion and / or migration of non-small cell lung cancer cells;

[0133] (a3) inhibiting mitochondrial metabolism in non-small cell lung cancer cells;

[0134] (a4) inhibiting the PGC-1α signaling pathway;

[0135] (a5) inhibiting the growth of non-small cell lung cancer;

[0136] (a6) Prevention and / or treatment of non-small cell lung cancer.

[0137] In another specific embodiment of the present invention, the substance that inhibits the expression level of CRABP2 can be an interfering molecule that takes the above-mentioned CRABP2 as the target sequence and can inhibit the expression of the CRABP2, and can specifically include an shRNA (small hairpin RNA) sequence of GAAATGGGAGAGTGAGAATAA or TCAAACAGGAGGGAGACACTT; the overexpression sequence can also include a compound small molecule inhibitor.

[0138] In another specific embodiment of the present invention, the above-mentioned product can be a medicine or a test reagent, and the test reagent can be used for basic research.

[0139] When the product is a drug, the drug may further include a pharmaceutically acceptable carrier, which may be a buffer, an emulsifier, a suspending agent, a stabilizer, a preservative, an excipient, a filler, a coagulant and a conditioning agent, a surfactant, a dispersant or a defoaming agent.

[0140] The drug may also include a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier may be a virus, a microcapsule, a liposome, a nanoparticle or a polymer and any combination thereof. The delivery vehicle of the pharmaceutically acceptable carrier may be a liposome, a biocompatible polymer (including a natural polymer and a synthetic polymer), a lipoprotein, a polypeptide, a polysaccharide, a lipopolysaccharide, an artificial viral envelope, an inorganic (including metal) particle, and a bacterial or viral (e.g., baculovirus, adenovirus, and retrovirus), a bacteriophage, a cosmid, or a plasmid vector.

[0141] The drug can also be used in combination with other drugs for preventing and / or treating non-small cell lung cancer. Other preventive and / or therapeutic compounds can be administered simultaneously with the main active ingredient, or even administered simultaneously in the same composition.

[0142] The medicine can also be administered separately to other preventive and / or therapeutic compounds in a separate composition or in a dosage form different from the main active ingredient. Partial doses of the main ingredient can be administered simultaneously with other therapeutic compounds, while other doses can be administered separately. In the course of treatment, the dosage of the medicine of the present invention can be adjusted according to the severity of the symptoms, the frequency of recurrence and the physiological response of the treatment regimen.

[0143] The medicine of the present invention can be applied to the body by known means. For example, it can be delivered to the tissue of interest by intravenous systemic delivery or local injection. It can be applied optionally via intravenous, percutaneous, intranasal, mucosal or other delivery methods. Such application can be carried out via single dose or multiple doses. It will be appreciated by those skilled in the art that the actual dose to be applied in the present invention can vary depending on various factors to a great extent, such as target cells, biological types or their tissues, the general condition of the subject to be treated, the route of administration, the mode of administration, etc.

[0144] In another specific embodiment of the present invention, a method for treating non-small cell lung cancer is provided, the method comprising: administering the above-mentioned substance that inhibits the expression level of CRABP2 to a subject.

[0145] The present invention is further explained by the following examples, but they are not intended to limit the present invention. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention.

Claims

1. Use of a CRABP2 inhibitor in the preparation of a drug for treating non-small cell lung cancer, wherein the inhibitor is shRNA, and the shRNA consists of SEQ ID No. 1 or SEQ ID No. 2.

Images