Composition, detection reagent, kit, application and detection method

Abstract

The present invention relates to the field of biological detection, and in particular to compositions, detection reagents, kits, applications and detection methods. The present invention provides a composition, including: RNA aptamers, scaffold RNA, Cas12a protein, DNA probe and cDNA; the sequence of the RNA aptamer is partially or completely complementary to the sequence of the cDNA; the sequence of the scaffold RNA has a sequence as shown in SEQ ID NO: 1; the sequence of the DNA probe has a sequence as shown in SEQ ID NO: 2; the RNA aptamer specifically recognizes antibiotics. The present invention provides a composition, a detection reagent, a kit, an application and a detection method, which can sensitively and specifically identify antibiotics in different environments, and does not require expensive instruments and equipment, which is of great significance for strengthening the supervision of the use of antibiotics.

Description

Technical Field

[0001] The present invention relates to the field of biological detection, and in particular to a composition, a detection reagent, a kit, an application and a detection method. Background Art

[0002] Antibiotics have bacteriostatic or bactericidal effects and are often used in medicine, agriculture and animal husbandry. However, with the widespread use of antibiotics, antibiotic residues have gradually caused environmental pollution, causing considerable harm to ecosystems and human health. Therefore, the World Health Organization has put forward the requirement of "raising global awareness of the problem of antibiotic resistance" and encouraged the public, health workers and policy makers to adopt best practices to avoid the continued occurrence and expansion of antibiotic resistance. In addition, accurate and reliable detection of antibiotics in ecosystems is also necessary. Traditional antibiotic detection usually includes chromatography / mass spectrometry, microbial detection, and enzyme-linked immunosorbent assay. The detection method based on chromatography / mass spectrometry has a fast detection speed, but the detection cost is expensive and the operation is more complicated; although the microbial detection method has a high sensitivity, its operation is cumbersome and the measurement time is long; although the enzyme-linked immunosorbent assay has been commercialized, it still has problems such as long detection time. Therefore, it is very important to establish a fast, simple and accurate method for antibiotic detection.

[0003] Specific detection is a necessary condition for antibiotic detection methods, which greatly affects the feasibility and practicality of the detection methods. Antibiotic detection usually utilizes antigen-antibody interaction or enzyme biorecognition, but these probes are easily disturbed by the external environment, thus affecting their stability. Aptamers are a new type of biomolecular recognition element, which is essentially artificially screened single-stranded DNA or RNA. Aptamers bind to targets through hydrophobic and electrostatic interactions, hydrogen bonds, and base stacking, and have the advantages of stability, low cost, and high specificity.

[0004] As a new type of gene editing tool, the CRISPR / Cas system was originally discovered in bacteria and archaea as an immune means to combat foreign viral invasion. The CRISPR / Cas system has broad application prospects in the fields of molecular diagnosis, genetic diagnosis of genetic diseases, etc. due to its advantages such as easy operation, accuracy, and programmability. Among them, Cas12a has become a widely used programmable biosensor due to its specificity and user-friendliness in targeting nucleic acids. Cas12a works by guiding CRISPRRNA (crRNA), guiding it to a specific double-stranded DNA (dsDNA) or single-stranded DNA (ssDNA) sequence. This interaction forms a ternary complex and activates the Cas12a-crRNA system. Subsequently, the activated Cas12a indiscriminately cuts nonspecific ssDNA, separating the fluorophore and quencher modified at both ends of the ssDNA and releasing a fluorescent signal. The significant increase in the fluorescent signal makes it possible to identify the target. In addition to the fluorescent signal output, the Cas12a-crRNA system can also be used for other signal outputs, such as electrochemistry, colorimetry, or test strips.

[0005] The Cas12a-crRNA system reported so far generally targets dsDNA or ssDNA, and is rarely used for the detection of non-nucleic acid targets. In general, the use of Cas12a to detect non-nucleic acid substances such as antibiotics requires aptamers as components for identifying the analyte, and converts the target signal of the non-nucleic acid into a nucleic acid signal through a chain displacement reaction, and then detects it using the Cas12a-crRNA system. The main principle of these chain displacement reactions is to design a nucleic acid chain complementary to the aptamer sequence, in which there is a nucleic acid sequence that activates the Cas12a-crRNA system. Therefore, when the analyte exists, the aptamer binds to the analyte, and the nucleic acid chain complementary to the aptamer is exposed, thereby activating the Cas12a-crRNA system. The activated Cas12a can cut the ssDNA probe, read the signal by electrochemistry or fluorescence, and thus realize the detection of the analyte. However, these methods all have certain limitations: 1. One crRNA can only realize the recognition of one analyte, and changing the analyte requires redesigning the crRNA, which makes the experimental cycle and cost higher. 2. The upstream chain displacement reaction in the scheme may have background leakage, and the reaction conditions need to be continuously optimized. Summary of the invention

[0006] In view of this, the present invention provides compositions, detection reagents, kits, applications and detection methods. The present invention overcomes the defects and deficiencies of existing antibiotic detection technologies based on Cas12a, and provides a highly specific, user-friendly antibiotic detection method based on Cas12a. The detection method established by the present invention can sensitively and specifically identify antibiotics in different environments, and does not require expensive instruments and equipment, which is of great significance for strengthening the supervision of the use of antibiotics.

[0007] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0008] The present invention provides a composition comprising: an RNA aptamer, a scaffold RNA, a Cas12a protein, a DNA probe and a cDNA;

[0009] The sequence of the RNA aptamer is partially or completely complementary to the sequence of the cDNA;

[0010] The sequence of the scaffold RNA has: a sequence as shown in SEQ ID NO: 1;

[0011] The sequence of the DNA probe has: the sequence shown in SEQ ID NO: 2;

[0012] The RNA aptamer specifically recognizes the antibiotic.

[0013] In some embodiments of the present invention, in the above-mentioned composition, the Cas12a protein is derived from NEW ENGLANDBiolabs M0653.

[0014] In some embodiments of the present invention, in the above composition, the RNA aptamer has a sequence as shown in SEQ ID NO: 3 or SEQ ID NO: 4.

[0015] In some embodiments of the present invention, in the above composition, the length of the cDNA is 17 to 27 bp.

[0016] In some embodiments of the present invention, in the above-mentioned composition, the molar ratio of the RNA aptamer, the scaffold RNA, the Cas12a protein, the DNA probe and the cDNA is: (0.5~5): (0.25~2.5): (0.25~0.5): (0.1~0.5): (0.1~1).

[0017] In some embodiments of the present invention, in the above-mentioned composition, the molar ratio of the RNA aptamer, the scaffold RNA, the Cas12a protein, the DNA probe and the cDNA is: 1:1:0.5:0.5:1.

[0018] The present invention also provides a detection reagent, including: the above composition.

[0019] In some embodiments of the present invention, the above-mentioned detection reagent comprises: detection reagent 1 and detection reagent 2;

[0020] The detection reagent 1 includes: 5 μM DNA probe, 0.25-2.5 μM RNA aptamer and buffer;

[0021] The detection reagent 2 includes: 0.25~0.5 μM Cas12a, 0.5~5 μM scaffold RNA, 0.1~1 μM cDNA and buffer.

[0022] In some embodiments of the present invention, the above-mentioned detection reagent comprises: detection reagent 1 and detection reagent 2;

[0023] The detection reagent 1 includes: 5 μM DNA probe, 1 μM RNA aptamer and buffer;

[0024] The detection reagent 2 includes: 0.5 μM Cas12a, 1 μM scaffold RNA, 1 μM cDNA and buffer.

[0025] In some embodiments of the present invention, in the above detection reagent, the buffer comprises: 500 mM NaCl, 100 mM Tris-HCl, 100 mM MgCl2 and 1000 μg / mL recombinant albumin.

[0026] In some embodiments of the present invention, in the above detection reagent, the buffer solution is purchased from: NEW ENGLAND Biolabs B6002.

[0027] The present invention also provides a detection kit, comprising: the above composition and / or the above detection reagent.

[0028] The present invention also provides the use of the above composition, the above detection reagent and / or the above detection kit in detecting antibiotics.

[0029] In some embodiments of the present invention, in the above application, the antibiotics include: tobramycin and / or kanamycin.

[0030] The present invention also provides a method for detecting antibiotics, wherein the detection reagent 1 in the above detection reagent is mixed with the antibiotic to be detected, incubated, and then mixed with the detection reagent 2 to react, and the content of the antibiotic is detected according to the fluorescence intensity.

[0031] In some embodiments of the present invention, in the above detection method, the incubation temperature is 25-37° C. and the time is 5-30 min.

[0032] In some embodiments of the present invention, in the above detection method, the incubation temperature is 25° C. and the time is 30 min.

[0033] The present invention provides a composition comprising: an RNA aptamer, a scaffold RNA, a Cas12a protein, a DNA probe and a cDNA;

[0034] The sequence of the RNA aptamer is partially or completely complementary to the sequence of the cDNA;

[0035] The sequence of the scaffold RNA has: a sequence as shown in SEQ ID NO: 1;

[0036] The sequence of the DNA probe has: the sequence shown in SEQ ID NO:2.

[0037] The detection system provided by the present invention can detect a variety of antibiotics by changing the aptamer and its complementary DNA sequence, without the need for complex crRNA screening and optimization, and has universal applicability; it realizes direct antibiotic detection using the CRISPR / Cas12a system, without the need for other signal transduction methods, and is simple to operate. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art are briefly introduced below.

[0039] Figure 1 The schematic diagram of the experimental process of the present invention is shown; when the target does not exist, the three oligonucleotide chains of scaffold RNA, RNA aptamer and cDNA complementary to the RNA aptamer bind to the Cas12a protein to form a complete Cas12a system, activate the cutting activity of Cas12a, and realize the trans cutting of the non-target single-stranded DNA probe, thereby generating a fluorescent signal; when the target exists, the target specifically binds to the RNA aptamer, so that the Cas12a system is no longer complete and cannot generate a fluorescent signal;

[0040] Figure 2The figure shows the effect of different concentrations of tobramycin on the fluorescence generation rate. As the concentration of tobramycin increases, the fluorescence generation rate decreases.

[0041] Figure 3 The results showed that the method had a good specific response to tobramycin in nuclease-free water; only when the target was tobramycin, the fluorescence growth rate decreased significantly, while when the target was other antibiotics (such as chloramphenicol, ampicillin and spectinomycin), the fluorescence growth rate was basically the same as that of the blank control group;

[0042] Figure 4 Figure 2 shows the application of this method in the detection of kanamycin; A shows the effect of different concentrations of kanamycin on fluorescence intensity; as the concentration of kanamycin increases, the fluorescence value gradually decreases; B shows that this method has a good specific response to kanamycin. Only when the target is kanamycin, the fluorescence intensity decreases significantly, while when the target is other antibiotics (such as chloramphenicol, ampicillin and spectinomycin), the fluorescence intensity is basically the same as that of the blank control group;

[0043] Figure 5 The figure shows the practicality of this method in real water samples; A shows that in tap water samples, this method can achieve specific detection of tobramycin. Only when the target is tobramycin, the fluorescence growth rate decreases significantly, and when the target is other antibiotics (such as chloramphenicol, ampicillin and spectinomycin), the fluorescence growth rate is basically the same as that of the blank control group; the table on the right marks the specific values ​​in the bar graph on the left; B shows that in lake water samples, this method can achieve specific detection of tobramycin. Only when the target is tobramycin, the fluorescence growth rate decreases significantly, and when the target is other antibiotics (such as chloramphenicol, ampicillin and spectinomycin), the fluorescence growth rate is basically the same as that of the blank control group. The table on the right marks the specific values ​​in the bar graph on the left;

[0044] Figure 6 The results of optimizing the length of cDNA for tobramycin detection are shown in the figure. It can be seen from the figure that sc-5'-6 has the best reaction effect.

[0045] Figure 7 The figures show the detection results of tobramycin by this method before and after optimization; wherein: A shows the detection results of tobramycin before optimization; B shows the detection results of tobramycin after optimization. DETAILED DESCRIPTION

[0046] The invention discloses a composition, a detection reagent, a kit, an application and a detection method.

[0047] It should be understood that the expression "one or more of..." includes each of the items recited after the expression individually and in various different combinations of two or more of the recited items, unless otherwise understood from the context and usage. The expression "and / or" in combination with three or more recited items should be understood to have the same meaning, unless otherwise understood from the context.

[0048] The use of the terms "comprising", "having" or "containing", including their grammatical synonyms, should generally be understood as open and non-restrictive, for example not excluding other unrecited elements or steps, unless otherwise specifically stated or otherwise understood from the context.

[0049] It should be understood that the order of steps or the order in which certain actions are performed is not important as long as the present invention remains operable. In addition, two or more steps or actions may be performed simultaneously.

[0050] The use of any and all examples or exemplary language, such as "for example" or "including", herein is intended only to better illustrate the invention and does not limit the scope of the invention unless otherwise claimed. No language in this specification should be construed as indicating that any non-claimed element is essential to the practice of the invention.

[0051] In addition, the numerical ranges and parameters used to define the present invention are approximate values, and the relevant values ​​in the specific embodiments have been presented as accurately as possible. However, any numerical value inherently inevitably contains standard deviations due to individual test methods. Therefore, unless otherwise expressly stated, it should be understood that all ranges, quantities, values ​​and percentages used in this disclosure are modified by "about". Here, "about" generally means that the actual value is within plus or minus 10%, 5%, 1% or 0.5% of a specific value or range.

[0052] The present invention designs an antibiotic detection method based on the CRISPR / Cas12a system. Figure 1As shown in the figure, when there is no antibiotic present, the RNA aptamer and scaffold RNA together with the Cas12a protein form a complex to form a complete Cas12a / split-crRNA complex, which activates the cleavage activity of the Cas12a protein on the non-target single-stranded DNA probe (ssDNA reporter) by binding to the DNA sequence (cDNA) complementary to the aptamer. After the single-stranded DNA probe is cut, the fluorescent group (FAM) and the quencher group (quencher) modified at both ends are separated to generate a fluorescent signal. When antibiotics are present, they can bind to RNA aptamers (aptamers), and the Cas12a / split-crRNA complex is no longer complete, so the cleavage activity of the Cas12a protein cannot be activated. Antibiotics can be specifically detected by fluorescence intensity or fluorescence generation rate.

[0053] The scaffold RNA sequence used in the present invention is:

[0054] 5'-UAAUUUCUACUAAGUGUAGAU (as shown in SEQ ID NO: 1);

[0055] The single-stranded DNA probe sequence used in the present invention is:

[0056] 5' BHQ1-TTATTTTATTTTATT-6'FAM3' (as shown in SEQ ID NO: 2);

[0057] In Examples 1 to 2 and Verification Examples 1 to 3 of the present invention, all the raw materials and reagents used can be purchased from the market.

[0058] The present invention will be further described below in conjunction with embodiments:

[0059] Example 1

[0060] The present invention is used to carry out specific detection of tobramycin.

[0061] First, the mixed solution 1 was incubated at 25°C for 30 min. The mixed solution 1 is shown in Table 1: 2.5 μL of nuclease-free water, 1 μL of single-stranded DNA probe (5 μM), 1 μL of RNA aptamer (10 μM), 0.1 μL of buffer (500 mM NaCl, 100 mM Tris-HCl, 100 mM MgCl2, 1000 μg / mL recombinant albumin), 2.5 μL of antibiotic samples with different concentrations, a total of 7.1 μL of mixed solution.

[0062] After incubation, add 1 μL cDNA (10 μM) and mixed solution 2, and the total reaction system is 10 μL. Mixed solution 2 is as follows: 0.5 μL Cas12a (10 μM), 0.5 μL scaffold RNA (20 μM), 0.9 μL buffer (500 mM NaCl, 100 mM Tris-HCl, 100 mM MgCl2, 1000 μg / mL recombinant albumin). The configured reaction system is reacted at 25°C for 2 hours, and the fluorescence intensity is recorded in real time using Cytion 5 to calculate its fluorescence enhancement rate.

[0063] The total reaction system was as follows: 500 nM single-stranded DNA probe, 1 μM RNA aptamer, 1 μM cDNA, 500 nMCas12a, 1 μM scaffold RNA, buffer (50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 100 μg / mL recombinant albumin) and different concentrations of antibiotic samples.

[0064] The RNA aptamer sequence is: GGCACGAGGUUUAGCUACACUCGUGCC (as shown in SEQ ID NO: 3);

[0065] The cDNA sequence is: AGTGTAGCTAAACCTCGTGCC; (as shown in SEQ ID NO: 5).

[0066] Table 1 Mixture 1

[0067]

[0068] Table 2 Mixture 2

[0069]

[0070] Table 3

[0071]

[0072] Table 4

[0073]

[0074] Figure 2 Table 3 shows the relative intensity of the fluorescence generation rate under different tobramycin concentrations. In the method of the present invention, the fluorescence generation rate decreases with the increase of tobramycin concentration, and the minimum detection value is 0.2 μM. The present invention has high specificity.

[0075] like Figure 3As shown in Table 4, when equal concentrations of ampicillin, chloramphenicol and spectinomycin were added to the system, no obvious fluorescence decrease was caused, and there was no significant difference with the negative control group.

[0076] Example 2

[0077] The kanamycin detection protocol is as follows: first, incubate the mixed solution 1 at 25°C for 30 min.

[0078] Mixture 1 is as follows: 5 μL nuclease-free water, 1 μL single-stranded DNA probe (5 μM), 1 μL RNA aptamer (10 μM), 0.1 μL buffer (500 mM NaCl, 100 mM Tris-HCl, 100 mM MgCl2, 1000 μg / mL recombinant albumin), a total of 7.1 μL mixed solution. After incubation, add 1 μL cDNA (10 μM) and mixture 2, the total reaction system is 10 μL.

[0079] Mixture 2 was as follows: 0.5 μL Cas12a (5 μM), 0.5 μL scaffold RNA (10 μM), 0.9 μL buffer (500 mM NaCl, 100 mM Tris-HCl, 100 mM MgCl2, 1000 μg / mL recombinant albumin). The prepared reaction system was reacted at 30°C for 2 hours, and the fluorescence intensity was recorded in real time using Cytion 5.

[0080] The RNA aptamer sequence is: 5'-CGCGAGUGGGCGAUGCAACCAUGCGC-3' (as shown in SEQ ID NO: 4);

[0081] The cDNA sequence is: 5′-TGGTTGCATCGCCCACTCGCG-3′ (as shown in SEQ ID NO: 6);

[0082] The experimental results are as follows Figure 4 shown.

[0083] Verification Example 1

[0084] To demonstrate the practicality of the method of Example 1, we used it to specifically detect tobramycin in two environmental samples. We added the same concentration of antibiotics to filtered tap water samples and then analyzed them using this method. In the tap water samples, the results were consistent with those obtained using nuclease-free water, showing relatively high specificity ( Figure 5 A). Similar results were observed in filtered lake water samples ( Figure 5B). The proposed method showed specific detection of tobramycin in both tap water and lake water samples, demonstrating its robustness and utility for the analysis of antibiotics in environmental samples.

[0085] Table 5

[0086]

[0087] Table 5 corresponds to Figure 5 The data of A.

[0088] Table 6

[0089]

[0090] Table 6 corresponds to Figure 5 The data of B.

[0091] Verification Example 2 Design and length selection of DNA sequence complementary to aptamer

[0092] As shown in Table 7, the cDNA that is completely complementary to the RNA aptamer is recorded as fcDNA-TOB, and the remaining cDNAs are obtained by truncating fcDNA with different base numbers, and are recorded as sc-TOB-5'-x or sc-TOB-3'-x, where 5' and 3' represent truncated fcDNA from the 5' or 3' end, and x represents the number of truncated bases. The specific steps are:

[0093] First, incubate the mixture 1 at 25°C for 30 minutes. The mixture 1 is shown in Table 1. After the incubation is completed, add 1 μL of cDNA of different lengths (10 μM) and mixture 2, and the total reaction system is 10 μL. Mixture 2 is as follows: 0.5 μL Cas12a (5 μM), 0.5 μL scaffold RNA (10 μM), 0.9 μL buffer (500 mM NaCl, 100 mM Tris-HCl, 100 mMMgCl2, 1000 μg / mL recombinant albumin). The prepared reaction system is reacted at 25°C for 2 hours, and the fluorescence intensity is recorded in real time using Cytion 5 to calculate its fluorescence enhancement rate.

[0094] Table 7 cDNA sequences

[0095]

[0096] Experimental data and statistical results are shown in Figure 6 : X in the abscissa sc-TOB-5'-X and / or sc-TOB-3'-X represents a number 1-10. Figure 6The left figure shows the statistical results of the fluorescence rate of the reactions when 11 sequences, including fcDNA TOB, sc-TOB-5'-1, sc-TOB-5'-2, ... and sc-TOB-5'-10 (SEQ ID NO: 7-16), were used as cDNA; Figure 6 The right figure shows the statistical results of the fluorescence rate of the reaction when 11 sequences, fcDNA TOB, sc-TOB-3'-1, sc-TOB-3'-2, ... and sc-TOB-3'-10 (SEQ ID NO:7, SEQ ID NO:17-26), were used as cDNA. Comparing the fluorescence rates, it can be seen that when sc-TOB-5'-6 is used as cDNA, the reaction rate is much faster than fcDNA-TOB or other truncated cDNAs.

[0097] Verification Example 3

[0098] The results of different concentrations of TOB detection before and after optimization are as follows Figure 7 shown. Figure 7 A is the experimental result before optimization. Figure 7 B is the experimental result after optimization.

[0099] Experimental steps before optimization: Mix the final concentration of 1 μM RNA aptamer, 500 nM non-target single-stranded DNA probe, 500 nM cDNA, 200 nM Cas12a, and 500 nM scaffold RNA in a buffer (50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 100 μg / mL recombinant albumin), react at 25°C for 2 h, and use Cytion 5 to record the fluorescence intensity in real time.

[0100] The optimized conditions include whether the RNA aptamer is incubated with the target and the incubation temperature, and the concentrations of the RNA aptamer, cDNA, Cas12a, and scaffold RNA.

[0101] Table 8

[0102]

[0103] Table 9

[0104]

[0105] Table 9 Figure 7 A corresponds to the value in Table 8. Figure 7 The conditions of A; Figure 7 B corresponds to the Figure 7 The condition of B.

[0106] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A composition, characterized in that include: RNA aptamers, scaffold RNA, Cas12a protein, DNA probes and cDNA; The sequence of the RNA aptamer is partially or completely complementary to the sequence of the cDNA; The sequence of the scaffold RNA has: a sequence as shown in SEQ ID NO: 1; The sequence of the DNA probe has: the sequence shown in SEQ ID NO: 2; The RNA aptamer specifically recognizes the antibiotic.

2. The composition according to claim 1, characterized in that The length of the cDNA is 17-27 bp.

3. The composition according to claim 1, characterized in that The molar ratio of the RNA aptamer, the scaffold RNA, the Cas12a protein, the DNA probe and the cDNA is: (0.5~5): (0.25~2.5): (0.25~0.5): (0.1~0.5): (0.1~1).

4. A detection reagent, characterized in that: include: The composition according to any one of claims 1 to 3.

5. The detection reagent according to claim 4, characterized in that include: Detection reagent 1 and detection reagent 2; The detection reagent 1 includes: 5 μM DNA probe, 0.5-5 μM RNA aptamer and buffer; The detection reagent 2 includes: 0.25~0.5 μM Cas12a, 0.25~5 μM scaffold RNA, 0.1~1 μM cDNA and buffer.

6. The detection reagent according to claim 5, characterized in that The buffer comprises: 500 mM NaCl, 100 mM Tris-HCl, 100 mM MgCl2 and 1000 μg / mL recombinant albumin.

7. A detection kit, characterized in that: include: The composition according to any one of claims 1 to 3 or the detection reagent according to any one of claims 4 to 6.

8. Use of the composition according to any one of claims 1 to 3, the detection reagent according to any one of claims 4 to 6, or the detection kit according to claim 7 in detecting antibiotics.

9. A method for detecting antibiotics, characterized in that: The detection reagent 1 in the detection reagent as claimed in claim 6 is mixed with the antibiotic to be detected, incubated, and then mixed with the detection reagent 2 to react, and the content of the antibiotic is detected according to the fluorescence intensity.

10. The detection method according to claim 9, characterized in that: The incubation temperature is 25-37° C. and the incubation time is 5-30 min.

Images