Liver-targeted small nucleic acid drug carrier, medicinal composition, and preparation method and application of liver-targeted small nucleic acid drug carrier

Abstract

The invention provides a liver targeting small nucleic acid drug carrier, a pharmaceutical composition and a preparation method and application thereof, and belongs to the technical field of biological drugs. The liver-targeted small nucleic acid drug carrier comprises N-acetylgalactosamine (GalNAc), a small nucleic acid drug for treating hepatocellular carcinoma and a cell-penetrating peptide which are connected in sequence, the cell-penetrating peptide comprises at least one of the following components: TP10 cell-penetrating peptide, iRGD polypeptide, cell-penetrating peptide TPP and cRGD polypeptide. The drug carrier has good nuclease stability and can protect nucleic acid from being degraded by enzyme. Experimental results show that compared with naked small nucleic acid and GalNAc-nucleic acid conjugates, the liver-targeted small nucleic acid drug carrier can be more ingested by HepG2 cells, has stronger capability of silencing tumor-related genes, and can realize efficient treatment of hepatocellular carcinoma (HCC).

Description

Technical Field

[0001] The present invention belongs to the technical field of biopharmaceuticals, and in particular relates to a liver-targeted small nucleic acid drug carrier, a pharmaceutical composition, and a preparation method and application thereof. Background Art

[0002] Hepatocellular carcinoma (HCC) is the main form of primary liver cancer. It is extremely difficult to cure and is the second most lethal cancer in the world. Surgical resection and chemotherapy are commonly used treatments for HCC, but surgical resection is only suitable for patients with early HCC, and it is easy to relapse after surgery. Sorafenib is a first-line small molecule chemotherapy drug, but about 2 / 3 of patients show obvious resistance to sorafenib, and it has great toxic side effects. Therefore, rational gene therapy based on the genomic and epigenetic characteristics of the tumor will be the key to treating HCC.

[0003] In recent years, nucleic acid drugs such as small interfering RNA (siRNA), microRNA (miRNA), antisense oligonucleotides (ASOs), and short hairpin RNA (shRNA) have received extensive attention. Unlike traditional small molecule chemical drugs and antibody drugs that exert pharmacological effects at the protein level, nucleic acid drugs highly rely on the principle of base complementary pairing to participate in gene transcription and translation. They can efficiently and specifically regulate pathogenic target genes, improve efficacy while reducing toxic side effects, and are very advantageous in the treatment of genetic diseases, tumors, metabolic diseases, and rare diseases. A variety of nucleic acids have shown great potential in the treatment of HCC. microRNA-199a-3p is a miRNA that can inhibit tumor growth, migration, invasion, and angiogenesis in HCC by regulating the mechanistic target of rapamycin (mTOR) and p21-activated kinase 4 (PAK4) pathways. PLK1 (Polo-like Kinase 1) belongs to the Polo-like kinase family and is a type of serine / threonine kinase widely present in eukaryotic cells. If the expression of PLK1 kinase is interfered with, it will affect the proliferation and division of cancer cells, thereby inducing apoptosis of cancer cells. Therefore, PLK1-siRNA (siPLK1) has a therapeutic effect on HCC. In addition, VEGF siRNA (siVEGF) can inhibit tumor growth by inhibiting the formation of tumor angiogenesis. In addition, STAT3-ASO is an antisense oligonucleotide targeting STAT3 and also has potential anti-tumor activity. STAT3 is a cancer driver and tumor microenvironment regulator. ASO can bind to STAT3 mRNA to inhibit the expression of STAT3, thereby inducing tumor cell apoptosis and inhibiting tumor cell growth.

[0004] Although these nucleic acid drugs are expected to treat HCC, they are unstable and easily degraded by nucleases in the body, and they are negatively charged and difficult to be taken up by cells. At present, drug delivery vectors are mainly used to solve the problems existing in the nucleic acid delivery process. Commonly used delivery vectors such as viruses, liposomes, nanoparticles, and micelles all have some common problems, either high toxicity or low delivery efficiency, and the delivery also lacks targeting. Conjugated nucleic acid drugs mainly use N-acetylgalactosamine (GalNAc) as a carrier, which is also the most widely used liver-targeted delivery vector. GalNAc is a high-affinity ligand of the hepatocyte-specific asialoglycoprotein receptor (ASGPR), so GalNAc nucleic acid conjugates can bind to the ASGPR on hepatocytes and be rapidly internalized, thereby achieving targeted entry of nucleic acids into cells. However, the ASGPR receptor is more expressed on normal hepatocytes and relatively less expressed on liver cancer cells. Therefore, for the treatment of HCC, GalNAc-nucleic acid conjugates need to be further coupled with substances with endocytic effects to improve the endocytic ability. Summary of the invention

[0005] In view of this, the purpose of the present invention is to provide a liver-targeted small nucleic acid drug carrier, which greatly improves the delivery efficiency of nucleic acids and enhances the intracellular entry of liver-targeted small nucleic acid drug carriers by coupling a cell-penetrating peptide with an N-acetylgalactosamine (GalNAc) carrier and a small molecule nucleic acid drug, thereby achieving efficient treatment of hepatocellular carcinoma.

[0006] The present invention provides a liver-targeted small nucleic acid drug carrier, comprising N-acetylgalactosamine, a small nucleic acid drug for treating hepatocellular carcinoma and a cell-penetrating peptide connected in sequence;

[0007] The cell-penetrating peptide comprises at least one of the following: TP10 cell-penetrating peptide, iRGD polypeptide, cell-penetrating peptide TPP and cRGD polypeptide.

[0008] Preferably, the amino acid sequences of the TP10 membrane-penetrating peptide, iRGD polypeptide, cell-penetrating peptide TPP and cRGD polypeptide are shown in SEQ ID NO: 1 to SEQ ID NO: 4.

[0009] Preferably, the small nucleic acid drug for treating hepatocellular carcinoma comprises at least one of the following: microRNA-199a, siRNA targeting PLK1 gene, siRNA targeting VEGF gene and STAT3 antisense oligonucleotide.

[0010] Preferably, the nucleotide sequences of the microRNA-199a, the siRNA targeting the PLK1 gene, the siRNA targeting the VEGF gene and the STAT3 antisense oligonucleotide are shown in SEQ ID NO: 5 to SEQ ID NO: 11.

[0011] Preferably, the small nucleic acid drug for treating hepatocellular carcinoma comprises a backbone having at least one of the following modifications: 2′-fluoro nucleotide modification, 2′-O-methyl modification, 2′-O-methoxyethyl modification, locked nucleic acid modification, restricted ethyl bridge nucleic acid modification, 5′-vinyl phosphonate modification, and replacement of phosphodiester bond with thiophosphate bond.

[0012] Preferably, the connection method of the small nucleic acid drug for treating hepatocellular carcinoma and the cell-penetrating peptide includes connection through a thiol-maleimide covalent bond.

[0013] The present invention provides a method for preparing the liver-targeted small nucleic acid drug carrier, comprising the following steps:

[0014] Using N-acetylgalactosamine as a carrier, a single-chain small nucleic acid drug for treating hepatocellular carcinoma is synthesized by gene synthesis to obtain an N-acetylgalactosamine-nucleic acid single-chain conjugate;

[0015] The N-acetylgalactosamine-nucleic acid single-chain conjugate and the cell-penetrating peptide are linked by thiol-maleimide covalent bonds to obtain an N-acetylgalactosamine-nucleic acid single-chain-cell-penetrating peptide conjugate;

[0016] The N-acetylgalactosamine-nucleic acid single chain-membrane-penetrating peptide conjugate is annealed and hybridized with another chain of a small nucleic acid drug for treating hepatocellular carcinoma to obtain a liver-targeted small nucleic acid drug carrier.

[0017] Preferably, the thiol-maleimide covalent bond connection method comprises chemically reacting the thiol group of the nucleic acid single chain in the N-acetylgalactosamine-nucleic acid single chain conjugate with the cell-penetrating peptide modified with maleimide, or chemically reacting the thiol group on the cell-penetrating peptide with the N-acetylgalactosamine-nucleic acid single chain conjugate in which the nucleic acid single chain is modified with maleimide;

[0018] The molar ratio of the N-acetylgalactosamine-nucleic acid single-strand conjugate to the cell-penetrating peptide is 1:(5-30);

[0019] The chemical reaction time is 2 to 24 hours.

[0020] The present invention provides a drug for preventing and / or treating hepatocellular carcinoma, wherein the active ingredients include the liver-targeted small nucleic acid drug carrier or the liver-targeted small nucleic acid drug carrier prepared by the preparation method and pharmaceutically acceptable excipients.

[0021] The present invention provides use of the liver-targeted small nucleic acid drug carrier or the liver-targeted small nucleic acid drug carrier prepared by the preparation method in preparing a drug for preventing and / or treating hepatocellular carcinoma.

[0022] The present invention provides a liver-targeted small nucleic acid drug carrier, comprising N-acetylgalactosamine, a small nucleic acid drug for treating hepatocellular carcinoma and a membrane-penetrating peptide connected in sequence; the membrane-penetrating peptide comprises at least one of the following: TP10 membrane-penetrating peptide, iRGD polypeptide, cell-penetrating peptide TPP and cRGD polypeptide. The addition of the membrane-penetrating peptide of the present invention is conducive to promoting the endocytosis of N-acetylgalactosamine-small nucleic acid drug conjugate by cells, improving the delivery efficiency of nucleic acids, and thus better playing an anti-tumor role. At the same time, the liver-targeted small nucleic acid drug carrier has good nuclease stability and can protect nucleic acids from enzyme degradation. Experimental results show that compared with naked small nucleic acid drugs, the connection of N-acetylgalactosamine as a carrier with small nucleic acid drugs can improve the targeting of drug carriers, and the drug carrier formed by connecting membrane-penetrating peptides and N-acetylgalactosamine at the same time has a further better membrane-penetrating effect than naked small nucleic acid drugs and only N-acetylgalactosamine and small nucleic acid drug carriers, and the efficiency of targeting target genes is greatly improved. At the same time, the results of in vivo small animal imaging experiments show that the liver-targeted small nucleic acid drug carrier prepared by the present invention has good liver targeting. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 is the mass spectrum of the positive chain GalNAc-miR-199a-GWTLNS;

[0024] Figure 2 is the mass spectrum of the antisense chain GalNAc-miR-199a-GWTLNS;

[0025] Figure 3 is the mass spectrum of the positive chain GalNAc-siVEGF-CKRRMKWKK;

[0026] Figure 4 is the mass spectrum of the antisense chain GalNAc-siVEGF-CKRRMKWKK;

[0027] Figure 5 is the mass spectrum of GalNAc-STAT3-ASO-cRGD;

[0028] Figure 6 is the mass spectrum of the positive chain GalNAc-siPLK1-iRGD;

[0029] Figure 7 is the mass spectrum of the antisense chain GalNAc-siPLK1-iRGD;

[0030] Figure 8 The diagram is a result of enzyme stability of different GalNAc-nucleic acid-membrane-penetrating peptide conjugates;

[0031] Fig. 9 This is the result diagram of GalNAc-siPLK1-iRGD cellular endocytosis;

[0032] Fig.10 This is the result diagram of GalNAc-miR-199a-GWTLNS cellular endocytosis;

[0033] Fig.11 This is the result diagram of GalNAc-STAT3-ASO-cRGD endocytosis;

[0034] Fig.12 This is the result diagram of the cell endocytosis of GalNAc-siVEGF-CKRRMKWKK;

[0035] Fig.13 The relative expression results of tumor genes in HepG2 cells after transfection with 4 different GalNAc-nucleic acid-membrane-penetrating peptide conjugates; a is the relative expression results of miR-199a and mTOR, b is the relative expression results of siPLK1, c is the relative expression results of STAT3-ASO, and d is the relative expression results of siVEGF;

[0036] Fig.14 The graph shows the fluorescence distribution results of different GalNAc-nucleic acid-membrane-penetrating peptide conjugates in mouse in vitro tissues. DETAILED DESCRIPTION

[0037] The present invention provides a liver-targeted small nucleic acid drug carrier, comprising N-acetylgalactosamine, a small nucleic acid drug for treating hepatocellular carcinoma and a cell-penetrating peptide connected in sequence; the cell-penetrating peptide comprises at least one of the following: TP10 cell-penetrating peptide, iRGD polypeptide, cell-penetrating peptide TPP and cRGD polypeptide, and the specific sequences are shown in Table 1:

[0038] Table 1 Sequences of molecules in liver-targeted small nucleic acid drug carriers of the present invention

[0039]

[0040] In the present invention, the small nucleic acid drug for treating hepatocellular carcinoma preferably includes a backbone having at least one of the following modifications: 2'-fluoronucleotide modification, 2'-O-methyl modification, 2'-O-methoxyethyl modification, locked nucleic acid modification, restricted ethyl bridge nucleic acid modification, 5'-vinyl phosphonate modification, and substitution of phosphodiester bond with thiophosphate bond. The modification is beneficial to improving the stability of the small nucleic acid drug.

[0041] In the present invention, the connection method of the small nucleic acid drug for treating hepatocellular carcinoma and the cell-penetrating peptide preferably includes connection through a thiol-maleimide covalent bond. The present invention has no special restrictions on whether the thiol-linked small nucleic acid drug or the cell-penetrating peptide is connected, and both methods can be used for connection. The function of the cell-penetrating peptide is to improve the efficiency of N-acetylgalactosamine-small nucleic acid drug conjugate entering liver cancer cells, thereby exerting the targeting effect of the small nucleic acid drug, and the ability to silence tumor-related genes is stronger, which is expected to achieve efficient treatment of hepatocellular carcinoma.

[0042] In the present invention, the N-acetylgalactosamine and the small nucleic acid drug for treating hepatocellular carcinoma are connected by a covalent bond, preferably using N-acetylgalactosamine as a carrier, connecting the first nucleotide at the 5' end of the small nucleic acid drug to the carrier, and then synthesizing the N-acetylgalactosamine-small nucleic acid drug conjugate according to the gene synthesis method. The N-acetylgalactosamine, as a carrier, can have a high affinity with the specific asialoglycoprotein receptor (ASGPR) on hepatocytes. The small nucleic acid drug for treating hepatocellular carcinoma exists as a drug active ingredient, targets oncogenes in hepatocellular carcinoma, silences the expression of oncogenes, and thus exerts its efficacy.

[0043] The present invention provides a method for preparing the liver-targeted small nucleic acid drug carrier, comprising the following steps:

[0044] Using N-acetylgalactosamine as a carrier, a single-chain small nucleic acid drug for treating hepatocellular carcinoma is synthesized by gene synthesis to obtain an N-acetylgalactosamine-nucleic acid single-chain conjugate;

[0045] The N-acetylgalactosamine-nucleic acid single-chain conjugate and the cell-penetrating peptide are linked by thiol-maleimide covalent bonds to obtain an N-acetylgalactosamine-nucleic acid single-chain-cell-penetrating peptide conjugate;

[0046] The N-acetylgalactosamine-nucleic acid single chain-membrane-penetrating peptide conjugate is annealed and hybridized with another chain of a small nucleic acid drug for treating hepatocellular carcinoma to obtain a liver-targeted small nucleic acid drug carrier.

[0047] The invention uses N-acetylgalactosamine as a carrier and utilizes a gene synthesis method to synthesize a small nucleic acid drug single chain for treating hepatocellular carcinoma to obtain an N-acetylgalactosamine-nucleic acid single chain conjugate.

[0048] In the present invention, the N-acetylgalactosamine is preferably Universal CPG / GalNAc CPG, purchased from Suzhou Beixin Biotechnology Co., Ltd. The gene synthesis method is preferably completed using a gene synthesizer. The introduction of each base requires four steps of DMTr removal, coupling, oxidation and capping. During gene synthesis, only single-stranded nucleic acids are synthesized.

[0049] After obtaining the N-acetylgalactosamine-nucleic acid single-strand conjugate, the present invention connects the N-acetylgalactosamine-nucleic acid single-strand conjugate and the cell-penetrating peptide through a thiol-maleimide covalent bond to obtain the N-acetylgalactosamine-nucleic acid single-strand-cell-penetrating peptide conjugate.

[0050] In the present invention, the method of thiol-maleimide covalent bond connection preferably includes chemically reacting the thiol of the nucleic acid single chain in the N-acetylgalactosamine-nucleic acid single chain conjugate with the maleimide-modified cell-penetrating peptide or chemically reacting the thiol on the cell-penetrating peptide with the N-acetylgalactosamine-nucleic acid single chain conjugate in which the nucleic acid single chain is modified with maleimide. When the nucleic acid single chain is modified with maleimide, it is preferred that a DMSO solution containing maleimide (MAL) activated ester reacts with the NH2 of the nucleic acid single chain to form a single-stranded nucleic acid modified with maleimide N-acetylgalactosamine. The chemical reaction is to form a SC covalent bond. The molar ratio of the N-acetylgalactosamine-nucleic acid single chain conjugate to the cell-penetrating peptide is preferably 1: (5-30), more preferably 1: (8-25), further preferably 1: (10-20), and most preferably 1: 15. The time of the chemical reaction is preferably 2 to 24 hours, more preferably 6 to 22 hours, further preferably 8 to 20 hours, further preferably 10 to 18 hours, and most preferably 12 hours.

[0051] The present invention provides a drug for preventing and / or treating hepatocellular carcinoma, wherein the active ingredients include the liver-targeted small nucleic acid drug carrier or the liver-targeted small nucleic acid drug carrier prepared by the preparation method and pharmaceutically acceptable excipients.

[0052] In the present invention, the pharmaceutically acceptable excipients preferably include at least one of the following: several or all of a buffer system, a stabilizer, a pH regulator, and an osmotic pressure regulator. In an embodiment of the present invention, the buffer system is one of an acetate buffer, a citrate buffer, a histidine buffer, and a phosphate buffer. The stabilizer is one of sucrose, trehalose, sorbitol, mannitol, sodium chloride, potassium chloride, glycine, methionine, and histidine. The pH regulator is one or more of hydrochloric acid, citric acid, phosphoric acid, sodium hydroxide, potassium hydroxide, sodium bicarbonate, disodium hydrogen phosphate, and sodium dihydrogen phosphate. The osmotic pressure regulator is one of sodium chloride and glucose.

[0053] In the present invention, a pharmaceutical preparation has a formula of: 5 mg / mL of GalNAc-STAT3-ASO-cRGD, 8.6 mg / mL of sodium chloride, 0.63 mg / mL of disodium hydrogen phosphate dihydrate, 0.21 mg / mL of anhydrous sodium dihydrogen phosphate, pH 7.4; or 7.5 mg / mL of GalNAc-siPLK1-iRGD, 8.5 mg / mL of sodium chloride, 0.72 mg / mL of disodium hydrogen phosphate dihydrate, 0.14 mg / mL of anhydrous sodium dihydrogen phosphate, pH 7.4.

[0054] The present invention provides use of the liver-targeted small nucleic acid drug carrier or the liver-targeted small nucleic acid drug carrier prepared by the preparation method in preparing a drug for preventing and / or treating hepatocellular carcinoma.

[0055] In the present invention, the drug for preventing and / or treating hepatocellular carcinoma preferably exhibits good ability to enter cells and good ability to knock out oncogenes in cells and hepatocellular carcinoma cells in vivo.

[0056] The liver-targeted small nucleic acid drug carrier, pharmaceutical composition, preparation method and application thereof provided by the present invention are described in detail below in conjunction with the examples, but they should not be construed as limiting the scope of protection of the present invention.

[0057] Example 1

[0058] Synthesis method of N-acetylgalactosamine-miR-199a-TP10 transmembrane peptide (GalNAc-miR-199a-GWTLNS)

[0059] The miRNA antisense chain sequence to be synthesized (5'-UAACCAAUGUGCAGACUACUGU-3', SEQ ID NO: 6) is introduced into the synthesizer, and Universal CPG / GalNAc is used as a carrier. The synthesis is performed according to the set synthesis program. The introduction of each base requires four steps of DMTr removal, coupling, oxidation and capping. After the synthesis is completed, the carrier is removed and blown dry, and concentrated ammonia is used for deprotection. After the reaction is completed, it is concentrated and then purified by RP-HPLC. The purified and collected fractions are subjected to HPLC, MS and UV detection. The qualified fractions are collected and freeze-dried to obtain GalNAc-miRNA-SH single strands.

[0060] The maleimide-modified TP10 transmembrane peptide (GWTLNS-MAL, equivalent 20, solvent: DMSO) was weighed, dissolved and added to GalNAc-miRNA-SH (solvent: DMSO), and an appropriate amount of carbonate solution was added to adjust the pH to 7, reacted at room temperature for 12 hours, and then the crude product was detected and purified to obtain the target single strand. In order to produce double-stranded miRNA, the target single strand was mixed with another strand (5'-ACAGUAGUCUGCACAUUGGUUA-3', SEQ ID NO: 5) in an annealing buffer at a molar ratio of 1:1, heat denatured at 90°C for 5 minutes, then slowly cooled to 20°C, and finally the solution was lyophilized to obtain the miRNA double strand.

[0061] The final product was detected and characterized by LC-MS, as shown in Tables 2 to 4.

[0062] Table 2 RP-HPLC purity test conditions

[0063]

[0064]

[0065] Table 3 RP-HPLC mobile phase gradient ratio status

[0066] Time (min) Flow rate (ml / min) A％ B％ 0.00 0.8 100 0 1.00 0.8 100 0 25.00 0.8 70 30 26.00 0.8 35 65 27.00 0.8 35 65 28.00 0.8 100 0

[0067] Table 4 MS detection conditions

[0068] index condition index condition Heating temperature(℃) 40 Spray voltage (kV) 4 Sheath gas flow (arb) 30 Capillary temperature (℃) 300 Auxiliary gas flow (arb) 10 Capillary voltage(V) 10 Purge gas flow (arb) 0 Tubular lens (V) -150

[0069] Results Figure 1 and Figure 2 The results showed that GalNAc-miR-199a-GWTLNS was successfully synthesized, and the purity of the synthesized target product was high, all above 90%.

[0070] Example 2

[0071] Preparation method of GalNAc-miR-199a-GWTLNS injection

[0072] Add 75 mg of GalNAc-miR-199a-GWTLNS to 9 mL of water for injection, add 85.7 mg of sodium chloride, 7.2 mg of disodium hydrogen phosphate dihydrate, and 1.4 mg of anhydrous sodium dihydrogen phosphate, stir to dissolve, add appropriate amounts of sodium hydroxide and phosphoric acid to adjust the pH value to 7.4, add water for injection to 10 mL, and filter through a 0.22 μm filter membrane to obtain the solution.

[0073] Example 3

[0074] Synthesis method of N-acetylgalactosamine-siVEGF-cell penetrating peptide TPP (GalNAc-siVEGF-CKRRMKWKK)

[0075] The siVEGF sense chain sequence (Sense (5'-3'): GCACAUAGGAGAGAUGAGCUU, SEQID NO: 9) was introduced into the synthesizer, and Universal CPG / GalNAc was used as a carrier. The synthesis was performed according to the set synthesis program. The introduction of each base required four steps of DMTr removal, coupling, oxidation and capping. After the synthesis, the carrier was removed and blown dry, and concentrated ammonia was used for deprotection. After the reaction was completed, it was concentrated and then purified by RP-HPLC. The purified and collected fractions were detected by HPLC, MS and UV. The qualified fractions were collected and freeze-dried to obtain GalNAc-siRNA single strand. Maleimide (MAL) activated ester was dissolved in DMSO, added to the GalNAc-siRNA single strand NH2 intermediate (DMSO dissolved), reacted at 25°C for 30 minutes, and purified to obtain GalNAc-siRNA-MAL. Weigh an appropriate amount of polypeptide (equivalent 10, solvent: DMSO), dissolve it and add it to GalNAc-siRNA-MAL (solvent: DMSO), add an appropriate amount of carbonate solution to make the solution pH 7, react at room temperature for 12 hours, and then perform crude product detection and purification to obtain the target single strand. In order to produce double-stranded siRNA, the target single strand and the antisense strand (SEQ ID NO: 10, molar ratio 1:1) were mixed in annealing buffer, heat denatured at 90°C for 5 minutes, then slowly cooled to 20°C, and finally the solution was lyophilized to obtain siRNA double strands.

[0076] The final product was detected and characterized by LC-MS. Figure 3 and Figure 4 The results showed that GalNAc-siVEGF-CKRRMKWKK was successfully synthesized, and the purity of the synthesized target product was high, all above 90%.

[0077] Example 4

[0078] Preparation method of GalNAc-siVEGF-CKRRMKWKK injection

[0079] Add 75 mg of GalNAc-siVEGF-CKRRMKWKK to 9 mL of water for injection, add 85.7 mg of sodium chloride, 7.2 mg of disodium hydrogen phosphate dihydrate, and 1.4 mg of anhydrous sodium dihydrogen phosphate, stir to dissolve, add appropriate amounts of sodium hydroxide and phosphoric acid to adjust the pH value to 7.4, add water for injection to 10 mL, and filter through a 0.22 μm filter membrane to obtain the product.

[0080] Example 5

[0081] Synthesis method of N-acetylgalactosamine-STAT3-ASO-cRGD (GalNAc-STAT3-ASO-cRGD)

[0082] The STAT3-ASO sequence (5'-CTATTTGGATGTCAGC-3', SEQ ID NO: 11) to be synthesized was introduced into the synthesizer, and Universal CPG / GalNAc was used as a carrier. The synthesis was performed according to the set synthesis program. The introduction of each base required four steps of DMTr removal, coupling, oxidation and capping. After the synthesis, the carrier was removed and blown dry, and concentrated ammonia was used for deprotection. After the reaction, it was concentrated, and then purified by RP-HPLC. The purified and collected fractions were subjected to HPLC, MS and UV detection. The qualified fractions were collected and freeze-dried to obtain GalNAc-STAT3-ASO-SH single chain.

[0083] The cRGD polypeptide modified with maleimide (cyclo(Arg-Gly-Asp-d-Phe-Lys)-MAL, equivalent 15, solvent: DMSO) was weighed, dissolved and added to the GalNAc-STAT3-ASO-SH single chain (solvent: DMSO), and an appropriate amount of carbonate solution was added to adjust the pH to 7, reacted at room temperature for 12 hours, and then the crude product was detected and purified to obtain the target product. In order to produce double-stranded siRNA, the target single chain and the antisense chain (SEQ ID NO: 12, molar ratio 1:1) were mixed in annealing buffer, heat denatured at 90°C for 5 minutes, and then slowly cooled to 20°C, and finally the solution was lyophilized to obtain siRNA double chains.

[0084] The final product was detected and characterized by LC-MS. Figure 5 The results showed that GalNAc-STAT3-ASO-cRGD was successfully synthesized, and the purity of the synthesized target product was high, all above 90%.

[0085] Example 6

[0086] Preparation method of GalNAc-STAT3-ASO-cRGD injection

[0087] Add 50 mg of the prescribed amount of GalNAc-STAT3-ASO-cRGD to 9 mL of water for injection, add 86.1 mg of sodium chloride, 6.3 mg of disodium hydrogen phosphate dihydrate, and 2.1 mg of anhydrous sodium dihydrogen phosphate, stir and dissolve, add sodium hydroxide and hydrochloric acid to adjust the pH value to 7.4, add water for injection to 10 mL, and filter through a 0.22 μm filter membrane to obtain the product.

[0088] Example 7

[0089] Synthesis method of N-acetylgalactosamine-siPLK1-iRGD polypeptide (GalNAc-siPLK-iRGD)

[0090] The positive chain sequence of siPLK1 (SEQ ID NO: 7) was introduced into the synthesizer, and Universal CPG / GalNAc was used as a carrier. The synthesis was performed according to the set synthesis program. The introduction of each base required four steps of DMTr removal, coupling, oxidation and capping. After the synthesis, the carrier was removed and blown dry, and concentrated ammonia was used for deprotection. After the reaction, it was concentrated and then purified by RP-HPLC. The purified and collected fractions were detected by HPLC, MS and UV. The qualified fractions were collected and freeze-dried to obtain GalNAc-siRNA single strands.

[0091] The GalNAc-siRNA single strand was dissolved in a buffered saline solution, and the maleimide-modified iRGD polypeptide (CRGDKGPDC-MAL, equivalent 20, solvent: DMSO) was added to the above solution for reaction, and then the antisense strand of siPLK1 was added for hybridization and vortexing; THPTA:CuSO4·5H2O=5:1 (equivalent 15eq and 3eq, respectively) was added, and the mixture was vortexed at 40°C for 5 minutes, and sodium vitamin C (25eq) was quickly added to the above solution, vortexed, and reacted at 40°C for 2 hours, and then the crude product was detected and purified to obtain the target product. In order to produce double-stranded siRNA, the target single strand and the antisense strand (SEQ ID NO: 8, molar ratio 1:1) were mixed in an annealing buffer, heat denatured at 90°C for 5 minutes, and then slowly cooled to 20°C, and finally the solution was lyophilized to obtain the siRNA double strand.

[0092] The final product was detected and characterized by LC-MS. Figure 6 and Figure 7 The results showed that GalNAc-siPLK1-iRGD was successfully synthesized, and the purity of the synthesized target product was high, all above 90%.

[0093] Example 8

[0094] Preparation method of GalNAc-siPLK1-iRGD injection

[0095] Add 75 mg of the prescribed amount of GalNAc-siPLK1-iRGD to 9 mL of water for injection, add 85.7 mg of sodium chloride, 7.2 mg of disodium hydrogen phosphate dihydrate, and 1.4 mg of anhydrous sodium dihydrogen phosphate, stir to dissolve, add appropriate amounts of sodium hydroxide and phosphoric acid to adjust the pH value to 7.4, add water for injection to 10 mL, and filter through a 0.22 μm filter membrane to obtain the product.

[0096] Example 9

[0097] Enzyme stability assay

[0098] The GalNAc-siVEGF-CKRRMKWKK injection prepared in Example 2 was diluted 100 times, 4 μL of the diluted injection was taken, 4 μL of 0.1 mg / mL RNase A solution was added, and then incubated at 37°C for 2 hours, and then RNase inhibitor (40 U / μL) was added to terminate the reaction. GalNAc-siVEGF and naked siVEGF were operated in the same way as controls, and finally the complex was diluted to an appropriate concentration with sterile water for agarose gel electrophoresis. In addition, untreated GalNAc-siVEGF-CKRRMKWKK, GalNAc-siVEGF and naked siVEGF were also directly loaded for agarose gel electrophoresis, and their electrophoresis bands were observed by an imager.

[0099] The results are as follows Figure 8 As shown in the figure, the results show that before incubation with enzyme, GalNAc-siVEGF-CKRRMKWKK, GalNAc-siVEGF and naked siVEGF can all run out bands. After incubation with enzyme, siVEGF is degraded by nuclease and no bands can be seen in the electrophoresis. However, obvious bands can be seen in the electrophoresis of GalNAc-siVEGF-CKRRMKWKK and GalNAc-siVEGF with modified backbones, indicating that they are not degraded by nuclease.

[0100] Similarly, the same enzyme stability experiment was performed using GalNAc-miR-199a-GWTLNS injection and GalNAc-siPLK1-iRGD injection. The results also showed that the backbone-modified GalNAc-miR-199a-GWTLNS and GalNAc-siPLK1-iRGD have the ability to resist nuclease degradation. This property provides a basis for the in vivo and in vitro delivery of GalNAc-nucleic acid-polypeptide conjugates.

[0101] Example 10

[0102] Cellular uptake experiments

[0103] The nucleic acid was labeled with Cy5, and the cell entry of GalNAc-siPLK1-iRGD injection was observed by fluorescence microscopy. HepG2 cells were cultured at 5×10 4 / well were inoculated in a 24-well plate. After culturing in an incubator for 24 hours, 200nM GalNAc-siPLK1-iRGD, GalNAc-siPLK1 and siPLK1 were added to each well. After culturing for 4 hours, the culture medium was discarded and washed three times with 500μL PBS. Then, 500μL of 4% paraformaldehyde solution was added to each well to fix the cells for 15 minutes. After fixation, 500μL DAPI solution (1μg / mL) was added to each well to stain the cell nucleus for 2-5 minutes. After staining, it was also washed three times with PBS. Finally, the 24-well plate was placed under a fluorescence microscope for observation.

[0104] The results are as follows Fig. 9 As shown, the results showed that the red fluorescence of Cy5 in the naked siPLK1 group was very weak, while a large amount of red fluorescence could be observed in the cells of the GalNAc-siPLK1 and GalNAc-siPLK1-iRGD groups, and the red fluorescence intensity in the GalNAc-siPLK1-iRGD group was stronger. This showed that naked siPLK1 was rarely taken up by cells, while GalNAc-siPLK1 and GalNAc-siPLK1-iRGD were both successfully taken up by cells, and GalNAc-siPLK1-iRGD had a higher efficiency of cellular entry.

[0105] The experimental steps for the cellular uptake of GalNAc-miR-199a-GWTLNS, GalNAc-VEGF-siRNA-CKRRMKWKK, and GalNAc-STAT3-ASO-cRGD were similar to those for the cellular uptake of GalNAc-siPLK1-iRGD, except that the conjugate concentration (50 nM to 200 nM) and incubation time (1 h to 4 h) were different. Fig.10 , Fig.11 , Fig.12 As shown, the results indicate that naked nucleic acid can hardly be taken up by cells, while the cell uptake effect of doubly coupled nucleic acid is better.

[0106] Embodiment 11

[0107] Real-time fluorescence quantitative PCR (qPCR) experiment

[0108] The qPCR experiment was used to detect the effect of nucleic acid conjugate injection on silencing tumor genes. HepG2 liver cancer cells were cultured at 3×10 5Cells / well were inoculated into 6-well plates, and 400nM miR-199a, GalNAc-miR-199a, and GalNAc-miR-199a-GWTLNS were added respectively. They were incubated in serum-free medium without dual antibodies for 4h, and then the serum-free medium was replaced with an equal volume of serum-containing medium and incubated for another 48h. Subsequently, the transfected liver cancer cells were collected, and RNA was extracted using a total RNA extraction reagent, followed by reverse transcription of the total RNA, and finally a real-time fluorescence quantitative PCR experiment was performed. Using U6 as an internal reference, the changes in miR-199a expression levels were determined, and using β-Actin as an internal reference, the changes in mTOR mRNA expression levels were determined. The primer sequences, reaction systems, and reaction procedures for PCR are shown in Tables 5 to 7 below:

[0109] Table 5 Primer sequences

[0110]

[0111] Table 6 Fluorescence quantitative PCR reaction system

[0112] Reagents 20μL reaction system Final concentration 2×UltraSYBR Mixture 10μL 1× Primer Mixture, 5 μM 0.8μL 0.2μM TemplateDNA 9.2μL - <![CDATA[ddH2O]]> up to 20 μL -

[0113] Table 7 Fluorescence quantitative PCR reaction program

[0114] step Temperature(℃) time Pre-denaturation 95 10min Denaturation (50 cycles) 95 15s Annealing / Extension 60 1min Melting curve analysis 95 15s 60 1min 95 1s 60 15s

[0115] The results are as follows Fig.13 Middle a. After 48h of transfection, the relative expression levels of miR-199a in the GalNAc-miR-199a and GalNAc-miR-199a-GWTLN groups were 6 and 9, respectively, indicating that the dual-coupled miR-199a could enter more HepG2 cells and upregulate the expression of miR-199a in the cells. In addition, the relative expression levels of mTOR mRNA in the naked miR-199a, GalNAc-miR-199a, and GalNAc-miR-199a-GWTLN groups were 0.98, 0.77, and 0.58, respectively, indicating that the dual-coupled miR-199a could significantly downregulate the expression of the corresponding tumor genes and improve the efficiency of gene silencing.

[0116] The qPCR steps for the other three GalNAc-nucleic acid-peptide conjugate injections were as described above, except that the transfection concentrations (200 nM to 10 μM) and incubation times (2 d to 7 d) were different. The results are shown in Fig.13b, c and d. The results showed that compared with uncoupled and single-coupled nucleic acids, double-coupled nucleic acids had a stronger ability to downregulate the expression of corresponding tumor genes. Among them, the relative expression levels of PLK1 mRNA, VEGF mRNA, and STAT3 mRNA in the GalNAc-siPLK1-iRGD, GalNAc-siVEGF-CKRRMKWKK, and GalNAc-STAT3-ASO-cRGD groups were 0.15, 0.47, and 0.21, respectively. In particular, GalNAc-siPLK1-iRGD and GalNAc-STAT3-ASO-cRGD had a stronger ability to silence tumor-related genes, silencing almost 80% of tumor genes.

[0117] Example 12

[0118] In vivo small animal imaging experiments

[0119] Using Cy5 as a fluorescent probe, a small animal imaging system was used to monitor the distribution of nucleic acids in mice. The mice were randomly divided into 4 groups: control group, naked Cy5-ASO group, GalNAc-ASO-Cy5 group, and GalNAc-ASO-cRGD-Cy5 group. The mice were fasted overnight before administration. The injection dose for each mouse was 5 mg / kg, and the injection method was subcutaneous injection. Imaging was performed at 5 time points after injection (0.5, 1, 2, 4, and 8 hours). After imaging, each tissue (heart, liver, spleen, lung, and kidney) was removed to observe fluorescence.

[0120] The fluorescence distribution results in mouse ex vivo tissues are as follows Fig.14 As shown, the results showed that compared with Cy5-labeled naked ASO, the GalNAc-ASO-Cy5 group and the GalNAc-ASO-cRGD-Cy5 group had better liver targeting.

[0121] The in vivo small animal imaging experimental procedures for GalNAc-miR-199a-GWTLNS injection and GalNAc-siPLK1-iRGD injection were as described above, except that the injection dose for each mouse was different (5 mg / kg and 10 mg / kg, respectively). The results showed that the GalNAc-nucleic acid-peptide conjugate has the characteristics of liver targeting and renal excretion.

[0122] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A liver-targeted small nucleic acid drug carrier, characterized in that: including sequentially linked N-acetylgalactosamine, a small nucleic acid drug for treating hepatocellular carcinoma, and a cell-penetrating peptide; The cell-penetrating peptide comprises at least one of the following: TP10 cell-penetrating peptide, iRGD polypeptide, cell-penetrating peptide TPP and cRGD polypeptide.

2. The liver-targeted small nucleic acid drug carrier according to claim 1, characterized in that: The amino acid sequences of the TP10 membrane-penetrating peptide, iRGD polypeptide, cell-penetrating peptide TPP and cRGD polypeptide are shown in SEQ ID NO: 1 to SEQ ID NO:

4.

3. The liver-targeted small nucleic acid drug carrier according to claim 1, characterized in that: The small nucleic acid drug for treating hepatocellular carcinoma comprises at least one of the following: microRNA-199a, siRNA targeting PLK1 gene, siRNA targeting VEGF gene and STAT3 antisense oligonucleotide.

4. The liver-targeted small nucleic acid drug carrier according to claim 3, characterized in that: The nucleotide sequences of the microRNA-199a, the siRNA targeting the PLK1 gene, the siRNA targeting the VEGF gene and the STAT3 antisense oligonucleotide are shown in SEQ ID NO: 5 to SEQ ID NO:

11.

5. The liver-targeted small nucleic acid drug carrier according to any one of claims 1, 3 and 4, characterized in that: The small nucleic acid drug for treating hepatocellular carcinoma includes a backbone having at least one of the following modifications: 2′-fluoro nucleotide modification, 2′-O-methyl modification, 2′-O-methoxyethyl modification, locked nucleic acid modification, restricted ethyl bridge nucleic acid modification, 5′-vinyl phosphonate modification, and substitution of phosphodiester bonds with phosphorothioate bonds.

6. The liver-targeted small nucleic acid drug carrier according to claim 1, characterized in that: The connection method of the small nucleic acid drug for treating hepatocellular carcinoma and the cell-penetrating peptide includes connection through a thiol-maleimide covalent bond.

7. The method for preparing the liver-targeted small nucleic acid drug carrier according to any one of claims 1 to 6, characterized in that: The following steps are involved: Using N-acetylgalactosamine as a carrier, a single-chain small nucleic acid drug for treating hepatocellular carcinoma is synthesized by gene synthesis to obtain an N-acetylgalactosamine-nucleic acid single-chain conjugate; The N-acetylgalactosamine-nucleic acid single-chain conjugate and the cell-penetrating peptide are linked by thiol-maleimide covalent bonds to obtain an N-acetylgalactosamine-nucleic acid single-chain-cell-penetrating peptide conjugate; The N-acetylgalactosamine-nucleic acid single chain-membrane-penetrating peptide conjugate is annealed and hybridized with another chain of a small nucleic acid drug for treating hepatocellular carcinoma to obtain a liver-targeted small nucleic acid drug carrier.

8. The preparation method according to claim 7, characterized in that: The method of thiol-maleimide covalent bond connection includes chemically reacting the thiol of the nucleic acid single chain in the N-acetylgalactosamine-nucleic acid single chain conjugate with the cell-penetrating peptide modified with maleimide, or chemically reacting the thiol on the cell-penetrating peptide with the N-acetylgalactosamine-nucleic acid single chain conjugate in which the nucleic acid single chain is modified with maleimide; The molar ratio of the N-acetylgalactosamine-nucleic acid single-strand conjugate to the cell-penetrating peptide is 1:(5-30); The chemical reaction time is 2 to 24 hours.

9. A drug for preventing and / or treating hepatocellular carcinoma, characterized in that: The active ingredients include the liver-targeted small nucleic acid drug carrier according to any one of claims 1 to 6 or the liver-targeted small nucleic acid drug carrier prepared by the preparation method according to claim 7 or 8 and pharmaceutically acceptable excipients.

10. Use of the liver-targeted small nucleic acid drug carrier according to any one of claims 1 to 6 or the liver-targeted small nucleic acid drug carrier prepared by the preparation method according to claim 7 or 8 in the preparation of a drug for preventing and / or treating hepatocellular carcinoma.

Images