Pineapple CRISPR / Cas9 gene editing vector as well as construction method and application thereof

Abstract

The invention relates to the technical field of gene engineering, in particular to a pineapple CRISPR / Cas9 gene editing vector as well as a construction method and application thereof. The invention relates to a pineapple CRISPR / Cas9 (clustered regularly interspaced short palindromic repeats / CRISPR associated protein 9) gene editing vector. Target sites Target1 and Target2 are designed according to a cDNA (complementary deoxyribonucleic acid) sequence of AcCWIN1; by taking a pMODB2312 carrier as a template, carrying out amplification by utilizing the primer for amplifying the target fragment to obtain the target fragment; a target fragment is inserted into a pMODB2312 carrier through double enzyme digestion, and a module B is obtained; the method comprises the following steps: cutting a pMODA1110 module, a pMODC0000 module, a pTRANS260d module and a B module by using an Aar I incision enzyme, and carrying out connection by using a T4 ligase, so as to obtain the CRISPR / Cas9 gene editing vector of the pineapple. The pineapple edited homozygous strain is successfully obtained according to the method, and a basis is provided for directional research of pineapples.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering technology, and in particular to a pineapple CRISPR / Cas9 gene editing vector and a construction method and application thereof. Background Art

[0002] The existing pineapple breeding technology has made slow progress, and prominent industry problems such as water core disease and storage intolerance have restricted the healthy development of the pineapple industry. Molecular breeding has clear goals, short cycles, and quick results. It effectively combines molecular breeding with traditional breeding, which can quickly and efficiently solve the bottleneck problems in the pineapple industry.

[0003] As an efficient gene-directed editing technology, the CRISPR / Cas9 system can achieve site-directed mutation, gene replacement and gene repair in situ in the genome, and is an ideal way to improve crop varieties and create new germplasm. However, in pineapple gene editing breeding, genetic transformation uses callus, leaves, stem segments and other tissues as transformation receptors. Although transgenic plants can be obtained, there are still bottlenecks such as low embryonic callus induction rate and low transformation positive rate, which makes it difficult to effectively apply the excellent trait genes discovered and identified to breeding practice. Therefore, the establishment of an efficient pineapple gene editing breeding technology system has important theoretical and practical significance for accelerating the selection and breeding of pineapples and excellent varieties.

[0004] Based on this, the present invention is proposed. Summary of the invention

[0005] The purpose of the present invention is to provide a high-efficiency pineapple CRISPR / Cas9 gene editing vector, and in particular to a pineapple CRISPR / Cas9 gene editing vector and a construction method and application thereof.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The present invention provides a method for constructing a pineapple CRISPR / Cas9 gene editing vector, comprising the following steps:

[0008] (1) Using pineapple cDNA as a template, PCR amplification was performed using a specific primer pair for amplifying AcCWIN1 to obtain the cDNA sequence of AcCWIN1;

[0009] (2) Designing target sites based on the cDNA sequence of AcCWIN1 to obtain target sites Target1 and Target2;

[0010] (3) Screening the target site sequences to obtain a vector pMOD_B2312 with high promoter activity and dual target sites, and designing primers for amplifying the target fragment;

[0011] (4) Using the pMOD_B2312 vector as a template, amplify the target fragment using primers to obtain the target fragment;

[0012] (5) Insert the target fragment into the pMOD_B2312 vector using Sap I and Bsa I restriction enzymes to obtain module B;

[0013] (6) Using Aar I endonuclease to simultaneously cut pMOD_A1110, pMOD_C0000, pTRANS_260d and module B, and connecting them using T4 ligase to obtain the pineapple CRISPR / Cas9 gene editing vector;

[0014] The sequence of the Target1 target site is shown in SEQ ID NO: 4;

[0015] The sequence of the Target2 target site is shown in SEQ ID NO:5.

[0016] Preferably, the nucleotide sequences of the specific primers for amplifying AcCWIN1 in step (1) are shown in SEQ ID NOs: 1-2.

[0017] Preferably, the tool for designing target sites is CRISPOR;

[0018] The tool for screening vectors with high promoter activity and dual targets is Crispr-multiplex.

[0019] Preferably, the primers for amplifying the target fragment include 3 pairs of primers;

[0020] The first pair of primers is used to amplify target fragment 1, and the nucleotide sequence of the primer pair is shown in SEQ ID NOs: 6-7;

[0021] The second pair of primers is used to amplify target fragment 2, and the nucleotide sequence of the primer pair is shown in SEQ ID NOs: 8-9;

[0022] The third pair of primers is used to amplify target fragment 3, and the nucleotide sequences of the primer pair are shown in SEQ ID NOs: 10-11.

[0023] Preferably, the nucleotide sequences of the target fragments 1 to 3 are shown in SEQ ID NOs: 12 to 14.

[0024] The present invention also provides a pineapple CRISPR / Cas9 gene editing vector constructed by the construction method.

[0025] The present invention also provides the use of the pineapple CRISPR / Cas9 gene editing vector constructed by the construction method in pineapple directed genetic breeding or directed editing of pineapple genes.

[0026] The present invention also provides the use of the pineapple CRISPR / Cas9 gene editing vector in pineapple directed genetic breeding or directed editing of pineapple genes.

[0027] The present invention also provides a method for directed editing of pineapple resistant plants, comprising the following steps: using a pineapple CRISPR / Cas9 gene editing vector to transform pineapple embryonic callus, and performing PPT resistance screening and rooting culture to obtain pineapple directed editing resistant plants;

[0028] The pineapple CRISPR / Cas9 gene editing vector is the pineapple CRISPR / Cas9 gene editing vector constructed by the construction method or the pineapple CRISPR / Cas9 gene editing vector.

[0029] Preferably, the transformation method is Agrobacterium-mediated transformation.

[0030] The present invention provides a pineapple CRISPR / Cas9 gene editing vector and a construction method and application thereof. The construction method of the pineapple CRISPR / Cas9 gene editing vector of the present invention comprises the following steps: (1) using pineapple cDNA as a template, using specific primers for amplifying AcCWIN1 to perform PCR amplification to obtain the cDNA sequence of AcCWIN1; (2) designing target sites according to the cDNA sequence of AcCWIN1 to obtain target sites Target1 and Target2; (3) screening the sequences of the target sites to obtain a vector pMOD_B2312 with high promoter activity and dual target sites, and designing primers for amplifying a target fragment; (4) using the pMOD_B2312 vector as a template, using primers for amplifying the target fragment to perform amplification to obtain the target fragment; (5) using Sap I and BsaI restriction endonucleases to insert the target fragment into the pMOD_B2312 vector to obtain module B; (6) using Aar I endonuclease simultaneously cuts pMOD_A1110, pMOD_C0000, pTRANS_260d and B module, and connects them with T4 ligase to obtain pineapple CRISPR / Cas9 gene editing vector; the nucleotide sequence of the Target1 target site is shown in SEQ ID NO: 4; the nucleotide sequence of the Target2 target site is shown in SEQ ID NO: 5. The present invention improves the CRISPR / Cas9 gene editing efficiency by designing dual target sites and screening promoters with high transcriptional activity on pineapples, establishes an efficient CRISPR / Cas9 gene editing technology system, and provides a basis for the directed breeding and directed editing of pineapples and the screening of homozygous transgenic plants.

[0031] The method of the present invention uses Bari pineapple as material to establish a pineapple efficient genetic transformation system; DNA recombination technology is used to construct sgRNA initiated by a promoter with high transcriptional activity, and a CRISPR / Cas9 gene editing technology system with pineapple excellent trait genes such as high quality, high yield, and stress resistance as target sequences, and excellent new germplasm is created by knocking out the key negative regulatory genes of excellent traits. The research results will accelerate the efficient utilization of pineapple germplasm resources and excellent genes and the breeding process of new varieties with independent intellectual property rights, and enhance the core competitiveness of pineapple varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 is the PCR product of AcCWIN1 (M: 2000DNAMarker, 1: PCR product of AcCWIN1);

[0033] Figure 2 Schematic diagram of CRISPR / Cas9 editing vector;

[0034] Figure 3PCR amplification of target fragment and PCR detection of positive clones (M: 2000DNAMarker, 1-3: PCR amplification of target fragment; 4-9: PCR detection of positive clones of module B; 10-15: PCR detection of positive clones of CRISPR / Cas9 gene editing);

[0035] Figure 4 The effects of different proliferation medium on adventitious bud regeneration from callus (a indicates 6-BA concentration of 1.0 mg·L -1 Proliferation medium, b indicates 6-BA concentration of 1.5 mg·L -1 Proliferation medium, c means 6-BA concentration is 2.0 mg·L -1 proliferation medium, d represents statistical analysis of adventitious bud regeneration rate);

[0036] Figure 5 The effect of different screening media on embryogenic callus contamination (a indicates that the concentration of timenidine is 100 mg·L -1 The antibacterial effect of b indicates that the concentration of timenidine is 200 mg·L -1 The antibacterial effect of c indicates that the concentration of timenidine is 400 mg·L -1 The inhibition of bacteria, d represents the statistical analysis of embryonic callus contamination rate);

[0037] Figure 6 The effect of different PPT concentrations in the screening medium on the regeneration of resistant adventitious buds (a represents the regeneration of adventitious buds when the PPT concentration is 1 mg / L, b represents the regeneration of adventitious buds when the PPT concentration is 1.5 mg / L, c represents the regeneration of adventitious buds when the PPT concentration is 2.0 mg / L, and d represents the statistical analysis results of the regeneration rate of resistant adventitious buds);

[0038] Figure 7 The genetic transformation of pineapple embryonic callus (a represents embryonic callus induction, b represents resistant adventitious buds, c represents rooting culture, d represents seedling hardening, and e represents transplanting);

[0039] Figure 8 is the PCR test result of resistant plants;

[0040] Fig. 9 These are pineapple directed editing resistant plants (wt represents wild-type plants, and the remaining numbers represent pineapple directed editing resistant plants);

[0041] Fig.10 The PCR test results of pineapple directed editing resistance plants (M represents the DNA Marker of DL2000; wt represents the wild-type plant; the remaining numbers represent pineapple directed editing resistance plants);

[0042] Fig.11Results of sequence analysis of target sites for directed editing of pineapple resistant plants;

[0043] Fig.12 Types of gene target site editing for targeted editing of resistant plants in pineapple. DETAILED DESCRIPTION

[0044] In the present invention, the specific primers for amplifying AcCWIN1 were designed with reference to the mRNA sequence (Aco023030.1) of AcCWIN1 in the pineapple genome database PGD.

[0045] In the present invention, the pineapple cDNA is the Bali pineapple cDNA.

[0046] In the present invention, the nucleotide sequences of specific primers for amplifying AcCWIN1 are shown in SEQ ID NOs: 1-2; SEQ ID NO: 1 is an upstream primer, and its sequence is CTCACTGTGTGAATTAGAGG; SEQ ID NO: 2 is a downstream primer, and its sequence is ACTACTACACCGCAGAACATC.

[0047]

[0048] In the present invention, the designed target sites are Target1 and Target2; the sequence of the Target1 target site is shown in SEQ ID NO: 4, specifically: CGGGTGGATAGCCGGTTCGA; the sequence of the Target2 target site is shown in SEQ ID NO: 5, specifically: CGGACCCGTACCTCCGCAAA.

[0049] In the present invention, primers for amplifying the target fragment include 3 pairs of primers; the first pair of primers is used to amplify the target fragment 1, the upstream primer PvUbi1 is shown in SEQ ID NO: 6, specifically: TGCTCTTCGCGCCACGTCAGTGTTTGGTTTCC; the downstream primer TRNA_AcCWIN1-1 is shown in SEQ ID NO: 7, specifically: TGGTCTCCGCTATCCACCCGTGCACCAGCCGGGAATCG. The second pair of primers is used to amplify the target fragment 2, the upstream primer REP_AcCWIN1-1 is shown in SEQ ID NO: 8, specifically: TGGTCTCATAGCCGGTTCGAGTTTTAGAGCTAGAAATAGC; the downstream primer TRNA_AcCWIN1-2 is shown in SEQ ID NO: 9, specifically: TGGTCTCCGGTACGGGTCCGTGCACCAGCCGGGAATCG. The third pair of primers is used to amplify the target Target2 sequence, the upstream primer REP_AcCWIN1-2 is shown in SEQ ID NO: 10, specifically: TGGTCTCATACCTCCGCAAAGTTTTAGAGCTAGAAATAGC, and the downstream primer TRNA_term is shown in SEQ ID NO: 11, specifically: TGCTCTTCTGACTGCACCAGCCGGGAATCG. The PvUbi1, TRNA, and REP in front of the primer name are automatically generated by the software, and the AcCWIN1-1 and TRNA_AcCWIN1-2 in the back are marked to distinguish the primers.

[0050]

[0051] The sequence of the target fragment amplified by the second pair of primers is shown in SEQ ID NO: 13, specifically: TGGTCTCATAGCCGGTTCGAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCAACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCACGGACCCGTACCGGAGACCA.

[0052] The sequence of the target fragment amplified by the third pair of primers is shown in SEQ ID NO: 14, specifically: TGGTCTCATACCTCCGCAAAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCAACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCAGTCAGAAGAGCA.

[0053] The technical solution provided by the present invention is described in detail below in conjunction with embodiments.

[0054] Example 1

[0055] Gene cloning and CRISPOR-Cas9 editing vector construction

[0056] (1) Gene cloning

[0057] Referring to the mRNA sequence of AcCWIN1 in the pineapple genome database PGD (Aco023030.1), the specific primers for amplifying AcCWIN1 were designed using Primer-BLAST in NCBI. The nucleotide sequences of the specific primers for amplifying AcCWIN1 are shown in SEQ ID NOs: 1-2; SEQ ID NO: 1 is an upstream primer, and the sequence is CTCACTGTGTGAATTAGAGG; SEQ ID NO: 2 is a downstream primer, and the sequence is ACTACTACACCGCAGAACATC. PCR amplification was performed using Bali pineapple cDNA as a template to obtain the cDNA sequence of AcCWIN1 (SEQ ID NO: 3).

[0058]

[0059] PCR amplification system 25 μL: 10 μM upstream primer 1 μL, 10 μM downstream primer 1 μL, cDNA 1 μL, PCR SuperMix 12.5μL, Nuclease-free Water 9.5μL,

[0060] PCR reaction program: 95°C for 5 min; 95°C for 30 s, 55°C for 30 s, 72°C for 2 min, 35 cycles; 72°C for 10 min.

[0061] (2) Construction of pineapple CRISPR / Cas9 gene editing vector

[0062] Construction of pineapple CRISPR / Cas9 gene editing vector using Golden Gate Cloning method

[0063] ① Target design: According to the cDNA sequence of AcCWIN1 shown in SEQ ID NO: 3, the target sites were designed by the online tool CRISPOR (http: / / crispor.tefor.net / ), and a comprehensive evaluation was performed. Two sequences with high evaluation scores and low off-target rates were selected for each gene as target sites. The target sites obtained were Target1 and Target2. The sequence of the Target1 target site is shown in SEQ ID NO: 4, specifically: CGGGTGGATAGCCGGTTCGA; the sequence of the Target2 target site is shown in SEQ ID NO: 5, specifically: CGGACCCGTACCTCCGCAAA.

[0064] ② Vector selection: Use the Crispr-multiplex (http: / / crispr-multiplex.cbs.umn.edu / / vector.php) online tool to select a vector suitable for pineapple (monocotyledonous crop), which has a high promoter activity and dual target sites. Finally, pMOD_B2312 was obtained, which was the most suitable vector for pineapple.

[0065] ③ Target primer design: Primer Design and Map in the Crispr-multiplex online tool was used to design primers for amplifying the target fragment using the pMOD_B2312 vector as a template. Finally, three pairs of primers were designed, namely (PvUbi1, TRNA_AcCWIN1-1), (REP_AcCWIN1-1, TRNA_AcCWIN1-2), and (REP_AcCWIN1-2, TRNA_term), which were sent to Sangon Biotech Co., Ltd. for synthesis. The specific primers are shown in Table 1.

[0066] Table 1 Primers for amplifying target fragments

[0067]

[0068] ④ Obtaining the target fragment: Using vector pMOD_B2312 as template, PCR amplification was performed with the three pairs of primers designed above, and the products were detected by gel and purified and stored at -20°C.

[0069] PCR amplification system 25 μL: 10 μM upstream primer 1 μL, 10 μM downstream primer 1 μL, pMOD_B2312 1 μL, PCR SuperMix 12.5μL, Nuclease-free Water 9.5μL.

[0070] PCR reaction program: 98°C for 60 s; 98°C for 10 s, 60°C for 15 s, 72°C for 15 s, 30 cycles; 72°C for 2 min.

[0071] ⑤PCR product purification: Use DNA purification kit Ep101 (Beijing Quanshijin Biotechnology Co., Ltd.) to purify PCR products. Add different volumes of 100% ethanol to WB before use. The specific purification method refers to the kit instructions and is slightly modified:

[0072] a. Add 300 μL of BB solution to 60 μL of the sample to be purified, mix well, load onto the column, and centrifuge at 12000 rpm for 30 seconds;

[0073] b. Rinse with 600 μL of WB solution and centrifuge at 12000 rpm for 30 seconds;

[0074] c. Add 50 μL of deionized water to the centrifuge column and centrifuge at 12000 rpm for 30 seconds;

[0075] d. Repeat step c;

[0076] e. The eluted DNA was stored at -20°C;

[0077] f. Check the quality of the purified PCR product by electrophoresis.

[0078] ⑥ Construction of module B: The purified target fragment and the pMOD_B2312 vector were double-digested with restriction endonucleases Sap I and Bsa I, and then ligated with T4 ligase to construct module B. After transformation, the bacterial liquid was tested by PCR and sent for sequencing.

[0079] Enzyme digestion and ligation reaction system 20μL: pMOD_B23122μL, PCR product 4μL, Sap I 1μL, Bsa I 1μL, T4 ligase 2μL, T4 buffer 2μL, Nuclease-free Water 8μL.

[0080] Enzyme digestion and ligation reaction program: 37°C for 5 min, 25°C for 10 min, for a total of 10 cycles.

[0081] Transformation into competent E. coli

[0082] a. Add 5 μL B module to the E. coli competent cells, mix well and place on ice for 35 minutes;

[0083] b. Place at 42°C for 60 seconds and on ice for 3 minutes;

[0084] c. After adding LB liquid medium, incubate at 37°C and 200 rpm for 1 hour;

[0085] d. Take 200 μL of the cultured bacterial solution and add it to the LB plate medium containing antibiotics and spread it evenly;

[0086] e. Incubate the coated LB plates at 37°C overnight.

[0087] Single colonies were picked from the LB plate and PCR was performed using target primers. The positive strains detected by gel were sent for sequencing. The detection primers are shown in Table 2.

[0088] Table 2 Detection primers

[0089]

[0090] Bacterial liquid PCR reaction system 25μL: 10μM upstream primer 1μL, 10μM downstream primer 1μL, bacterial liquid 3μL, PCR SuperMix 12.5μL, Nuclease-free Water 9.5μL.

[0091] Bacterial liquid PCR reaction program: 95℃5min; 95℃30s, 60℃30s, 72℃1min, 35 cycles; 72℃, 10min.

[0092] ⑦ Construction of pineapple CRISPR / Cas9 gene editing vector: Use a plasmid extraction kit to extract the plasmids of pMOD_A1110, pMOD_C0000, pTRANS_260d, and B module, and then use Aar I endonuclease to cut them at the same time, and then use T4 ligase to connect and construct the final vector. After transformation, perform bacterial liquid PCR detection and send it for sequencing. The transformation and bacterial liquid PCR detection methods are the same as above. The final vector (pineapple CRISPR / Cas9 gene editing vector) with correct sequencing is transformed into Agrobacterium, and glycerol is added and stored at -80°C.

[0093] Enzyme digestion and ligation reaction system 20μL: pMOD_A11102μL, pMOD_C00002μL, pTRANS_260d2μL, module B 2μL, Aar I oligonucleotide 0.5μL, Aar I 0.5μL, T4 ligase 1μL, T4 buffer 2μL, Nuclease-free Water 8μL.

[0094] Enzyme digestion and ligation reaction program: 37°C 5 min, 22°C 10 min, 10 cycles in total; 37°C 15 min, 80°C 5 min.

[0095] Transformation of Agrobacterium competent cells:

[0096] a. Add 1.5 μL of pineapple CRISPR / Cas9 gene editing vector to the Agrobacterium competent cells, mix well and place on ice for 35 minutes;

[0097] b. Place on liquid nitrogen and ice for 60 seconds and 2 minutes respectively;

[0098] c. After adding YEP liquid culture medium, incubate at 28°C and 200 rpm for 3 h;

[0099] d. Take 200 μL of bacterial solution and add it to the YEP plate medium containing antibiotics, spread it evenly and let it dry;

[0100] e. Incubate the coated YEP plates at 28°C overnight for 48 hours.

[0101] Single colonies on the YEP plate were picked and PCR detection of bacterial solution was performed using target primers. The detection primers are shown in Table 2. Positive colonies were cultured at 250 rpm for 48 h and then stored at -80°C for transformation.

[0102] (3) Results

[0103] The AcCWIN1 sequence was downloaded from the pineapple genome database PGD, and specific primers were designed. PCR amplification was performed using the synthetic Bali pineapple cDNA as a template. The result was a band of about 1600 bp, which was consistent with the expected size ( Figure 1 ).

[0104] The CDS sequence of AcCWIN1 was used to design dual target sites Target1 and Target2 on the Crispr-tefor website ( Figure 2 ) and conduct a comprehensive evaluation; the B module vector pMOD_B2312 suitable for monocotyledonous pineapple was screened by using the target site sequence through the Crispr-multiplex website, and the primers for amplifying the target fragment were designed. PCR amplification was performed using the pMOD_B2312 vector as a template, and three target fragments (P1 shown in SEQ ID NO: 12, P2 shown in SEQ ID NO: 13, and P3 shown in SEQ ID NO: 14) were obtained by gel electrophoresis. The size of P1 was 2092bp, the size of P2 was 193bp, and the size of P3 was 185bp; the three target fragments were then inserted into the pMOD_B2312 vector using SapI and Bsa I restriction endonucleases, and after transformation and bacterial liquid PCR detection, a target band of about 600bp was obtained ( Figure 3 ), and the sequencing results were correct, and the B module was successfully constructed. Then, pMOD_A1110, pMOD_C0000, pTRANS_260d, and B module were cut simultaneously with Aar I endonuclease, and the final vector (pineapple CRISPR / Cas9 gene editing vector) was constructed using T4 ligase. After transformation, bacterial liquid PCR detection was performed ( Figure 3 ), the target band size was consistent and the sequencing results were correct, indicating that the pineapple CRISPR / Cas9 gene editing vector was successfully constructed.

[0105] Example 2

[0106] Method for transforming pineapple callus

[0107] (1) Callus induction culture: Take a sucker with a diameter of 0.5 cm at the stem base, remove the leaves above the sucker growth point, pre-sterilize with 2% NaClO for 10 min, then sterilize with 0.1% HgCl for 8 min, rinse with sterile water, and then inoculate on callus induction medium for induction;

[0108] (2) Callus proliferation culture: After 4 weeks, the callus tissue was excised and transferred to proliferation medium for dark culture for 3 weeks. During subculture, the browned part and adventitious buds were removed.

[0109] (3) Somatic embryo induction culture: callus tissue was inoculated on somatic embryo induction medium and cultured for 3 weeks;

[0110] (4) Pre-culture: Cut the somatic embryonic tissue into 1 cm small pieces, inoculate them on the pre-culture medium and culture them in the dark for 2 days;

[0111] (5) Infection and co-culture: OD 600 The pre-cultured somatic embryo tissue was infected with 0.5% bacterial solution for 4 min, blotted dry on filter paper, transferred to co-culture medium containing AS, and cultured in the dark at 28°C for 3 d;

[0112] (6) Screening culture: The co-cultured somatic embryonic tissue is transferred to the screening medium, and the albino buds and white calli are continuously eliminated, while the green buds and green calli are retained and subcultured.

[0113] (7) Rooting culture: The resistant seedlings were cut and placed in a rooting medium without antibiotics for rooting culture.

[0114] (8) Transplanting of resistant seedlings: After gradual hardening, the rooted resistant seedlings are transplanted into plug trays.

[0115] The culture media involved in this method are shown in Table 3.

[0116] Table 3 Culture medium composition

[0117]

[0118] In order to reduce the regeneration of adventitious buds during callus proliferation, three different proliferation culture media were set up for research. The three different proliferation culture media are shown in Table 4. After 30 days, the effects of the three different proliferation culture media on the regeneration of adventitious buds were observed. Each design was repeated 3 times. The results are shown in Tables 5 and Figure 4 shown.

[0119] Table 4 Composition of different proliferation medium

[0120] No. Medium 1 <![CDATA[MS+1.0mg·L -1 6-BA+3.0mg·L -1 NAA+2% sucrose+1% glucose]]> 2 <![CDATA[MS+1.5mg·L -1 6-BA+3.0mg·L -1 NAA+2% sucrose+1% glucose<!-- 9 --> ]]> 3 <![CDATA[MS+2.0mg·L -1 6-BA+3.0mg·L -1 NAA+2% sucrose+1% glucose]]>

[0121] Table 5 Effects of different proliferation media on adventitious bud regeneration

[0122]

[0123] Note: Different letters in the table indicate significant differences, P<0.05.

[0124] Table 5 and Figure 4 The results showed that the regeneration rate of adventitious buds was significantly different among the three proliferation media (p<0.05). -1 The callus in the culture medium had almost no adventitious bud regeneration, but the callus proliferation rate was slow and the number of proliferating callus was small; the 6-BA concentration was 1.5 mg·L -1The callus in the culture medium proliferated faster, the number of proliferating callus was larger, and the proliferating state was good. Only a small amount of callus regenerated adventitious buds, and the regeneration rate was 8.89%; the 6-BA concentration was 2 mg·L -1 The callus in the culture medium proliferated fastest and had the most proliferating callus, but most of the callus had regenerated adventitious buds, with a regeneration rate of 48.89%. Therefore, the 6-BA concentration was 1.5 mg·L -1 The culture medium is most suitable for the proliferation culture of Bali pineapple callus.

[0125] After co-culture, Timedin was selected as the antibacterial antibiotic to screen the optimal Timedin antibacterial concentration. Three Timedin concentration gradients were set, namely 100 mg·L -1 , 200mg·L -1 , 400mg·L -1 The three different screening media obtained are shown in Table 6. The contamination of embryonic callus and the effect of different concentrations of Timedin on resistant adventitious buds were observed. The results are shown in Tables 7 and Figure 6 shown.

[0126] Table 6 Composition of different screening media

[0127] No. Medium 1 <![CDATA[MS+2.0mg·L -1 6-BA+1.0mg·L -1 NAA+400mg·L -1 Timentin + 1.0mg·L -1 PPT + 3% sucrose]]> 2 <![CDATA[MS+2.0mg·L -1 6-BA+1.0mg·L -1 NAA+400mg·L -1 Timentin + 1.5mg·L -1 PPT + 3% sucrose]]> 3 <![CDATA[MS+2.0mg·L -1 6-BA+1.0mg·L -1 NAA+400mg·L -1 Timentin +2.0mg·L -1 PPT + 3% sucrose]]>

[0128] Table 7 Effects of different Timedin concentrations on embryonic callus contamination

[0129]

[0130] Note: Different letters in the table indicate significant differences, P<0.05.

[0131] Table 7 and Figure 5 As shown, the concentration of Timedin is 100 mg·L -1 In the culture medium, the embryonic callus contamination rate was high, 81.11%, and the regeneration of adventitious buds was inhibited; the concentration of timetin was 400 mg·L -1 In the culture medium, the contamination rate of embryonic callus was extremely low, only 1.11%, and the embryonic callus could differentiate into adventitious buds normally. -1 Temedin has the best antibacterial effect and does not affect the regeneration of adventitious buds.

[0132] After co-culture, PPT resistance screening culture was performed. Three PPT concentration gradients were set up, 1 mg·L -1 、1.5mg·L -1 , 2mg·L -1 ) to obtain three different screening media as shown in Table 8. After 60 days of culture, the effects of screening media with different PPT concentrations on callus regeneration were observed. The results are shown in Tables 9 and Figure 6 shown.

[0133] Table 8 Screening medium with different PPT concentrations

[0134] serial number Medium 1 <![CDATA[MS+2.0mg·L -1 6-BA+1.0mg·L -1 NAA+400mg·L -1 Timentin + 1.0mg·L -1 PPT + 3% sucrose]]> 2 <![CDATA[MS+2.0mg·L -1 6-BA+1.0mg·L -1 NAA+400mg·L -1 Timentin + 1.5mg·L -1 PPT + 3% sucrose]]> 3 <![CDATA[MS+2.0mg·L -1 6-BA+1.0mg·L -1 NAA+400mg·L -1 Timentin +2.0mg·L -1 PPT + 3% sucrose]]>

[0135] Table 9 Regeneration of resistant adventitious buds under different PPT concentrations

[0136]

[0137] Note: Different letters in the table indicate significant differences, P<0.05.

[0138] Table 9 and Figure 6 The results showed that as the PPT concentration increased, the number of calli with browning or adventitious bud death increased significantly, and the regeneration rate of resistant adventitious buds decreased significantly. -1 In the screening medium, a large number of embryonic calli turned light green or differentiated into green adventitious buds. The regeneration rate of resistant adventitious buds was the highest, at 64.44%, and the calli with browning or adventitious bud death were relatively few. -1 In the screening medium, some embryonic calli turned light green or differentiated into green adventitious buds, while most embryonic calli turned brown or the adventitious buds died. The regeneration rate of resistant adventitious buds was 18.89%. -1 In the screening medium, very few embryonic calli turned light green or differentiated into green adventitious buds, most embryonic calli turned brown or adventitious buds died, and the regeneration rate of resistant adventitious buds was the lowest, only 2.22%. It can be seen that adding 1.5 mg·L -1 The PPT of was the best screening pressure, under which not only the resistant adventitious buds could be well screened out, but also it was conducive to the rapid identification of the edited plants in the later stage.

[0139] The pineapple CRISPR / Cas9 gene editing vector obtained in Example 1 was transformed into Bali pineapple embryonic callus (somatic embryonic tissue obtained by co-cultivation according to the above-mentioned culture method) using the Agrobacterium-mediated method, and then screened for PPT resistance (screening medium was MS + 1.5 mg·L -1 6-BA, 1.0mg·L -1 NAA, 400mg·L -1 Timentin, 1.5mg·L -1 PPT, 3% sucrose, 8 g / L agar, pH adjusted to 5.9), rooting culture (rooting medium is the rooting medium shown in Table 3) and plant transplanting to obtain 29 AcCWIN1 editing resistant plants. The results are as follows Figure 7 shown.

[0140] The genomic DNA of AcCWIN1 editing-resistant plants was extracted and PCR detection was performed using the screening marker bar. The PCR results were as follows: Figure 8 shown.

[0141] Figure 8 It showed that 26 out of 29 AcCWIN1-edited plants could amplify the target band.

[0142] PCR amplification was performed using the detection primers shown in SEQ ID NOs: 15 to 16. The amplification results are shown in FIG. Figures 9-10 shown.

[0143] Figures 9-10 The results show that a total of 11 pineapple directional editing-resistant plants were obtained. These editing-resistant plants all had only one target band, and the band size was consistent with the wild type (WT), indicating that these editing-resistant plants were all single-target site mutants. The remaining numbers in the figure are the numbers when screening 29 AcCWIN1 editing-resistant plants.

[0144] The PCR products of 11 pineapple targeted editing-resistant plants were recovered and sequenced, and the editing status of the two target sites in the targeted editing-resistant plants was analyzed. Fig.11 shown. Fig.11 Among the 11 pineapple directed editing resistant plants, except for one plant that was edited at the second target site, the rest were edited at the first target site. It can be seen that the two target sites screened have different editing efficiencies, among which the editing efficiency of the first target site is significantly higher than that of the second target site.

[0145] The PCR amplification products of 11 pineapple plants with directed editing resistance were connected to the T vector and subjected to single clone sequencing. The AcCWIN1 editing type and genotype were analyzed based on the target site sequence comparison results. Fig.12 shown.

[0146] Fig.12 The results showed that all 11 pineapple plants with directional editing resistance were base deletion editing types, of which 6 were single base deletion ( Fig.12 a, b), 4 strains had 2 base deletions ( Fig.12 c), and all 10 strains had frameshift mutations; one strain had 3 base deletions, and only 1 amino acid was missing ( Fig.12 d).

[0147] As can be seen from the above embodiments, the present invention provides a pineapple CRISPR / Cas9 gene editing vector and its construction method and application. According to the method of the present invention, a pineapple CRISPR / Cas9 gene editing technology system was established, and the AcCWIN1 editing homozygous strain was successfully obtained. The genotype of the edited strain was also identified, which provides technical guarantee for the directed genetic improvement of pineapple.

[0148] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A method for constructing a pineapple CRISPR / Cas9 gene editing vector, characterized in that: The steps include: (1) Using pineapple cDNA as a template, PCR amplification was performed using a specific primer pair for amplifying AcCWIN1 to obtain the cDNA sequence of AcCWIN1; (2) Designing target sites based on the cDNA sequence of AcCWIN1 to obtain target sites Target1 and Target2; (3) Screening the target site sequences to obtain a vector pMOD_B2312 with high promoter activity and dual target sites, and designing primers for amplifying the target fragment; (4) Using the pMOD_B2312 vector as a template, amplify the target fragment using primers to obtain the target fragment; (5) Insert the target fragment into the pMOD_B2312 vector using SapI and BsaI restriction enzymes to obtain module B; (6) Using Aar I endonuclease to simultaneously cut pMOD_A1110, pMOD_C0000, pTRANS_260d and module B, and connecting them using T4 ligase to obtain the pineapple CRISPR / Cas9 gene editing vector; The sequence of the Target1 target site is shown in SEQ ID NO: 4; The sequence of the Target2 target site is shown in SEQ ID NO:

5.

2. The construction method according to claim 1, characterized in that: The nucleotide sequences of the specific primer pair for amplifying AcCWIN1 in step (1) are shown in SEQ ID NOs: 1-2.

3. The construction method according to claim 2, characterized in that: The tool for designing target sites is CRISPOR; The tool for screening vectors with high promoter activity and dual targets is Crispr-multiplex.

4. The construction method according to claim 3, characterized in that: The primers for amplifying the target fragment include 3 pairs of primers; The first pair of primers is used to amplify target fragment 1, and the nucleotide sequence of the primer pair is shown in SEQ ID NOs: 6-7; The second pair of primers is used to amplify target fragment 2, and the nucleotide sequence of the primer pair is shown in SEQ ID NOs: 8-9; The third pair of primers is used to amplify target fragment 3, and the nucleotide sequences of the primer pair are shown in SEQ ID NOs: 10-11.

5. The construction method according to claim 4, characterized in that: The nucleotide sequences of target fragments 1 to 3 are shown in SEQ ID NOs: 12 to 14.

6. The pineapple CRISPR / Cas9 gene editing vector constructed by the construction method according to any one of claims 1 to 5.

7. Use of the pineapple CRISPR / Cas9 gene editing vector constructed by the construction method according to any one of claims 1 to 5 in pineapple directed genetic breeding or directed editing of pineapple genes.

8. Use of the pineapple CRISPR / Cas9 gene editing vector described in claim 6 in pineapple directed genetic breeding or directed editing of pineapple genes.

9. A method for directed editing of pineapple resistant plants, characterized in that: The method comprises the following steps: using a pineapple CRISPR / Cas9 gene editing vector to transform pineapple embryonic callus, and obtaining pineapple directed editing resistant plants through PPT resistance screening and rooting culture; The pineapple CRISPR / Cas9 gene editing vector is a pineapple CRISPR / Cas9 gene editing vector constructed according to the construction method of any one of claims 1 to 5 or the pineapple CRISPR / Cas9 gene editing vector according to claim 6.

10. The method according to claim 9, characterized in that The transformation method is Agrobacterium-mediated transformation.

Images