T cell specific membrane fusion type virus-like particle as well as preparation method and application thereof

Abstract

The invention discloses T cell specific membrane fusion type virus-like particles as well as a preparation method and application thereof. The T cell specific membrane fusion type virus-like particles are prepared by instantaneously transfecting expression plasmids of human T cell specific membrane fusion protein, expression plasmids of mRNA (messenger Ribonucleic Acid) loading protein and expression plasmids of CAR (Chimeric Antigen Receptor) mRNA into 293T cells, the molar ratio of the expression plasmid of the mRNA loaded protein to the expression plasmid of the CAR mRNA is 1: (2-4). The T cell specific membrane fusion type virus-like particles are produced by utilizing a virus budding mechanism, a loaded CAR mRNA drug can be specifically delivered into cytoplasm of T cells, CAR-T cells are instantly generated, the preparation process of a CAR-T cell product is greatly simplified, the treatment cycle is shortened, tumor cells can be accurately targeted and killed, and the treatment effect is good. The T cell activity and the anti-tumor effect are obviously enhanced, the generation of cytokine storm in in-vivo treatment is expected to be reduced, and the safety is improved.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and more specifically, the present invention relates to a T cell-specific membrane fusion virus-mimicking particle for producing human CAR-T cells in vivo, and a preparation method and application thereof. Background Art

[0002] Chimeric Antigen Receptor (CAR) T cell therapy is a precision targeted therapy for tumors, which has achieved remarkable clinical efficacy. Among them, the chimeric antigen receptor is artificially constructed and mainly consists of three domains: an extracellular targeting binding domain, a transmembrane region, and one or more intracellular signaling domains. In recent years, the number of clinical trials related to CAR-T cell therapy has grown rapidly. Since the U.S. Food and Drug Administration (FDA) approved the first CAR-T cell drug in 2017, fifteen CAR-T cell drugs have been approved for marketing worldwide, two of which are in China.

[0003] So far, all CAR-T cell therapy drugs that have been marketed need to prepare T cells in vitro, and the steps include isolating T cells from the patient, transducing the CAR gene into T cells through viral vectors, and then activating and amplifying these T cells, and finally returning them to the patient. CAR-T cell therapy is a highly personalized treatment method. Each patient is a separate batch, which cannot be mass-produced, and has strict requirements on operators and production environment. In addition, its preparation process is time-consuming, so it may delay the condition of tumor patients and limit the application of CAR-T cell therapy. In addition, the side effects of CAR-T cell therapy cannot be ignored, especially cytokine release syndrome (CRS), whose clinical manifestations include fever, tachycardia, hypoxia and other organ dysfunction, which can be fatal in severe cases. In order to alleviate CRS, corticosteroids can only be used clinically to temporarily suppress some inflammatory responses in the body, and inflammation cannot be eliminated from the root. In addition, in clinical CAR-T cell therapy, there is also the risk of viral vectors being inserted into the host cell genome, leading to genotoxic problems such as insertion mutations, activation of proto-oncogenes, and ectopic gene expression.

[0004] In order to solve the problem of complicated CAR-T cell preparation process, some researchers have begun to try to prepare CAR-T cells in vivo. Waqas Nawaz et al. used adeno-associated virus to deliver CAR genes targeting CD4, which can produce CAR-T cells with targeted killing activity and have significant therapeutic effects on T-cell lymphoma. However, this preparation method still produces continuous activation of CAR-T cells in vivo, leading to side effects such as cytokine storm. Some studies have prepared short-term CAR-T cells with controllable expression by transiently transfecting CARmRNA into T cells. Researchers in the MTStephan research group used lipid nanoparticles such as LNP (LipidNanoparticles) to encapsulate CAR mRNA and used transient transfection to generate CAR-T cells in vivo for a short period of time, hoping to achieve safer therapeutic effects. LNP can effectively protect mRNA in a physiological environment, and can enter cells through endocytosis and destroy endosomes in an acidified environment with the help of ionizable lipids, thereby delivering mRNA to the cytoplasm. However, systemically administered LNPs are mainly enriched in the liver, making it difficult to target other tissue cells. In addition, LNPs mainly rely on passive uptake mechanisms to enter cells. They are often trapped in endosomes within cells, and the proportion of those that can successfully escape from endosomal structures is low, ultimately resulting in the degradation of most mRNAs, which cannot be released into the cytoplasm to exert their effects.

[0005] HIV efficiently delivers its genomic RNA to the cytoplasm of T cells through the "active recognition triggering membrane fusion" mechanism. HIV uses the gp120 subunit of the human membrane fusion protein gp160 on the envelope to recognize the CD4 molecule of T cells, and generates fusion holes on the cell membrane through the gp41 subunit, allowing the viral envelope and the T cell membrane to fuse with each other, thereby directly delivering the genomic RNA to the cytoplasm for efficient infection. This mechanism provides an idea for designing efficient mRNA drug delivery vectors.

[0006] Studies have shown that virus-like particles constructed by simulating RNA viruses can be used to deliver mRNA drugs. For example, some studies use the capsid proteins Peg10 or Gag-MS2 of endogenous retroviruses to encapsulate mRNA, and induce endosomal membrane fusion through the membrane fusion protein VSV-G to deliver mRNA to the cytoplasm. However, existing virus-like particles lack the ability to "actively recognize and trigger membrane fusion", resulting in insufficient cell specificity and delivery efficiency, making it difficult to deliver mRNA to T cells in a targeted manner.

[0007] Therefore, there is still a need to develop virus-like particles that can accurately and efficiently deliver mRNA drugs directly to T cells and produce human CAR-T cells in vivo. Summary of the invention

[0008] Based on this, the purpose of the present invention is to provide a T cell-specific membrane fusion virus-like particle and its preparation method and application. The virus-like particle of the present invention can directly deliver CAR mRNA drugs to T cells accurately and efficiently, and effectively and quickly prepare transient human CAR-T cells in vivo.

[0009] The specific technical solutions for achieving the above-mentioned invention objectives include the following.

[0010] In the first aspect of the present invention, a T cell-specific membrane fusion virus-like particle is disclosed, which is prepared by transiently transfecting an expression plasmid of a human T cell-specific membrane fusion protein, an expression plasmid of an mRNA-loaded protein, and an expression plasmid of a CAR mRNA into 293T cells; the molar ratio of the expression plasmid of the human T cell-specific membrane fusion protein to the expression plasmid of the mRNA-loaded protein is 1:1.8-2.2; the molar ratio of the expression plasmid of the mRNA-loaded protein to the expression plasmid of the CAR mRNA is 1:2-4.

[0011] The second aspect of the present invention discloses a method for preparing the above-mentioned T cell-specific membrane fusion virus-mimicking particles, comprising the following steps:

[0012] (1) Constructing the expression plasmid of human T cell-specific membrane fusion protein, the expression plasmid of mRNA-loaded protein, and the expression plasmid of UTR-anti-human CD19 CAR;

[0013] (2) The three expression plasmids constructed in step (1) are transiently transfected into 293T cells and incubated for 45 h to 55 h, followed by ultracentrifugation and purification.

[0014] The third aspect of the present invention discloses the use of the above-mentioned T cell-specific membrane fusion virus-mimicking particles in the preparation of drugs for treating tumors.

[0015] The T cell-specific membrane fusion-type virus-like particles of the present invention are prepared by transiently transfecting the expression plasmid of human T cell-specific membrane fusion protein, the expression plasmid of mRNA loaded protein and the expression plasmid of CAR mRNA into 293T cells according to a certain molar ratio, and utilizing the viral budding mechanism. The T cell-specific membrane fusion-type virus-like particles can efficiently fuse with the T cell membrane with the help of the human T cell-specific membrane fusion protein, thereby specifically delivering the loaded CAR mRNA drug to the cytoplasm of the T cell (bypassing the endosome pathway, reducing the low drug delivery efficiency and liver toxicity problems when delivering mRNA drugs, and effectively improving the stability and targeting of CAR mRNA to T cells) to prepare CAR-T cells, and the CAR-T cells are generated transiently and will not continuously activate the CAR-T cells (being able to achieve rapid and efficient induction of CAR protein expression while avoiding genome integration and providing rapid response, improving the safety and controllability of treatment). The T cell-specific membrane fusion-type virus-like particles prepared by the present invention can specifically deliver CAR mRNA drugs (such as anti-human CD19) in vivo (or in vitro) by intravenous injection. CAR mRNA, etc.) is delivered to T cells to achieve specific expression of CAR protein in T cells, so that T cells can be transformed into CAR-T cells in situ in vivo, which greatly simplifies the preparation process of CAR-T cell products, shortens the treatment cycle, and can accurately target and kill tumor cells, significantly enhance T cell activity and anti-tumor effects, and is expected to reduce the occurrence of cytokine storms during in vivo treatment and improve safety. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 For the preparation of T cell-specific membrane fusion virus-like particles (T-FVLP) in Example 1 of the present invention mCAR ) Schematic diagram of the desired plasmid.

[0017] Figure 2 The T-FVLP is a T cell-specific membrane fusion virus-like particle (T-FVLP) in Example 2 of the present invention. mCAR ) preparation and characterization results; A is the preparation method; B is the particle size of different groups of virus-mimicking particles; C is the yield of different groups of virus-mimicking particles; D is the protein map of different groups of virus-mimicking particles.

[0018] Figure 3 The T-FVLP is a T cell-specific membrane fusion virus-like particle (T-FVLP) in Example 3 of the present invention. mCAR ) loading efficiency optimization result diagram; wherein, A is the loading efficiency result of CAR mRNA at different molar ratios of pCMV-Peg10 expression plasmid and pCMV-UTR-anti-human CD19 CAR expression plasmid; B is the result of the ratio of particles encapsulating CAR mRNA.

[0019] Figure 4 The T-cell specific membrane fusion virus-like particles (T-FVLP) in Example 4 of the present invention mCAR ) of T cell-specific membrane fusion and its efficiency detection results; wherein, A is the fluorescence signal diagram; B is the fusion efficiency result.

[0020] Figure 5 The T-cell specific membrane fusion virus-like particles (T-FVLP) in Example 5 of the present invention mCAR )'s mRNA delivery efficiency and the proportion of CAR-T cells produced; wherein, A is the red fluorescent protein expression result; B is the result of Western blot detection of CAR protein expression; C is the proportion of T cells expressing CAR protein.

[0021] Figure 6 The T-cell specific membrane fusion virus-like particles (T-FVLP) in Example 6 of the present invention mCAR ) Expression duration detection results of CAR-T cells produced.

[0022] Figure 7 The T-cell specific membrane fusion virus-like particle (T-FVLP) in Example 7 of the present invention mCAR )The results of the test on the ability of CAR-T cells to kill tumor cells.

[0023] Figure 8 The T-cell specific membrane fusion virus-like particles (T-FVLP) in Example 8 of the present invention mCAR ) The results of the growth detection of Raji-Luc B cell lymphoma in humanized mice after treatment with CAR-T cells produced in vivo; wherein A is the bioluminescence signal graph; B is the fluorescence intensity statistical graph.

[0024] Fig. 9 The T-cell specific membrane fusion virus-like particles (T-FVLP) in Example 9 of the present invention mCAR ) in vivo safety evaluation test results of CAR-T cells produced by the experiment; A is the levels of major inflammatory cytokines IL-1β, IL-6 and GM-CSF; B is the H&E stained tissue image of the forehead and hippocampus. DETAILED DESCRIPTION

[0025] In order to facilitate the understanding of the present invention, the present invention will be described more fully below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0026] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those commonly understood by those skilled in the art to which the present invention belongs. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The term "and / or" used in the present invention includes any and all combinations of one or more of the related listed items.

[0027] Unless otherwise specified, the examples are all based on conventional experimental conditions, such as Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual, 2001, or the conditions recommended by the manufacturer's instructions. All raw materials and / or reagents are purchased on the market or prepared according to conventional methods well known to those skilled in the art.

[0028] In some embodiments of the present invention, a T cell-specific membrane fusion virus-like particle is disclosed, which is prepared by transiently transfecting an expression plasmid of a human T cell-specific membrane fusion protein, an expression plasmid of an mRNA-loaded protein, and an expression plasmid of a CAR mRNA into 293T cells; the molar ratio of the expression plasmid of the human T cell-specific membrane fusion protein to the expression plasmid of the mRNA-loaded protein is 1:1.8-2.2; the molar ratio of the expression plasmid of the mRNA-loaded protein to the expression plasmid of the CAR mRNA is 1:2-4.

[0029] In some of the embodiments, the molar ratio of the expression plasmid of the mRNA loading protein to the expression plasmid of the CAR mRNA is 1:3-4, more preferably 1:3.

[0030] In some of the embodiments, the human T cell-specific membrane fusion protein is obtained by introducing mutations into the gene sequence of the targeting subunit of HIV virus gp160, measles virus MV-H / MV-F or vesicular stomatitis virus VSV-G to remove the original receptor recognition ability (for example, introducing amino acid mutations at multiple sites of the recognition subunit gp120 of gp160, introducing Y481A and R533A mutations into the H protein of MV-H / MV-F, or introducing K47A and R354A mutations into the VSVG protein), and then using the synthetic biology method to connect anti-CD3, anti-CD4, anti-CD8 and other scFv to the extracellular end of the corresponding targeting subunit. The anti-CD3, anti-CD4, anti-CD8 and other scFv sequences are mainly obtained by intercepting the heavy chain variable region and light chain variable region sequences of the antibody from the sequences of the anti-human CD3, CD4, CD8 monoclonal antibodies disclosed in the IMGT database, and connecting them through flexible short peptides.

[0031] In some of the embodiments, the human T cell-specific membrane fusion protein is obtained by connecting the anti-CD3 scFv with a sequence as shown in SEQ ID NO: 2 to the extracellular end of the mutated gp160 gene with a sequence as shown in SEQ ID NO: 1.

[0032] In some of these embodiments, the mRNA loading protein includes mRNA loading protein Peg10 and mRNA loading protein Gag-MS2 or mRNA loading protein Gag-Tat.

[0033] In some of the embodiments, the nucleotide sequence of the protein Peg10 is shown in SEQ ID NO: 3. Peg10 is derived from the capsid protein of endogenous retrovirus, which recognizes and encapsulates CARmRNA carrying the corresponding loading signal UTR sequence. In addition, the HIV capsid protein Gag can be connected with the phage capsid protein MS2 or the transactivation protein Tat by synthetic biology methods to obtain new capsid proteins such as Gag-MS2 and Gag-Tat. Similarly, Gag-MS2 and Gag-Tat can also recognize and encapsulate MS2 loop-CAR mRNA and TAR-CAR mRNA carrying their corresponding loading signals, respectively.

[0034] In some of the embodiments, the CAR mRNA has a specific UTR signal and carries anti-CD19 or anti-EGFRvIII targeting human tumor cell targets, and the CAR protein that can be expressed is anti-CD19 protein or anti-EGFRvIII CAR protein.

[0035] In some of the embodiments, the CAR mRNA has a specific UTR signal and carries anti-CD19 targeting human tumor cell targets, and its sequence is shown in SEQ ID NO:4.

[0036] In other embodiments of the present invention, a method for preparing the above-mentioned T cell-specific membrane fusion virus-mimicking particles is disclosed, comprising the following steps:

[0037] (1) constructing an expression plasmid for human T cell-specific membrane fusion protein, an expression plasmid for mRNA-loaded protein, and an expression plasmid for CAR mRNA;

[0038] (2) The three expression plasmids constructed in step (1) are transiently transfected into 293T cells and incubated for 45 h to 55 h, followed by ultracentrifugation and purification.

[0039] In some embodiments, the method for preparing the T cell-specific membrane fusion virus-like particles comprises the following steps:

[0040] (1) Constructing the expression plasmid of human T cell-specific membrane fusion protein anti-CD3 scFv-mut gp160, the expression plasmid of mRNA loading protein Peg10, and the expression plasmid of UTR-anti-human CD19 CAR mRNA;

[0041] (2) The three expression plasmids constructed in step (1) are transiently transfected into 293T cells and incubated for 45 h to 55 h, followed by ultracentrifugation and purification.

[0042] In a specific embodiment of the present invention, the gene fragments of human T cell-specific membrane fusion protein anti-CD3 scFv-mut gp160, mRNA loading protein Peg10 and UTR-anti-human CD19 CAR mRNA are first synthesized by a biological method, introduced into an expression plasmid and sequenced for verification; then the three expression plasmids are transiently transfected together to obtain an engineered cell that can simultaneously express the human T cell-specific membrane fusion protein anti-CD3scFv-mut gp160, mRNA loading protein Peg10 and UTR-anti-human CD19 CAR mRNA; the three components are assembled and budded in the engineered cells, separated and purified by ultracentrifugation, and a highly efficient loaded CAR can be obtained. mRNA T cell-specific membrane fusion virus-like particles (CAR molecules are mainly composed of three parts: the extracellular segment, the transmembrane segment, and the intracellular segment of the human sequence. The extracellular segment is the single-chain variable region (scFv) of the antibody targeting the human target, targeting hematological tumors, solid tumors, immune cells, viruses and other targets, and is mainly responsible for identifying and binding to specific antigens on the surface of the tumor; when the CAR-T cells and tumor cells are combined, the intracellular segment is responsible for signal transduction and completes T cell activation and effector function). The average particle size of the virus-like particles is about 90nm.

[0043] In other embodiments of the present invention, the use of the above-mentioned T cell-specific membrane fusion virus-mimicking particles in the preparation of drugs for treating tumors is disclosed.

[0044] In the following examples, the sources of the raw materials used are as follows: tryptone, yeast extract, and bovine serum albumin (BSA) were purchased from Shanghai Shenggong Bioengineering Co., Ltd.; DMEM cell culture medium, fetal bovine serum, and 0.25% trypsin were purchased from Gibco, USA; PEI was purchased from Shanghai Li Ji Biotechnology Co., Ltd.; RIPA cell lysis buffer was purchased from Shanghai Biyuntian Biotechnology Co., Ltd.; BCA protein concentration determination kit and SYTO dye were purchased from Thermo, USA; Tween-20 was purchased from Sigma-Aldrich, USA; Peg10 antibody was purchased from Proteintech Group, USA; ECL color development system Western Blot substrate kit was purchased from Pierce, USA; DiI dye was purchased from Dalian Meilun Biotechnology Co., Ltd.; PE anti-human CD3, PerCP / Cy5.5 anti-human CD3, AF488 anti-human CD11b, BV421 anti-human CD19, AF647 anti-Myc tag flow cytometry antibodies, anti-human CD3, anti-human CD28 antibody, Anti-human GAPDH, Anti-gp160, Anti-Peg10, and Anti-Myc were purchased from Biolegend, USA; anti-Myc anti-human GAPDH antibodies were purchased from Beijing Sino-Biological Technology Co., Ltd.; anti-Myc tag antibody was purchased from CST, USA; NCG mice were purchased from Guangdong Yaokang Biotechnology Co., Ltd.; PBMCs were purchased from Shanghai Aoneng Biotechnology Co., Ltd.; CD3 sorting magnetic beads were purchased from Miltenyi Biotec, Germany; and fluorescein potassium salt was purchased from Dalian Meilun Biotechnology Co., Ltd.

[0045] In the following examples, the instruments used are from the following sources: Electronic balance: Model: ME204E, Mettler Toledo Group, Switzerland. Clean bench: model SW-CJ-1FD, Suzhou Antai Air Technology Co., Ltd.; inverted fluorescence microscope: model TS2, Nikon, Japan; ultra-low temperature refrigerator: model 995, Thermo, USA; -25℃ vertical low temperature preservation box: model DW-LY270, Zhongke Meiling Low Temperature Technology Co., Ltd.; carbon dioxide cell culture incubator: model 3111, Thermo, USA; small high-speed centrifuge: model Microfuge 20R, Eppendorf, Germany; floor-standing intelligent refrigerated ultracentrifuge: model Optima XPN-100, Beckman Coulter, USA; ultrapure water treatment device: model Millipore Milli-Q Direct, Merck, USA; nano flow detector: model NanoFCM U30, Guangzhou Lianbo Biotechnology Co., Ltd.; flow cytometer: model FACSCelesta, BD, USA; laser confocal scanning microscope: model LSM 880with Airyscan, Carl Zeiss, Germany; microplate reader: model 800TS, BioTek, USA; in vivo imaging system: model IVIS Lumina III, PerkinElmer, USA; Digital Pathology microscope: model Aperio CS2, Leica, USA.

[0046] In the present specification and the accompanying drawings, mCAR and CAR mRNA have the same meaning.

[0047] The present invention is described in detail below with reference to the accompanying drawings and specific embodiments.

[0048] Example 1 Construction and preparation of T cell-specific membrane fusion virus-like particles (T-FVLP mCAR ) Required plasmid

[0049] Please refer to Figure 1 By conventional biological methods, three preparation methods for T cell-specific membrane fusion virus-like particles (hereinafter referred to as T-FVLP) were constructed. mCAR )The desired plasmid.

[0050] 1. The anti-CD3 scFv gene sequence (SEQ ID NO: 2) was connected to the mutated gp160 gene sequence (SEQ ID NO: 1), and CMV was used as the promoter to construct the expression plasmid pCMV-T-FP for human T cell-specific membrane fusion protein (T-FP).

[0051] SEQ ID NO:1 (Mutated gp160 gene sequence)

[0052] atgagagtgaaggggatcaggaagaattatcagcacttgtggagatggggcaccatactccttgggatgttgatgatctgt

[0053] agtgctgcagatcaattgtgggtcacagtctattatggggtgcctgtgtggaaagaagcaaccaccactctattttgtgcatc

[0054] agatgctaaagcatatagtacagaggtacataatatttgggccacacatgcctgtgtacccacagaccccagcccacaaga

[0055] aatagtaatggaaaatgtgacagaagagttcaacatgtggaaaaataacatggtagaacagatgcatgaggatataatcag

[0056] tttatgggatgaaagcctaaagccatgtgtaaaattaactccactctgtgttactctaaattgcactactgagttgaatcttctaa

[0057] attgcattgataatagtactagtggtaataacactgataatagcactagtagtaatagtactgatgataaatgtataccgccag

[0058] atcaaaaaggaaaaatgaaaaactgctctttcaatatcaccgcaggcataagagataaggtgcggaaagaatatgcactttt

[0059] ttatacaagtgatgtagcaccaatagataatgatgctatcagttatagattgataagttgtaacacctcaatcattacacaggcc

[0060] tgtccaaaggtatcctttgagccaattcccatacactattgtgccccggctggttttgcgattctaaagtgtaaggataggaatt

[0061] tcaatggaacaggactatgtaaaaatgtcagcacagtacaatgtacacatggaattaggccagtagtatcaactcaactgct

[0062] gttaaatggcagtctggcaaaaaaagagatagtaattagatctgaaaatttcacggacaatgctaaaaccataaatagtacag

[0063] ctgcctgaaatagtacacattaattgtacaagacctaacaataatataagaaaaggtctacgtataggaccagggagagcat

[0064] ggtggtatgcaacaagaggaataataggaaaaatgagacaaacacattgcaacattagtagagaaaaatggaataacact

[0065] ttagaacagatagttaaaaaattaggagacaaatttgggactaataataataaaaacaataatatttaatcaatcctcaggaggg

[0066] gacccagaaattacaatgcacacttttaattgtggaggggaatttttttactgtaatacaacacaactgtttaatagtacttggat

[0067] tcggaatggtactgattggactcaaaatgatactgaaggatcagacatcactaacgaaaatatcacgctcccatgtagaata

[0068] aaacaaattataaacatgtggcaggaagtagggaaagcaatgtatgcccctcccatcagtggacaaattagctgttcatcaa

[0069] atattacagggctgctattaacacacgatggtgttgttggtctgtacacgaacgcgaacaacgtgaccttcagaccgggag

[0070] gaggaaatatgagggacaattggagaagtgaattatataaatataaagtaataaaagttgaaccaataggaatagcaccca

[0071] ccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctatgttccttgggttcttgggaac

[0072] agcaggaagcgctatgggcgcagcgtcagtgacgctgacggtacaagccagacaattattgtctggtatagtgcaacag

[0073] cagaacaatctgctgagggctattgaggcgcaacagcatatgttgcaactcacagtctggggcatcaagcagctccaggc

[0074] aagagtcctggctgtggaaagatacctaagggatcaacagctcctgggaatttggggttgctctggaaaactcatttgcacc

[0075] actgctgtgccttggaatagtagttggagtaatagatctctgggagacatttgggaaaatgataacatgacctggatgaagt

[0076] gggaaagagaaattgataattacacaagctatatatacaccttaattgaagaatcgcagaaccagcaagaaaagaatgaac

[0077] tagaattattggaattagacaaatgggacagtttgtggagttggtttagcataacaaactggctgtggtatataaaaatattcat

[0078] aatgatagtaggaggcttgataggtttaaaaatagtttttagtgtgctttctatagtgaatagagttaggcagggatactcacca

[0079] ttgtcgtttcagacccggcccccagccccgaggggacccgacaggcccgaaggaatcgaagaagaaggtggagagag

[0080] agacagagacagatccggcagattagtggatggattcttagcacttatctgggtcgacctgcggagcctgtgcctcttcag

[0081] ctaccaccgcttgagagacttactcttgattgcagcgaggattgtggaactcctgggacgcagggggtgggaagtcctca

[0082] agtattgttggaatctcctacagtactggagtcaggaactaaagaatagtgctgttagcttgcttaataccatagcaatagcag

[0083] tagctgaggggacagatagggttatagaaataatacaaagagcttgtagagctattctccacatacctagaagaataagac

[0084] agggctttgaaagggctttgctataa

[0085] SEQ ID NO:2 (anti - human CD3 scFv gene sequence)

[0086] atgtacagcatgcagctcgcatcctgtgtcacattgacacttgtgctccttgtcaacagcgaattcgatattcagctgaccca

[0087] gtctcctgccatcatgtctgcctctccaggcgagaaggtgaccatgacctgtagagcctcttcttctgtgtcttacatgaactg

[0088] gtatcagcagaagtctggaaccagccctaagagatggatctacgatacatccaaggtggcctctggcgtgccttacagatt

[0089] ctccggatctggctctggcacatcttactctctgacaatctcttctatggaggctgaggatgccgctacatactactgtcagca

[0090] gtggagctctaacccactgaccttcggagccggaaccaagctggagctgaaggtggatggcggcagcggcggctctgg

[0091] cggctctggaggctccggcggcgtggaggatattaagctgcagcagtctggcgctgagctggctagacctggcgcttct

[0092] gtgaagatgagctgtaagacctctggctacacattcaccagatacaccatgcactgggtgaagcagagacctggccagg

[0093] gcctggagtggatcggctacatcaaccctagcagaggctacaccaactacaaccagaagtttaaggataaggccacactg

[0094] accacagataagtctagctctaccgcttacatgcagctgtctagcctgacatctgaggattctgccgtgtactactgtgccag

[0095] atactacgatgatcactactgtctggattactggggccagggcaccaccctgaccgtgagctctggcggcggcggatcc

[0096] 2. Construct the expression plasmid pCMV-Peg10 that loads the mRNA with protein Peg10 (the gene sequence is shown as SEQ ID NO:3).

[0097] SEQ ID NO:3 (Gene sequence of Peg10)

[0098] atggctgctgcaggtggttcatcaaactgcccgccccctccccctccccctcctcccaacaacaacaacaacaacaacac

[0099] cccaaagagcccaggcgtgcctgacgccgaagatgatgatgaacgcagacacgatgagctccctgaagacatcaacaa

[0100] ctttgacgaagacatgaacaggcagtttgagaatatgaacctgctggatcaggtggagttgcttgcacagagctacagtct

[0101] gctggatcatttagatgactttgatgatgatgatgaagacgatgactttgatccagaacctgaccaggatgagctccctgagt

[0102] acagtgacgatgatgacctggagcttcagggtgctgcagcagcccctatcccaaactttttctccgatgatgactgccttga

[0103] agaccttcctgagaagttcgatggcaaccctgacatgctgggtcctttcatgtatcagtgccagctcttcatggaaaagagc

[0104] accagagatttctcagttgaccgcatccgtgtgtgcttcgtgacaagcatgctgatcggccgtgccgcccgctgggctact

[0105] gccaagctgcaaagatgtacttacctgatgcacaactacactgcctttatgatggagctgaagcatgtctttgaagaccctca

[0106] gagacgtgaagctgccaaacgcaagatcagacgtctgcgccagggccctgggcctgttgtggactactccaatgcattcc

[0107] agatgattgcccaggacctggattggactgagcctgccctgatggatcagttccaggaaggtctcaacccagacattcgc

[0108] gcagagctgtctcgccaggaggcccccaagaccctggctgctctgattactgcctgtattcacatcgagagaaggctggc

[0109] tcgtgacgctgctgcaaagcccgatccttcacccagagccttggtgatgcctccaaacagccagaccgatcccaccgagc

[0110] ctgtgggaggtgcccgcatgcgcctgtccaaggaagaaaaggagagacgccgcaaaatgaatttgtgtctctactgtggc

[0111] aatggaggccatttcgccgacacgtgtccagcgaaagcctccaagaattcgccgccgggaaactccccggccccgctgt

[0112] aaggggaccttcagcgacagggccagaacgaataaggtccccaccctccgaggcttcgactcagcacctgcaagtgat

[0113] gctccagattcatatgccgggcagacccaccctgtttgtccgagctatgattgattctggtgcatctggcaacttcattgatca

[0114] agactttgtcatacaaaatgcaattcctctcagaatcaaagactggccagtgatggtggaagctattgatgggcatccaattg

[0115] cctcgggcccaatcattttggaaacccaccacctgatagttgatctgggagaccaccgtgagatactgtcatttgatgtgact

[0116] cagtctccattctttcctattgtcctaggaattcgttggctctctactcacgacccacacatcacctggagtactcgctccatag

[0117] tcttcaactctgattactgtcggttgagatgccgaatgttcgctcagatcccaagcaacctgctctttaccgttccccaaccaa

[0118] atctccacccctatctcctgcatcatgtacacccccatgtacaccctcacatgcatcaacaccttcatcaacacctgcatcagt

[0119] ttcttcatcctgatccacatcagtatccacacccagacccccattaccatcatcaccagcaggctgatatgcagcatcagctg

[0120] caacagtatttgtatcagtacttgtactaccatctgtaccctgtcatgcatcatcatcttcctcctgaccaacatgaacatctgca

[0121] cgaatatcttcaccaatacctccatcagtaccttcaccaattcctccaccaccatcttcaccctgacttgcaccaatatttgtac

[0122] cagtatcttcacaaccacatgaatccagatccacatcaccatccccatccagatccccctcaggatccacatcaccctccac

[0123] atcaggatccacatcagcatccggatccccatcaggatcctccacatcaggatccacatcagcatccggatccccatcagg

[0124] atcctccacatcaggatccacatcagcatccggatccccatcaggatcctccacatcaggatccacatcaggatgcacatc

[0125] agcatcaggatccccatcaggatgcacatcaggatccacatcaggatgcacatcaggatccccatatggatccacacctg

[0126] catcagcaccagcatccgcagccgcagccgcatccacaacagcatcctaaccatcctcagcagccaccattcttctacca

[0127] catggctggattcagaatttaccaccctgtaaggtattactatattcagaatgtgtatacacctgttgatgagcatgtctatccg

[0128] ggtcaccgggtggttgaccctaacattgagatgattcctggagcgcacagcctgcccagtggacatttgtactcaatgtctg

[0129] agtctgaaatgaatgctctgcgaaatttcgtggacaggaatgttaaagatgggctcatgactcccactgtggcgcccaatgg

[0130] agcccaagtcctgcaagtgaaaagagggtggaaactccaagtcacttacaattgccgagctccacagagtggcaccatcc

[0131] aaaatcagtacctacgcatgtctcttccaaatatgggagaccctgcacacctggcaagctatggtgaatttgtccaagttcct

[0132] ggctacccatatccagcctatgtttactatacaagcccgcatatgatgactgcgtggtacccagtaggacgagatgtacatg

[0133] gacgaataatcgttgtgcctgttgtaatcacctggtctcaaaatacgaaccgccagcctccggtgccccagtatcctcctcc

[0134] gcagccacctccaccaccaccaccacctccaccgccaccaccacctccaccagcatcatcctgcagtgctgcg

[0135] 3. Design the mRNA loading signal UTR and anti-human-CD19 CAR gene sequence (SEQ ID NO: 4), and construct the expression plasmid pCMV-UTR-anti-human CD19 CAR of UTR-anti-human CD19 CAR.

[0136] SEQ ID NO: 4 (UTR-anti-human CD19 CAR gene sequence)

[0137] ggatttggcgccccccctcctaggatctctctatataaggcaagcagtccggactcccgatacacgcgtttccaacttgagtt

[0138] ggtgtgtgtcgaagaatcctgaccaactacgacctggggagagcagccaaccgagaaggtccaccgagcctcgcctag

[0139] gtctgctgcgcgggctgcggtccggagccttctccggaccgcggtcacccagtggaccgggccgtcgcgggacccctc

[0140] atccttcgtggcatcgcagaggaatcctcgtgtggaacaggcgggttttaagaaccaaaagacgccaaccacgagggtc

[0141] ccaggatccagggctccctccccaggggagtgaagcccctctcaccgcagccatgcttctcctggtgacaagccttctgc

[0142] tctgtgagttaccacacccagcattcctcctgatcccagacatccagatgacacagactacatcctccctgtctgcctctctg

[0143] ggagacagagtcaccatcagttgcagggcaagtcaggacattagtaaatatttaaattggtatcagcagaaaccagatgga

[0144] actgttaaactcctgatctaccatacatcaagattacactcaggagtcccatcaaggttcagtggcagtgggtctggaacag

[0145] attattctctcaccattagcaacctggagcaagaagatattgccacttacttttgccaacagggtaatacgcttccgtacacgtt

[0146] cggaggggggactaagttggaaataacaggctccacctctggatccggcaagcccggatctggcgagggatccaccaa

[0147] gggcgaggtgaaactgcaggagtcaggacctggcctggtggcgccctcacagagcctgtccgtcacatgcactgtctca

[0148] ggggtctcattacccgactatggtgtaagctggattcgccagcctccacgaaagggtctggagtggctgggagtaatatgg

[0149] ggtagtgaaaccacatactataattcagctctcaaatccagactgaccatcatcaaggacaactccaagagccaagttttctt

[0150] aaaaatgaacagtctgcaaactgatgacacagccatttactactgtgccaaacattattactacggtggtagctatgctatgg

[0151] actactggggtcaaggaacctcagtcaccgtctcctcagagcagaagctgatcagcgaggaggacctggcggccgcaa

[0152] ttgaagttatgtatcctcctccttacctagacaatgagaagagcaatggaaccattatccatgtgaaagggaaacacctttgtc

[0153] caagtcccctatttcccggaccttctaagcccttttgggtgctggtggtggttgggggagtcctggcttgctatagcttgctag

[0154] taacagtggcctttattattttctgggtgaggagtaagaggagcaggctcctgcacagtgactacatgaacatgactccccg

[0155] ccgccccgggcccacccgcaagcattaccagccctatgccccaccacgcgacttcgcagcctatcgctccagagtgaag

[0156] ttcagcaggagcgcagacgcccccgcgtaccagcagggccagaaccagctctataacgagctcaatctaggacgaaga

[0157] gaggagtacgatgttttggacaagagacgtggccgggaccctgagatggggggaaagccgagaaggaagaaccctca

[0158] ggaaggcctgtacaatgaactgcagaaagataagatggcggaggcctacagtgagattgggatgaaaggcgagcgcc

[0159] ggaggggcaaggggcacgatggcctttaccagggtctcagtacagccaccaaggacacctacgacgcccttcacatgc

[0160] aggccctgccccctcgcgaattctaagtaacatcctgcagtgctgcgtgaaacctgtcatgtcctttgtagtctctgccctca

[0161] acttgatcctgtgcagcttctcaatctatgactgtgtggtactggaccttcagaggcgcacagagctcaagtcagttttcgtctt

[0162] gactgccactttataagttgacaggcctgggttttacttgttaaaacctctcaccatctcaatcacaggctgccaagtgtcttta

[0163] caaagaagctgatacaaacacaggccatgctgatttcttacagaggggagagaagaggaagagaagaagaaagaggag

[0164] gaagaggacatgacttgcccatatgctgggcaccttataaaggaagccagacttttcggtgcagtatggaaaggcttccgt

[0165] gattctcttgctgcaccccacgaaacttcaccaccttcaaactccattttcacggttccgttaattttcaaggagcagcaactcg

[0166] actggttctctgctacatgaaacacctcagcttgaaaaggaagtgctctctcagactgacttgtgagtgtgccttcacattctg

[0167] gtgcaaatcatg

[0168] Example 2 T cell-specific membrane fusion virus-like particles (T-FVLP mCAR ) preparation and characterization

[0169] Using PEI transfection reagent, the three expression plasmids pCMV-T-FP, pCMV-Peg10, and pCMV-UTR-anti-human CD19 CAR constructed in Example 1 were transiently transfected into 293T cells. After 48 hours, the cell supernatant was collected, centrifuged at 1000g for 10 minutes, and then filtered with a 0.45μm sterile filter membrane, and ultracentrifuged at 150000g for 100 minutes at 4°C. Resuspend the centrifuged precipitate with sterile 1xPBS, stand at 4°C for 1 hour, and then centrifuge at 3000rpm for 5 minutes. The resulting supernatant is the T cell-specific membrane fusion virus-like particle T-FVLP. mCAR .

[0170] The virus-like particles VLP (plasmid pCMV-Peg10 was transiently transfected into 293T cells, and the other preparation steps were the same as T-FVLP mCAR ) and VLP mCAR (The plasmids pCMV-Peg10 and pCMV-UTR-anti-human CD19 CAR were transiently transfected into 293T cells simultaneously. The other preparation steps were the same as T-FVLP mCAR ) as control.

[0171] T-FVLP mCAR Preparation method Figure 2 As shown in A, the characterization results of each group are as follows Figure 2 As shown in B to D in Figure 1, nano-flow cytometry showed that T-FVLP mCAR The particle size is about 90 nm and the yield is 1.5×10 8 / 10 7 cells, compared with the VLP group and VLP mCAR There was no significant difference between the groups ( Figure 2 B and C). Western blot results showed that T-FVLP mCAR The simultaneous expression of T-FP and Peg10 proteins indicated that the prepared T-FVLP mCAR Contains anti-CD3 scFv-gp160 and Peg10, while VLP and VLP mCAR It only contains Peg10 component, does not contain anti-CD3 scFv-gp160 component, and has no human T cell-specific membrane fusion protein modification on its surface ( Figure 2 D).

[0172] Example 3 T cell-specific membrane fusion virus-like particles (T-FVLP mCAR ) loading efficiency optimization

[0173] This embodiment explores T-FVLP mCAR Effect of the transfection molar ratio of pCMV-Peg10 to pCMV-UTR-anti-humanCD19 CAR on the loading efficiency of CAR mRNA during the preparation process.

[0174] Use PEI transfection reagent to 1 × 10 7 4 μg pCMV-T-FP, 6 μg pCMV-Peg10 and pCMV-UTR-anti-human CD19 CAR plasmids of different weights were transiently transferred into 293T cells. After 48 hours, the cell supernatant was collected to obtain T-FVLP mCARThe cells were lysed (the operation method was the same as in Example 2), and the loading amount of CAR mRNA was detected by fluorescence quantitative PCR.

[0175] The experimental results are as follows Figure 3 As shown, when the molar ratio of the two plasmids was 1:3, T-FVLP mCAR The loading efficiency of CAR mRNA is the highest, 1.5×10 8 T-FVLP mCAR 5ng of CAR mRNA can be loaded, which is significantly higher than the loading efficiency when the molar ratio of the two plasmids is 1:1 and 1:2 ( Figure 3 A). Nearly 100% T-FVLP was detected by nano-flow cytometry. mCAR All of them effectively encapsulate CAR mRNA; VLP mCAR Since the CAR mRNA contains the UTR sequence, the CAR mRNA is almost completely and effectively packaged; however, a part of the VLP may randomly package its own mRNA ( Figure 3 Example 4 T cell-specific membrane fusion virus-like particles (T-FVLP) mCAR ) T cell-specific membrane fusion and its efficiency

[0176] The frozen human peripheral blood mononuclear cells (PBMC) (Shanghai Aoneng Biotechnology Co., Ltd.) were thawed in a water bath and placed in an incubator overnight. Anti-human CD3 and anti-human CD28 antibodies were added to stimulate activation. 5×10 5 After activation, DiD-labeled VLPs were added to mCAR 、T-FVLP mCAR After 12 hours of incubation, the cells were collected; the antibodies were blocked and stained (PEαCD3, AF488αCD11b, BV421αCD19). After staining, the cells were resuspended in 1xPBS and transferred to a confocal dish, and VLPs (all virus-like particles, including VLPs) were observed using a confocal microscope. mCAR and T-FVLP mCAR ) and T cell fusion specificity in PBMC.

[0177] The experimental results are as follows Figure 4 As shown, T-FVLP mCAR The DiI fluorescence of the envelope of T-FVLP was obviously co-localized with the T cell membrane, while no DiI fluorescence signal was observed on the B cell and monocyte membrane, indicating that T-FVLP mCAR The VLPs undergo specific membrane fusion with T cells. mCAR No DiI fluorescence signal was observed on T cells, B cells and monocytes ( Figure 4A). T-FVLP was detected by flow cytometry. mCAR Membrane fusion occurred with about 30% of T cells, and VLP mCAR No membrane fusion with T cells ( Figure 4 B).

[0178] The results of this example show that the T-FVLP prepared by the present invention mCAR It can efficiently fuse with the T cell membrane with the help of human T cell-specific membrane fusion protein T-FP.

[0179] Example 5 T cell-specific membrane fusion virus-like particles (T-FVLP mCAR ) mRNA delivery efficiency and the proportion of CAR-T cells produced

[0180] Preparation of T-FVLPs using UTR-mRFP expressing red fluorescent protein RFP mRFP (The preparation method is the same as in Example 2). Magnetic bead sorting to obtain human CD3 + T cells, T-FVLP mRFP Activated human CD3 + T cells were incubated for 24 h.

[0181] In addition, activated human CD3 + T cells were seeded in each well of a 96-well plate at 5 × 10 5 cells, added VLP or VLP mCAR or T-FVLP mCAR After incubation for 24 h, T cells were collected by centrifugation at 450 g for 5 min at 4 °C; protein samples were obtained by RIPA lysis and quantified using a BCA protein quantification kit, and the concentration was adjusted to 0.5 μg / μL.

[0182] The experimental results are as follows Figure 5 As shown, T-FVLP was detected by flow cytometry. mRFP After transfection, 21.6% of T cells expressed red fluorescent protein RFP, while VLP and VLP mRFP There was no significant RFP expression in T cells in the group ( Figure 5 In addition, Western blot experiments showed that T-FVLP mCAR After transfection of human T cells, T cells showed obvious expression of CAR protein, while VLP and VLP mCAR T cells in the group do not express CAR protein ( Figure 5 B). Flow cytometry results also showed that 19.7% of T cells were transfected with T-FVLP. mCAR After transfection, CAR-T cells, VLP and VLP mCARCannot convert T cells into CAR-T cells ( Figure 5 C).

[0183] The results of this example show that the T cell-specific membrane fusion virus-like particles prepared by the present invention can deliver mRNA into T cells for CAR-T cell preparation.

[0184] Example 6 T cell-specific membrane fusion virus-like particles (T-FVLP mCAR ) Expression duration of CAR-T cells produced

[0185] Magnetic beads were used to separate activated human peripheral mononuclear cells (PBMCs) and obtain CD3 + T cells. 5×10 T cells were seeded into each well of a 96-well plate. 5 CD3 + T cells, and added VLP or VLP mCAR or T-FVLP mCAR After 24h, 48h and 72h of incubation, human CD3 + T cells were detected by flow cytometry. Cells were blocked with antibodies and stained (PerCP / Cy5.5αCD3, AF647 anti-Myc tag), and the proportion of CAR-T cells generated after incubation for different time periods was detected by flow cytometry.

[0186] The results are as follows Figure 6 As shown, after T cells and VLPs were co-incubated, no CAR-T cells were produced; mCAR After co-incubation, a very low proportion of CAR-T cells can be produced at 24 hours, and they decay quickly; T cells and T-FVLP mCAR A large number of transient CAR-T cells were generated after co-incubation, and the number of cells decreased from 24h to 72h, reaching 18.4% at 24h, 9.8% at 48h, and 3.6% at 72h.

[0187] The results of this example prove that the T cell-specific membrane fusion virus-like particles (T-FVLP) prepared by the present invention mCAR ) can produce transient CAR-T cells without continuously activating CAR-T cells, so it is expected to reduce the occurrence of cytokine storm during in vivo treatment and improve safety.

[0188] Example 7 T cell-specific membrane fusion virus-like particles (T-FVLP mCAR ) The ability of CAR-T cells produced to kill tumor cells

[0189] Raji-Luc cells (Shanghai Fuheng Biotechnology Co., Ltd.) are CD19-positive B-cell lymphoma cells. 1×10 cells were seeded into each well of a 96-well plate. 4Raji-Luc cells. Magnetic beads were used to separate human peripheral mononuclear cells (PBMCs) to obtain CD3 + T cells, with VLP or VLP mCAR or T-FVLP mCAR After 24 h of co-incubation, 5 × 10 4 CD3 + T cells; after 24 hours of co-incubation, the Raji-Luc cells were removed, and fresh culture medium containing 2× luciferase substrate was added, and the bioluminescent signal was read with an enzyme reader after sufficient reaction.

[0190] The results are as follows Figure 7 As shown, from Figure 7 It can be seen that, compared with T-FVLP mCAR CD3 after co-incubation + T cells have the strongest ability to kill tumor cells, and the activity of Raji-Luc cells was reduced by 35.8%, which was higher than that of VLP or VLP. mCAR There were significant differences in the co-incubation groups.

[0191] Example 8 T cell-specific membrane fusion virus-like particles (T-FVLP mCAR ) The effect of CAR-T cells generated in vivo on the treatment of Raji-Luc B lymphoma in humanized mice

[0192] One day before treatment, 1×10 7 Activated human peripheral mononuclear cells (PBMCs) were systemically injected into immunodeficient NCG mice that had been xenografted with Raji-Luc B-cell lymphoma. Subsequently, the mice were intravenously injected with PBS, VLP, VLP, and mCAR and T-FVLP mCAR The dosage was 2×10 10 VLPs were administered 5 times in total. The growth of luciferase-expressing Raji-Luc B-cell lymphoma in mice was continuously monitored by bioluminescence imaging.

[0193] The experimental results are as follows Figure 8 As shown, compared with the negative control group (PBS, VLP or VLP mCAR ) compared to T-FVLP mCAR Treatment significantly inhibited the growth of Raji-Luc B-cell lymphoma, with a tumor growth inhibition rate of 83.5%. By day 6, T-FVLP mCAR The tumor growth of the group was significantly slower than that of the other groups, and this effect became more obvious on days 9, 12, and 15. By day 15, T-FVLP mCARThe bioluminescent signals of mice in the 1 group were relatively weak and confined to individual tissues, while the bioluminescent signals of mice in the other groups were significantly stronger and more widely distributed in multiple tissues ( Figure 8 A and B in ).

[0194] The results of this example show that the T cell-specific membrane fusion virus-like particles (T-FVLP) prepared by the present invention mCAR )αCD19 CAR-T cells generated in vivo can effectively target and kill CD19-positive B-cell lymphoma cells.

[0195] Example 9 T cell-specific membrane fusion virus-like particles (T-FVLP mCAR In vivo safety evaluation of CAR-T cells produced by

[0196] At the end of the treatment in Example 8, NCG mice were killed and peripheral blood and other major organs (including brain, liver, kidney, lung, heart) were collected. The levels of major inflammatory cytokines IL-1β, IL-6 and GM-CSF in serum were detected by ELISA. Hematoxylin and eosin (H&E) staining was used to perform histopathological analysis of each organ. H&E stained tissue images were observed using a Digital Pathology AperioCS2 microscope.

[0197] The results are as follows Fig. 9 As shown, in T-FVLP mCAR After treatment, the concentrations of key inflammatory cytokines such as IL-1β, IL-6, and GM-CSF did not increase and were similar to the levels observed in PBS and other control groups ( Fig. 9 A in the figure). There were no obvious lesions in the organs and tissues of the experimental group ( Fig. 9 In addition, no neurological symptoms such as seizures, limb disorders, or paralysis were observed during treatment. Histopathological examination of brain tissue showed no signs of damage or toxicity. This is most likely due to the T-FVLP mCAR The mediated production of αCD19 CAR-T cells is transient and does not cause prolonged activation of CAR-T cells, thereby reducing excessive cytokine release and greatly alleviating its related side effects.

[0198] The results of this example show that the T cell-specific membrane fusion virus-like particles (T-FVLP) prepared by the present invention mCAR ) has good biocompatibility and safety.

[0199] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0200] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A T cell-specific membrane fusion virus-like particle, characterized in that: It is prepared by transiently transfecting an expression plasmid of a human T cell-specific membrane fusion protein, an expression plasmid of an mRNA-loaded protein and an expression plasmid of a CAR mRNA into 293T cells; the molar ratio of the expression plasmid of the human T cell-specific membrane fusion protein to the expression plasmid of the mRNA-loaded protein is 1:1.8-2.2; the molar ratio of the expression plasmid of the mRNA-loaded protein to the expression plasmid of the CAR mRNA is 1:2-4.

2. The T cell-specific membrane fusion virus-like particle according to claim 1, characterized in that: The molar ratio of the expression plasmid of the mRNA loading protein to the expression plasmid of the CAR mRNA is 1:3-4, more preferably 1:

3.

3. The T cell-specific membrane fusion virus-like particle according to claim 1 or 2, characterized in that: The human T cell-specific membrane fusion protein is obtained by introducing mutations into the gene sequence of the targeting subunit of HIV virus gp160, measles virus MV-H / MV-F or vesicular stomatitis virus VSV-G to remove the original receptor recognition ability, and then connecting anti-CD3scFv, anti-CD4scFv or anti-CD8scFv to the extracellular end of the corresponding targeting subunit.

4. The T cell-specific membrane fusion virus-like particle according to claim 3, characterized in that: The human T cell-specific membrane fusion protein is obtained by connecting the anti-CD3 scFv with a sequence as shown in SEQ ID NO: 2 to the extracellular end of the mutated gp160 gene with a sequence as shown in SEQ ID NO:

1.

5. The T cell-specific membrane fusion virus-like particle according to claim 1 or 2, characterized in that: The mRNA loading protein includes mRNA loading protein Peg10 and mRNA loading protein Gag-MS2 or mRNA loading protein Gag-Tat.

6. The T cell-specific membrane fusion virus-like particle according to claim 5, characterized in that: The nucleotide sequence of the protein Peg10 is shown in SEQ ID NO:

3.

7. The T cell-specific membrane fusion virus-like particle according to claim 1 or 2, characterized in that: The CAR mRNA has a specific UTR signal and carries anti-CD19 or anti-EGFRvIII targeting human tumor cell targets.

8. The T cell-specific membrane fusion virus-like particle according to claim 7, characterized in that: The CAR mRNA has a specific UTR signal and carries anti-CD19 targeting human tumor cell targets, and its sequence is shown in SEQ ID NO:

4.

9. The method for preparing T cell-specific membrane fusion virus-mimicking particles according to any one of claims 1 to 8, characterized in that: The following steps are involved: (1) constructing an expression plasmid for human T cell-specific membrane fusion protein, an expression plasmid for mRNA-loaded protein, and an expression plasmid for CAR mRNA; (2) The three expression plasmids constructed in step (1) are transiently transfected into 293T cells and incubated for 45 h to 55 h, followed by ultracentrifugation and purification.

10. Use of the T cell-specific membrane fusion virus-mimicking particle according to any one of claims 1 to 8 in the preparation of a drug for treating tumors.

Images