Novel Csx biological pore protein monomer and application thereof
By developing a new Csx bioporin monomer and designing a DNA linker with a hairpin structure, the problem of insufficient preparation difficulty and speed control efficiency caused by the complex structure of bioporin in the prior art is solved, and efficient and accurate nanopores are achieved Sequencing and detection.
Patent Information
- Application Number
- CN202411335888.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-24
- Publication Date
- 2024-12-10
AI Technical Summary
The complex structure of existing biological pore proteins leads to difficult preparation and high production costs, insufficient speed control efficiency, and limited scope of application, making it difficult to meet the needs of high-precision and high-speed nanopore sequencing.
Develop a novel Csx bioporin monomer derived from Prevotella buccae bacteria, cloned and purified by gene recombination technology, purified and restored its activity through affinity chromatography technology, and designed DNA linkers and DNA-peptides with hairpin structure to improve the capture rate and detection rate.
The simple cloning expression and purification of Csx biological pore protein was achieved, which reduced production costs, improved the stability and accuracy of nanopore sequencing, enhanced the capture rate and detection rate of DNA through pore protein, and ensured the accuracy of the detection process. Sex and reliability.
Smart Images
Figure CN119101134A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of gene sequencing, and specifically relates to a novel Csx biological porin monomer and an application thereof, in particular to an application in detecting DNA-peptide segments. Background Art
[0002] With the rapid development of next-generation sequencing (NGS) and single-molecule DNA sequencing technology, the accuracy and throughput of DNA sequencing have been significantly improved, which has greatly promoted the progress of precision medical diagnosis. Among them, nanopore sequencing technology based on biological porins has shown great application potential in genomics, transcriptomics and proteomics with its unique advantages, such as ultra-long read length, real-time and high accuracy. However, although biological porins in the existing technology, such as the MspA mutant EP3204511B1 of Mycobacterium smegmatis and the α-HL mutant EP 2 310 534 B1 of Aureobacterium aureum, have achieved good results, there are still some limitations: for example, the currently widely used MspA and α-HL biological porins are octamer and heptamer structures, respectively, and their complex polymerization morphology not only increases the difficulty of preparation, but also affects the stability and accuracy of the sequencing process; and due to the complex structure of biological porins such as MspA and α-HL, their cloning expression and purification process are relatively cumbersome, resulting in high production costs, which are not suitable for large-scale application and popularization.
[0003] In addition, in nanopore sequencing and protein detection, the speed at which samples pass through biological pores is crucial. Although existing rate-controlling enzymes such as Hel308, Dda, and TrwC can regulate the speed to a certain extent, their efficiency still needs to be improved, especially for sequencing of complex samples and long sequences, their rate-control mechanisms cannot meet the requirements of high precision and high speed. Based on the above problems, it is particularly important to develop new pore proteins to simplify the cloning expression and purification processes and further improve the stability and accuracy of nanopore sequencing. Summary of the invention
[0004] In view of the defects and problems of existing biological porins, such as complex structure, high preparation cost, insufficient rate control efficiency and limited scope of application, the present invention provides a novel Csx biological porin monomer and its application. The Csx biological porin is a monomer, and the cloning, expression and purification processes of the Csx protein are simple, cost-saving, and easy to assemble the protein of biological nanopores.
[0005] The solution adopted by the present invention to solve the technical problem is: a new Csx biological porin monomer, the amino acid sequence of the Csx biological porin is as follows: MDYMELAKEAFSIICTFIAAYVAYYYAIKQLHQKSVENIEYAKYQAVLQAHKSLYKLLRFTTNTENEDSILIWEKTKDGKQEATYYFRKENIRKFIKELSKEIYNEGCGIFMSKEALSLISEYRNIVYGFMLSAQNNPQETIRITNRESVERMKKIHQNLSIEIRQAINLKKRDLRFENLYFQHHHHHH (SEQ ID NO:2) Furthermore, the Csx biological porin is derived from Prevotella buccae bacteria and is named Csx. At the same time, the monomeric Csx biological porin is cloned, expressed and purified by using the gene recombination technology in biology; the nucleotide sequence of the Csx biological porin monomer is as follows: (SEQ ID NO: 1) Furthermore, the purification of the Csx bioporin adopts affinity chromatography technology, purifies the Csx protein using a His tag, and restores its activity through renaturation of the Csx protein.
[0006] The present invention also provides a DNA linker with a hairpin structure, which is designed to improve the capture rate and detection rate of DNA passing through the Csx monomer porin, and comprises a template strand, a blocking strand and a primer strand, and the nucleotide sequence thereof is as follows: (1) Template chain: GGGC3C3C3C3C3C3C3CC3C3C3C3C3C3C3C3C3C3C3TACTACGATCGATCGATGCATCGATCGATCGACT (SEQ ID NO: 5) (2) Blocking chain: GCTAGCTACTACGTACGATCGATCA (SEQ ID NO:6) (3) Primer chain: ACGTACGTACGTCAGTCGATC-cholesterol (SEQ ID NO:7) The template chain is used to pass through the monomer protein hole, the blocking chain is used to block the perforation of the template chain, and the primer chain is a double-stranded DNA that opens the hairpin structure under the action of a rate-controlling enzyme. At the same time, in order to increase the penetration of the hairpin structure DNA through the Csx monomer pore protein, cholesterol is added to the end of the primer chain to increase the capture rate; the end of the blocking chain is designed with a C3 spacer to improve the blocking effect and increase the detection rate of the template chain.
[0007] Furthermore, the nucleotide sequence of the rate-controlling enzyme is as follows: The amino acid sequence of the rate-controlling enzyme is as follows: (SEQ ID NO: 4) The present invention also provides a DNA-peptide segment. In the NCBI database, the peptide segment uses a bioinformatics method to obtain the amino acid sequence of the conserved region of the new coronavirus, and is synthesized for detection through the pore. The design template is a DNA-peptide segment, and the DNA is used to pull the peptide segment through the Csx pore protein; the nucleotide sequence of the DNA-peptide segment is as follows: ACGCTAGCTAGCATCGAT-WERNLPSSPRWRELPKYKLLPRS (SEQ ID NO:8) The present invention also provides a Csx nanopore, comprising the novel Csx bioporin monomer, a DNA linker or a DNA-peptide segment having a hairpin structure, and a method for constructing the Csx nanopore comprising the following steps: (1) Construction of a single Csx protein nanopore on an artificial lipid bilayer; (2) The ionic current through the Csx nanopore was measured using an Axopatch 200B amplifier to detect DNA-peptide permeation events.
[0008] Further, a single Csx pore was established in a lipid bilayer. A lipid bilayer of 1,2-diphytanyl-n-glycerol-3-phosphocholine (Avanti Polar Lipids) was formed on a Teflon horizontal aperture of approximately 20 μm in diameter. The 60 μl compartments on either side of the bilayer contained 0.4 M KCl, 1 mM EDTA, 1 mM DTT, 20 mM HEPES / KOH, 2 mM MgCl2, and 50 mM dNTP buffer at pH 8.0 ± 0.05. An Axopatch 200B integrated patch clamp amplifier (Axon Instruments) applied a 180 mV voltage (trans-positive) across the bilayer and measured the ionic current through the pore. Csx was added to the grounded cis chamber at a concentration of 4.0 ng / ml. Once a pore was inserted, the compartment was flushed with the experimental buffer to avoid further insertion. The DNA concentration was 1 μM. The rate-controlling enzyme was added to the cis cell chamber at a concentration of 0.75 μM. 10 mM MgCl2 and 100 μM of dCTP, dATP, dTTP, and dGTP were added to the cis chamber for DNA synthesis. All experiments were performed at room temperature (23 ± 1 °C). The analog signals were low-pass filtered at 100 kHz with a 4-pole Bessel filter and digitized at 500 kHz. Data acquisition was controlled by Origin.
[0009] The present invention also provides a Csx nanopore device, comprising the novel Csx bioporin monomer, a DNA linker with a hairpin structure, a DNA-peptide segment or a Csx nanopore.
[0010] The present invention also provides the use of the novel Csx bioporin monomer, the DNA connector with a hairpin structure, the DNA-peptide segment or the Csx nanopore in detecting the DNA-peptide segment.
[0011] Compared with the prior art, the present invention has the following beneficial effects: The invention provides a novel Csx biological porin monomer and application thereof. The Csx biological porin is derived from bacteria and is in monomeric form, which is easy to assemble into biological nanopore proteins. The Csx cloning expression and purification process are simple and cost-saving. The DNA-peptide hairpin structure can be used for the detection of DNA and peptides, and provides a direction for the development of applications for detecting peptides. When the template chain of the hairpin structure passes through the Csx monomer porin, the cholesterol designed at the end of the primer chain can enhance the interaction with the porin, thereby improving the capture rate of DNA.
[0012] The function of the blocking chain is to block the perforation of the template chain, ensuring that the template chain can continue to pass through the porin only when the primer chain opens the hairpin structure under the action of the rate-controlling enzyme, thereby controlling the perforation speed of the DNA; the DNA linker with a hairpin structure can improve the detection rate of the template chain in the Csx porin, ensure the accuracy and reliability of the detection process, and also help maintain the stability of the DNA during the perforation process, reducing detection errors caused by structural changes.
[0013] The DNA-peptide designed in the present invention targets the amino acid sequence in the conserved region of the novel coronavirus, and can specifically recognize and pass through the Csx porin, thereby achieving highly specific detection of novel coronavirus-related sequences; and the design of the DNA-peptide is not limited to the conserved region of the novel coronavirus, but can also be extended to the detection of other pathogens or disease-related sequences, increasing the applicability and flexibility of the technology. BRIEF DESCRIPTION OF THE DRAWINGS
[0014] Figure 1 Schematic diagram of the front view structure of Csx biological porin.
[0015] Figure 2 Schematic diagram of the top-down structure of the Csx bioporin.
[0016] Figure 3 Schematic diagram of the DNA linker structure with a hairpin structure.
[0017] Figure 4 The electrophoresis diagram of the expression of Csx bioporin; Lane M: Protein Marker; Lane 1: Uninduced sample; Lanes 2-6: Induced samples.
[0018] Figure 5 This is the western0blot identification result diagram.
[0019] Figure 6 This is the electrophoresis diagram of the purification of Csx biological porin; in the figure, lane M: Protein Marker; lane 1: precipitate after disruption; lane 2: supernatant after disruption; lane 3: effluent; lane 4: washing sample; lane 5: elution sample.
[0020] Figure 7This is the refolding electrophoresis diagram of Csx bioporin; lane M in the figure: Protein Marker; lane S: refolding sample.
[0021] Figure 8 This is a graph showing the current detection results when perforating a DNA linker with a hairpin structure.
[0022] Fig. 9 This is a graph showing the current detection results during DNA-peptide permeation. DETAILED DESCRIPTION
[0023] The present invention is further described below in conjunction with the accompanying drawings and embodiments.
[0024] 1) Transfection: Through gene cloning expression technology, with a His tag at the end, using the heat shock method, the operation steps are as follows: Take out the competent E.coli BL21 from the -80℃ refrigerator, quickly insert it into the ice box to dissolve it. Add the Csx recombinant plasmid and mix gently, and place it in ice for 30 minutes. Heat shock in a 42℃ water bath for 45 seconds, quickly return it to the ice and place it for 2 minutes. Be careful not to shake it. Add 700u of sterile culture medium without antibiotics and mix evenly. Incubate at 37℃ with shaking for 1 hour (160-225rpm), absorb an appropriate amount and evenly spread it on the LB agar medium plate containing the corresponding antibiotics. Place it upright at 37℃ until the liquid is absorbed, then invert it and culture overnight.
[0025] 2) Expression: Select a single clone and culture it in 5 tubes of LB medium at 37℃ until the bacterial OD600 is 0.6-0.8, add IPTG to a final concentration of 0.5mM, culture at 37℃ for 4h, then centrifuge, collect the bacteria and prepare samples for SDS-PAGE analysis. Figure 4 shown.
[0026] 3) Identification: Use the common biological western-blot technology for identification. Since the designed Csx protein contains a His tag, a His antibody is used for detection, such as Figure 5 shown.
[0027] 4) Optimization: After the inoculated seed bacteria were cultured to a bacterial OD600 of 0.6-0.8, IPTG was added to the 4 tubes of culture to a final concentration of 0.2 mM and 1 mM, respectively. The cultures were cultured at 37°C and 15°C 220 rpm for 4 h and 16 h, respectively, to induce the expression of the fusion protein. Samples were prepared for SDS-PAGE analysis under each condition. The bacterial liquid under each condition in the previous step was centrifuged to collect the cells, which were broken (Tris-KCl buffer, pH8.0), and the supernatant precipitate was prepared for SDS-PAGE analysis.
[0028] 5) Amplification and purification: Figure 6As shown, the best expressing clone strain was expanded and cultured in 1 L of LB medium at 37°C until OD600 = 0.6-0.8, and the bacteria were harvested by induction at 37°C for 4 h; the bacteria were harvested by centrifugation at 8000 rpm and 4°C for 30 min, and the bacteria were resuspended and disrupted by ultrasound; Centrifuge, dissolve the precipitate in denaturing buffer and centrifuge, and purify the supernatant by Ni column affinity chromatography: Equilibration buffer: “Tris-KCl-Urea” buffer, pH 8.0 Washing buffer: "Tris-KCl-Urea" buffer, pH 8.0, 250 mM imidazole Elution buffer: “Tris-KCl-Urea” buffer, pH 8.0, 500 mM imidazole.
[0029] 6) Csx protein renaturation: Figure 7 As shown, the washing sample and the elution sample were combined and renatured in Buffer (50 mM Tris, 400 mM KCl, 10% Glycerol, pH 8.0), and sterilized by 0.22 μm filtration.
[0030] The template strand, blocking strand and primer strand of the hairpin structure were in a ratio of 1:1:1.2, and the binding buffer used was 400mM KCl, 1mM Tris-HCl, pH 8.0. The incubation program used in the PCR instrument was 95°C, 10min, 4°C, 20min, and the speed of decreasing from 95°C to 4°C was 1°C / s.
[0031] 4mM of the hairpin structure DNA was added to the Csx nanopore device, and the detection buffer was 500mM KCl, 20mM hepes, 1mM DTT, 1mM dNTP and 2mM ATP for rapid detection of single-stranded DNA chains, which has the advantages of high efficiency and speed, and easy and convenient operation, thus bringing about the detection of DNA in the monomer protein biological pore. The results are as follows Figure 8 shown.
[0032] The ratio of DNA-peptide segment to complementary chain was 1:1, and the binding buffer used was 400mM KCl, 1mM Tris-HCl, pH 8.0. The incubation program used in the PCR instrument was 90℃, 10min, 4℃, 20min, and the speed of decreasing from 95℃ to 4℃ was 1℃ / s. The nucleotide sequence of the complementary chain is as follows: ATCGATGCTAGCTAGCGT (SEQ ID NO:8) 1mM of the formed DNA-peptide was added to the Csx nanopore device, and the detection buffer was 500mM KCl, 20mMhepes, 1mM DTT, 1mM dNTP, 100mM MgCl2 and 2mM ATP for rapid detection of the target peptide in the Csx protein biological pore. The peptide was efficiently detected under the monomer protein. Compared with MspA and α-HL biological proteins, which are complexes, the results are as follows Fig. 9 shown.
[0033] The above description is only a preferred embodiment of the present invention and does not limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
Claims
1. A novel Csx bioporin monomer, Features: The amino acid sequence of the Csx bioporin is shown in SEQ ID NO:
2.
2. The novel Csx bioporin monomer according to claim 1, Features: The Csx biological porin is derived from Prevotella buccae bacteria, and the monomeric Csx biological porin is cloned, expressed and purified by gene recombination technology; the nucleotide sequence of the Csx biological porin monomer is shown in SEQ ID NO:
1.
3. The novel Csx bioporin monomer according to claim 2, Features: The cloning and expression method of the Csx biological porin comprises using Escherichia coli BL21 (DE3) as a host cell, transforming a recombinant plasmid containing a Csx protein gene by a heat shock method, and optimizing and inducing the expression of the Csx protein.
4. The novel Csx bioporin monomer according to claim 2, Features: The purification of the Csx bioporin adopts affinity chromatography technology, purifies the Csx protein using a His tag, and restores its activity through renaturation of the Csx protein.
5. A DNA linker with a hairpin structure, Features: The linker is designed to improve the capture rate and detection rate of DNA passing through the Csx monomer porin, and comprises a template chain, a blocking chain and a primer chain, wherein the nucleotide sequence of the template chain is shown in SEQ ID NO: 5, the nucleotide sequence of the blocking chain is shown in SEQ ID NO: 6, and the nucleotide sequence of the primer chain is shown in SEQ ID NO: 7; wherein cholesterol is designed at the end of the primer chain to enhance the capture ability.
6. A DNA-peptide segment, Features: The peptide uses bioinformatics methods to obtain the amino acid sequence of the conserved region of the new coronavirus. The design template is DNA-peptide, in which DNA is used to pull the peptide through the Csx porin for detection.
7. A Csx nanopore, comprising the novel Csx bioporin monomer according to any one of claims 1 to 4, the DNA linker with a hairpin structure according to claim 5, or the DNA-peptide segment according to claim 6, Features: The method for constructing the Csx nanopore comprises the following steps: (1) Construction of a single Csx protein nanopore on an artificial lipid bilayer; (2) The ionic current through the Csx nanopore was measured using an Axopatch 200B amplifier to detect DNA-peptide permeation events.
8. A Csx nanopore device, Features: The invention comprises the novel Csx bioporin monomer according to any one of claims 1 to 4, the DNA linker with a hairpin structure according to claim 5, the DNA-peptide segment according to claim 6 or the Csx nanopore according to claim 7.
9. Use of the novel Csx bioporin monomer according to any one of claims 1 to 4, the DNA linker with a hairpin structure according to claim 5, the DNA-peptide according to claim 6, the Csx nanopore according to claim 7 or the Csx nanopore device according to claim 8 in detecting DNA-peptide.