Wheat SNP (Single Nucleotide Polymorphism) site markers and application thereof in root biomass identification in seedling stage

Abstract

The invention discloses a group of wheat SNP (Single Nucleotide Polymorphism) site markers and application thereof in root biomass identification in a seedling stage. The invention provides an application of a substance for detecting the unit types of four SNP loci Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP in a wheat genome in any one of the following applications: A1) identifying or assisting in identifying the biomass of a wheat root system; a2) screening or auxiliary screening of wheat with high root biomass; a3) breeding wheat with high root biomass; a4) wheat genetic breeding; the invention finds that a group of SNP loci Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP are obviously associated with wheat root system related traits, and the developed KASP marker is good in repeatability and low in cost, and has a better application prospect in molecular marker-assisted selection and molecular design breeding of wheat root system traits.

Description

Technical Field

[0001] The invention belongs to the field of molecular detection technology and crop genetic breeding, and relates to a group of wheat SNP site markers and their application in identification of root biomass at the seedling stage. Background Art

[0002] The root system is an important organ for wheat absorption, fixation and support. A good root system architecture is the basis for efficient use of water and nutrients in wheat (Atkinson et al. 2015). Root system architecture is mainly determined by factors such as root length, diameter, branching and surface area. For example, root length affects water absorption, root number, root diameter and root surface area affect nutrient absorption (Meister et al. 2014; Courtois et al. 2009), and root biomass affects the biomass balance between the aboveground part and the root system of the plant, thereby affecting yield (Bettembourg et al. 2017; Cormier et al. 2016). However, root phenotypes are not easy to obtain, and genetic and physiological studies are relatively rare, which greatly hinders the genetic study of root system structure. Root identification in the adult stage causes great damage to the root system and has low throughput, which is not suitable for genetic analysis of the population. Root identification in the seedling stage is fast, simple and has strong correlation with the adult stage, which can well reflect the root morphology and root group distribution in the adult stage. The root characteristics survey at the seedling stage includes the nutrient solution method (Ayalew et al. 2017), gel chamber method (Christopher et al. 2013), paper culture method (Bai et al. 2013), sand culture method (Hamada et al. 2012) and soil culture method (Cao et al. 2014). These methods have small errors, simple operation, high throughput, and small sampling damage. Combined with digital image analysis software, they can quickly determine the root morphology of wheat.

[0003] Discovering molecular markers that control root traits is a prerequisite for assisted breeding of wheat varieties with excellent root systems. Using molecular markers closely linked to genes or QTLs related to wheat seedling roots for assisted selection can greatly improve the efficiency of breeding selection, which is of great significance for accelerating the improvement and cultivation of wheat varieties with excellent root systems. Wheat root-related traits are complex quantitative traits controlled by micro-effect polygenes. Linkage analysis based on parent-offspring populations and natural population association analysis are commonly used research methods for mining important genes. At present, with the deepening of molecular marker technology in the field of wheat breeding, the positioning of root-related genes / QTLs has made certain progress. Li et al (2020) used RIL populations to identify 8 root traits in the seedling stage, and obtained a total of 18 related QTLs, with phenotypic contribution rates ranging from 3.27% to 11.75%. Liu et al (2019) used a natural population of 165 wheat materials to obtain 32 stable QTLs related to seedling root system, located on chromosomes 1B, 2D and 4A, which can explain 8.80%-15.60% of the phenotypic variation. Although some QTLs related to wheat seedling root system have been located, there are few reports on the application of tightly linked markers in molecular breeding.

[0004] Molecular marker-assisted selection technology can track the transfer or aggregation of root genes, providing an effective technical means for breeding wheat varieties with excellent root systems. Therefore, we should deeply explore the functional markers that can be used for wheat seedling root identification, and use the markers to screen wheat varieties with excellent root traits in the seedling stage, so as to provide molecular assisted selection means for breeding high-yield, stable-yield and excellent-quality wheat varieties. Summary of the invention

[0005] The technical problem solved by the invention is to use a group of SNP sites to design KASP markers for identification and auxiliary screening of wheat varieties with high root biomass at the seedling stage.

[0006] In order to solve the above technical problems, in the first aspect, the present invention provides a substance for detecting the unit type of four SNP sites Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP in the wheat genome in any of the following applications:

[0007] Or, the use of a substance for detecting the unit type of any one of the four SNP sites Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP in the wheat genome in any of the following:

[0008] A1) Identify or assist in identifying wheat root biomass;

[0009] A2) Screening or assisting in the selection of wheat with high root biomass;

[0010] A3) Breeding wheat with high root biomass;

[0011] A4) Wheat genetics and breeding;

[0012] The SNP site Ta-1B-SNP is position 83 of SEQ ID NO: 1;

[0013] The SNP site Ta-2A-SNP is position 92 of SEQ ID NO: 2;

[0014] The SNP site Ta-5D-SNP is position 59 of SEQ ID NO: 3;

[0015] The SNP site Ta-6A-SNP is position 41 of SEQ ID NO:4.

[0016] In the above application, the root biomass may be root biomass at the seedling stage.

[0017] In the above application, the root biomass is specifically embodied in root dry weight.

[0018] In the above application, the unit type of the SNP site Ta-1B-SNP is AA or CC;

[0019] The unit type of the SNP site Ta-2A-SNP is AA or GG;

[0020] The unit type of the SNP site Ta-5D-SNP is GG or AA;

[0021] The unit type of the SNP site Ta-6A-SNP is TT or CC.

[0022] In the above application, the substance is B1) or B2):

[0023] B1) Primer set;

[0024] B2) a PCR reagent or a kit containing the set of primers;

[0025] The primer set includes primer F, primer H and primer C;

[0026] The nucleotide sequence of the primer F includes the sequence shown in SEQ ID NO: 5, 22-43, SEQ ID NO: 8, 22-42, SEQ ID NO: 11, 22-41, or SEQ ID NO: 14, 22-43;

[0027] The nucleotide sequence of the primer H includes the sequence shown in SEQ ID NO: 6, 22-43, SEQ ID NO: 9, 22-42, SEQ ID NO: 12, 22-41, or SEQ ID NO: 15, 22-43;

[0028] The nucleotide sequence of the primer C is SEQ ID NO: 7 or SEQ ID NO: 10 or SEQ ID NO: 13 or SEQ ID NO: 16.

[0029] In the above application, the nucleotide sequence of the primer F is the sequence shown in SEQ ID NO: 5 or SEQ ID NO: 8 or SEQ ID NO: 11 or SEQ ID NO: 14;

[0030] The nucleotide sequence of the primer H is the sequence shown in SEQ ID NO: 6, SEQ ID NO: 9, SEQ ID NO: 12 or SEQ ID NO: 15.

[0031] The above application can be to detect the Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP unit types of the following four SNP sites in the wheat genome, and the root biomass (specifically, root dry weight) of wheat carrying the aggregated SNP site is greater than or has a candidate greater than the root biomass of wheat carrying the non-aggregated SNP site;

[0032] The wheat carrying the aggregated SNP loci is wheat in which the haplotypes of at least two of the four SNP loci, Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP, are dominant haplotypes;

[0033] The wheat carrying the non-aggregated SNP loci is wheat in which the haplotypes of Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP loci are all non-dominant haplotypes, or wheat in which the haplotype of only one of the Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP loci is a dominant haplotype, and the haplotypes of the other three SNP loci are all non-dominant haplotypes;

[0034] The dominant unit type of the Ta-1B-SNP site is AA, and the non-dominant unit type of the Ta-1B-SNP site is CC;

[0035] The dominant unit type of the Ta-2A-SNP site is AA, and the non-dominant unit type of the Ta-2A-SNP site is GG;

[0036] The dominant unit type of the Ta-5D-SNP site is GG, and the non-dominant unit type of the Ta-5D-SNP site is AA;

[0037] The dominant unit type of the Ta-6A-SNP site is TT, and the non-dominant unit type of the Ta-6A-SNP site is CC.

[0038] The above application can be used to detect the unit type of any of the following four SNP sites Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP in the wheat genome. The root biomass of wheat carrying the dominant unit type of a certain SNP site is greater than or is expected to be greater than that of wheat carrying the non-dominant unit type of the SNP site.

[0039] In a second aspect, the present invention provides any of the following substances:

[0040] The set of primers described in the first aspect;

[0041] Or, a PCR reagent or kit containing the set of primers described in the first aspect.

[0042] The PCR reagents include primer F, primer H, primer C, and KASP Master mix (LGC Biosearch, KBS-1050-122);

[0043] The molar ratio of primer F, primer H and primer C is 1:1:2.5.

[0044] In an embodiment of the present aspect, the concentration of primer F in the PCR reagent is 168 nM, the concentration of primer H in the PCR reagent is 168 nM, and the concentration of primer C in the PCR reagent is 420 nM.

[0045] Each of the above-mentioned SNP site detections corresponds to a PCR reagent, and the corresponding primers are primer F, primer H and primer C for detecting the SNP site.

[0046] In a third aspect, the present invention provides the use of the set of primers, PCR reagents or kits described in the second aspect in any of the following:

[0047] A1) Identify or assist in identifying wheat root biomass;

[0048] A2) Screening or assisting in the selection of wheat with high root biomass;

[0049] A3) Breeding wheat with high root biomass;

[0050] A4) Wheat genetics and breeding.

[0051] In a fourth aspect, the present invention provides the following method C1 or C2:

[0052] C1. A method for identifying or assisting in identifying wheat root biomass, comprising the following steps: detecting the unit type of SNP sites Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP in the wheat genome, and the root biomass of wheat carrying the aggregated SNP sites is greater than or has a candidate greater than that of wheat carrying the non-aggregated SNP sites;

[0053] The wheat carrying the aggregated SNP loci is wheat in which the haplotypes of at least two of the four SNP loci, Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP, are dominant haplotypes;

[0054] The wheat carrying the non-aggregated SNP loci is wheat in which the haplotypes of Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP loci are all non-dominant haplotypes, or wheat in which the haplotype of only one of the Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP loci is a dominant haplotype, and the haplotypes of the other three SNP loci are all non-dominant haplotypes;

[0055] The dominant unit type of the Ta-1B-SNP site is AA, and the non-dominant unit type of the Ta-1B-SNP site is CC;

[0056] The dominant unit type of the Ta-2A-SNP site is AA, and the non-dominant unit type of the Ta-2A-SNP site is GG;

[0057] The dominant unit type of the Ta-5D-SNP site is GG, and the non-dominant unit type of the Ta-5D-SNP site is AA;

[0058] The dominant unit type of the Ta-6A-SNP site is TT, and the non-dominant unit type of the Ta-6A-SNP site is CC.

[0059] C2. A method for identifying or assisting in identifying wheat root biomass, comprising the following steps: detecting any unit type of SNP sites Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP in the wheat genome, and the root biomass of wheat carrying a dominant unit type of a certain SNP site is greater than or has the potential to be greater than that of wheat carrying a non-dominant unit type of the SNP site.

[0060] In the method described above, the method for detecting the unit type of each SNP site in the wheat genome includes the following steps: using the wheat genome to be tested as a template, using the primers corresponding to each SNP site in the second aspect to perform KASP reaction respectively, to obtain the unit type of each SNP site.

[0061] In a fifth aspect, the present invention provides a method for breeding wheat with high root biomass, comprising the following steps: breeding wheat carrying the aggregated SNP loci described in the fourth aspect.

[0062] In the above, the KASP reaction procedure is as follows:

[0063] Pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s; annealing and extension at 61°C for 60 s, 10 cycles, decreasing by 0.6°C in each cycle; denaturation at 94°C for 20 s, annealing and extension at 55°C for 60 s, 32 cycles; 37°C for 1 min, 37°C for 1 s (scanning fluorescence values ​​for genotype reading).

[0064] In the above, the unit type is obtained by using PCR reagents to perform KASP reaction, and the amplification product is detected by using Bio-RAD CFX96 fluorescence quantitative PCR instrument, and the unit type is obtained by KASP reaction, and genotyping is performed according to the fluorescence data.

[0065] The present invention uses marker / trait association analysis in 255 Shanxi wheat germplasms to find that a group of SNP sites Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP are significantly associated with wheat root-related traits, and uses the four SNP sites to develop corresponding KASP molecular markers, which are further verified and applied in the breeding process. At the same time, the developed KASP marker has good repeatability and low cost, and has good application prospects in molecular marker-assisted selection and molecular design breeding of wheat root traits. BRIEF DESCRIPTION OF THE DRAWINGS

[0066] Figure 1 The relationship between the number of superior alleles and root dry weight under hydroponic conditions (A) and the relationship between different allele aggregation types and root dry weight (B).

[0067] Figure 2 Comparison of wheat root systems of different aggregation levels (AC).

[0068] Figure 3 Figure 3 The relationship between the number of superior alleles and root dry weight under soil culture conditions (A) and the comparison of root dry weight under hydroponic (B) and soil culture (C) conditions at different site aggregation levels. DETAILED DESCRIPTION

[0069] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0070] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0071] Unless otherwise specified, the quantitative tests in the following examples were performed three times and the results were averaged.

[0072] Root dry weight refers to the weight of the organism after water has been removed from the roots.

[0073] Example 1: Mining of SNP sites associated with root dry weight

[0074] 1. Investigation of root characteristics

[0075] 255 wheat varieties were used as materials. For each variety, seeds with full grains and uniform size were selected and soaked in distilled water for imbibition and germination. After the seeds turned white, they were cultured under two conditions. Hydroponic conditions: 20 seeds with the same germination degree were selected and placed in a culture dish for germination for 6 days, and then placed in Hoagland nutrient solution (pH=6.0) for 14 days. The nutrient solution was replaced every 3 days, and the oxygen pump was continuously ventilated (seedling stage). Soil culture conditions: 20 seeds with the same germination degree were selected and sown in a culture cup (diameter 7 cm, height 8 cm) containing vermiculite and 100mL water for 20 days (seedling stage). Both treatments were cultured in an artificial climate chamber with a light intensity of 500μmol m-2s-1, a humidity of 70%, and a light and temperature cycle of 20℃16h / 16℃8h.

[0076] Three plants were evenly selected from each line, and the phenotypic data of main root length, total root length, root surface area, root volume, root diameter and number of root tips were measured using Microtek Scanmakeri 800plus root scanner and Win-RHIZO system. The fresh weight of roots, fresh weight of stems and leaves, fresh weight of plants, dry weight of roots, dry weight of stems and leaves, and dry weight of plants were weighed.

[0077] 2. SNP association analysis and mining of SNP marker loci related to root dry weight

[0078] The wheat 16K SNP chip was used to perform SNP typing on 255 wheat varieties, of which 9793 SNP markers were different among the 255 wheat varieties. The mixed linear model of TASSEL5.0 was used to conduct genome-wide association analysis combining high-quality SNP markers, population structure and kinship. When the threshold value P<0.001 or log10(P)>3, four SNP sites Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP were found to be significantly associated with root dry weight.

[0079] The Ta-1B-SNP site is located on chromosome 1B of the wheat genome, and is the 83rd nucleotide of SEQ ID NO: 1. The nucleotide is A or C, and the unit type is AA, CC or AC.

[0080] The Ta-2A-SNP site is located on chromosome 2A of the wheat genome, and is the 92nd nucleotide of SEQ ID NO: 2. The nucleotide is G or A, and the unit type is GG, AA or GA.

[0081] The Ta-5D-SNP site is located on chromosome 5D of the wheat genome, and is the 59th nucleotide of SEQ ID NO:3, the nucleotide is A or G, and the unit type is AA, GG or AG.

[0082] The Ta-6A-SNP site is located on chromosome 6A of the wheat genome, and is the 41st nucleotide of SEQ ID NO:4. The nucleotide is T or C, and the unit type is TT, CC or TC.

[0083] Detailed information of SNPs is shown in Table 1 ;

[0084] Table 1 is the SNP site information:

[0085]

[0086]

[0087] 3. Analysis of genetic effects of loci related to root dry weight

[0088] The present invention uses significant SNP sites to analyze the genetic effects of markers on root traits, and finds that there are significant differences in different variant types of 4 SNP markers. They are Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP. The additive effect of the site on root traits is analyzed, and it is found that as the number of alleles at these 4 sites increases, the phenotypic value of root traits increases accordingly. Therefore, these SNP markers can be used to develop molecular markers for auxiliary selection of wheat root improvement.

[0089] Example 2: Acquisition of KASP marker-specific primers and establishment of a detection method and verification of SNP sites in natural populations

[0090] 1. Development of KASP markers for loci related to wheat root traits

[0091] According to the design rules of KASP primers, KASP primers for amplifying Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP loci were designed. The KASP primers for each locus include primer F, primer H and universal primer C, a total of 3 primer sequences (sequences are shown in Table 2).

[0092] Table 2 shows the KASP primer sequences

[0093]

[0094] In the above, GAAGGTGACCAAGTTCATGCT is the FAM fluorescent label sequence carried by the 5' end of primer F, and GAAGGTCGGAGTCAACGGATT is the HEX fluorescent label sequence carried by the 5' end of primer H.

[0095] The scatter plot based on KASP markers shows the clustering of different germplasms on the X-(FAM) axis and the Y-(HEX) axis. The genotype is determined by detecting the fluorescent signal of the amplified product.

[0096] KASP primers for detecting Ta-1B-SNP locus:

[0097] The amplification products of primers F and C only show the color of the linked FAM fluorescent label, and the strong FAM signal is concentrated in the lower right corner of the scatter plot, which means that the unit type of the wheat Ta-1B-SNP site to be tested is AA homozygous;

[0098] The amplification products of primers H and C only show the color of the linked HEX fluorescent label, and the strong HEX signal is concentrated in the upper left corner of the scatter plot, which means that the unit type of the wheat Ta-1B-SNP site to be tested is CC homozygous.

[0099] KASP primers for detecting Ta-2A-SNP locus:

[0100] The amplification products of primers F and C only show the color of the linked FAM fluorescent label, and the strong FAM signal is concentrated in the lower right corner of the scatter plot, which means that the unit type of the wheat Ta-2A-SNP site to be tested is AA homozygous;

[0101] The amplification products of primers H and C only show the color of the linked HEX fluorescent label, and the strong HEX signal is concentrated in the upper left corner of the scatter plot, which means that the unit type of the wheat Ta-2A-SNP site to be tested is GG homozygous.

[0102] KASP primers for detecting Ta-5D-SNP locus:

[0103] The amplification products of primers F and C only show the color of the linked FAM fluorescent label, and the strong FAM signal is concentrated in the lower right corner of the scatter plot, so the unit type of the tested wheat Ta-5D-SNP site is GG homozygous;

[0104] The amplification products of primers H and C only show the color of the connected HEX fluorescent label, and the strong HEX signal is concentrated in the upper left corner of the scatter plot, which means that the unit type of the wheat Ta-5D-SNP site to be tested is AA homozygous.

[0105] KASP primers for detecting Ta-6A-SNP locus:

[0106] The amplification products of primers F and C only show the color of the linked FAM fluorescent label, and the strong FAM signal is concentrated in the lower right corner of the scatter plot, which means that the unit type of the wheat Ta-6A-SNP site to be tested is TT homozygous;

[0107] The amplification products of primers H and C only show the color of the linked HEX fluorescent label, and the strong HEX signal is concentrated in the upper left corner of the scatter plot, which means that the unit type of the wheat Ta-6A-SNP site to be tested is CC homozygous.

[0108] 2. Establishment of the haplotype detection method for four SNP loci

[0109] 1. Extract the wheat genomic DNA to be tested;

[0110] 2. Using the extracted DNA as a template, PCR amplification was performed using the KASP primers corresponding to each SNP site in Table 2;

[0111] The amplification process is as follows:

[0112] (1) Preparation of KASP primer working solution

[0113] The primers were diluted into 100 μM stock solutions respectively, and then 12 μL of primer F, 12 μL of primer H, 30 μL of primer C and 46 μL of ddH2O were mixed to form the KASP-SNP Assay Mix working solution.

[0114] (2) KASP reaction system and procedure

[0115] The 10 μL reaction system of the 96-well plate is as follows: 5 μL of KASP Master mix (LGC Biosearch, KBS-1050-122), 1.5 μL of DNA template (about 60 ng), 0.14 μL of KASP-SNP Assay Mix working solution, and 3.5 μL of ddH2O. The concentration of F in the reaction system is 168 nM, the concentration of H in the reaction system is 168 nM, and the concentration of C in the reaction system is 420 nM.

[0116] The KASP reaction procedure is as follows:

[0117] Pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s; annealing and extension at 61°C for 60 s, 10 cycles, decreasing by 0.6°C in each cycle; denaturation at 94°C for 20 s, annealing and extension at 55°C for 60 s, 32 cycles; 37°C for 1 min, 37°C for 1 s (scanning fluorescence values ​​for genotype reading).

[0118] 3. Use Bio-RAD CFX96 fluorescence quantitative PCR instrument to detect the amplified products and perform genotyping based on the fluorescence data.

[0119] The detection results of the Ta-1B-SNP site are as follows: if the fluorescence signal of the amplified product is connected to the FAM fluorescent label sequence on the X-axis, the base of the wheat Ta-1B-SNP site to be tested is A, and the unit type is AA; if the fluorescence signal of the amplified product is connected to the HEX fluorescent label sequence on the Y-axis, the base of the wheat Ta-1B-SNP site to be tested is C, and the unit type is CC.

[0120] The detection results of the Ta-2A-SNP site are as follows: if the fluorescence signal of the amplified product is connected to the FAM fluorescent label sequence on the X-axis, the base of the wheat Ta-2A-SNP site to be tested is A, and the unit type is AA; if the fluorescence signal of the amplified product is connected to the HEX fluorescent label sequence on the Y-axis, the base of the wheat Ta-2A-SNP site to be tested is G, and the unit type is GG.

[0121] The detection results of the Ta-5D-SNP site are as follows: if the fluorescence signal of the amplified product is connected to the FAM fluorescent label sequence on the X-axis, the base of the wheat Ta-5D-SNP site to be tested is G, and the unit type is GG; if the fluorescence signal of the amplified product is connected to the HEX fluorescent label sequence on the Y-axis, the base of the wheat Ta-5D-SNP site to be tested is A, and the unit type is AA.

[0122] The detection results of the Ta-6A-SNP site are as follows: if the fluorescence signal of the amplified product is connected to the FAM fluorescent label sequence on the X-axis, the base of the wheat Ta-6A-SNP site to be tested is T, and the unit type is TT; if the fluorescence signal of the amplified product is connected to the HEX fluorescent label sequence on the Y-axis, the base of the wheat Ta-6A-SNP site to be tested is C, and the unit type is CC.

[0123] The wheat to be tested was genotyped with the allele-specific marker KASP using forward primer F with a FAM sequence tag, forward primer H with a HEX sequence tag, and reverse primer C.

[0124] 3. Application of SNP locus combination in detecting wheat root traits

[0125] The SNP locus combination consists of Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP loci.

[0126] Taking 255 natural populations as an example, the corresponding SNP loci were detected according to the method shown in the above two, and the KASP reaction and data analysis were performed using the Bio-RAD CFX96 fluorescence quantitative PCR instrument.

[0127] Table 3 shows the SNP unit type statistics of 255 germplasms and root biomass under hydroponic conditions

[0128]

[0129]

[0130]

[0131]

[0132]

[0133]

[0134]

[0135]

[0136] The results showed that the root biomass of wheat carrying the dominant haplotype AA of the Ta-1B-SNP locus was 16.79% higher than that of wheat carrying CC; the root biomass of wheat carrying the dominant haplotype AA of the Ta-2A-SNP locus was 16.75% higher than that of wheat carrying GG; the root biomass of wheat carrying the dominant haplotype GG of the Ta-5D-SNP locus was 18.72% higher than that of wheat carrying AA; the root biomass of wheat carrying the dominant haplotype TT of the Ta-6A-SNP locus was 16.24% higher than that of wheat carrying CC. The root biomass of wheat with four dominant haplotypes was 63.94% higher than that of wheat without dominant haplotypes, and 40.58% higher than that of wheat carrying one dominant haplotype. It can be seen that the root dry weight of wheat carrying the aggregated SNP loci is greater than or has a candidate greater than the root dry weight of wheat carrying non-aggregated SNP loci.

[0137] Wheat carrying aggregated SNP sites is wheat in which the haplotype of at least two of the four SNP sites, namely, Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP, is a dominant haplotype; specifically, wheat in which the haplotype of two of the four SNP sites, namely, Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP, is a dominant haplotype, or wheat in which the haplotype of three of the four SNP sites, namely, Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP, is a dominant haplotype, or wheat in which the haplotype of four of the four SNP sites, namely, Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP, are all dominant haplotypes.

[0138] Wheat carrying non-aggregated SNP loci is wheat in which the haplotypes of Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP loci are all non-dominant haplotypes, or wheat in which only one of Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP loci has a dominant haplotype, and the haplotypes of the other three SNP loci are all non-dominant haplotypes;

[0139] The dominant haplotype of the Ta-1B-SNP locus is AA, and the nondominant haplotype is CC;

[0140] The dominant haplotype of the Ta-2A-SNP locus is AA, and the nondominant haplotype is GG;

[0141] The dominant haplotype of the Ta-5D-SNP locus is GG, and the non-dominant haplotype is AA;

[0142] The dominant unit type of Ta-6A-SNP locus is TT, and the non-dominant unit type is CC.

[0143] According to the effect of aggregation sites on root biomass, the aggregation types of sites were divided into three levels (Ⅰ-Ⅲ). Among them, level I is a non-aggregate type, including wheat materials that do not contain dominant unit types or only contain one dominant unit type among Ta-1B-SNP-AA, Ta-2A-SNP-AA, Ta-5D-SNP-GG or Ta-6A-SNP-TT, which can be used to screen wheat materials with lower root biomass; level II is a wheat material that aggregates two dominant unit types among Ta-1B-SNP-AA, Ta-2A-SNP-AA, Ta-5D-SNP-GG or Ta-6A-SNP-TT, such as Ta-1B-SNP-AA and Ta-2A-SNP-AA aggregation or Ta-1B-SNP-AA and Ta-6A-SNP-TT aggregation, which can be used to screen wheat materials with medium root biomass; level III is a wheat material that aggregates 3-4 dominant unit types, such as Ta-1B-SNP-AA, Ta-2A-SNP-AA and Ta-6A-SNP-TT aggregation, which can be used to screen wheat materials with higher root biomass.

[0144] Table 4 shows the SNP site aggregation types

[0145] grade Ta-1B-SNP Ta-2A-SNP Ta-5D-SNP Ta-6A-SNP Root biomass Ⅰ - - - - Lower Ⅰ + - - - Lower Ⅰ - + - - Lower Ⅰ - - + - Lower Ⅰ - - - + Lower Ⅱ + + - - medium Ⅱ + - + - medium Ⅱ + - - + medium Ⅱ - + + - medium Ⅱ - + - + medium Ⅱ - - + + medium Ⅲ + + + - Higher Ⅲ + + - + Higher Ⅲ + - + + Higher Ⅲ - + + + Higher Ⅲ + + + + Higher

[0146] The aggregation types of the above four SNP sites and their corresponding root dry weights were analyzed, and the results showed that:

[0147] Under hydroponic conditions, among the 255 materials, 6 wheat materials aggregated the dominant haplotypes of 4 SNP sites (all 4 SNP sites were dominant haplotypes), with an average root dry weight of 5.82 mg; 17 wheat materials aggregated the dominant haplotypes of 3 SNP sites (3 SNP sites were dominant haplotypes, and the other 1 SNP site was non-dominant haplotype), with an average root dry weight of 5.59 mg; 139 wheat materials aggregated the dominant haplotypes of 2 SNP sites (2 SNP sites were dominant haplotypes, and the other 2 SNP sites were non-dominant haplotypes), with an average root dry weight of 4.56 mg; 62 wheat materials aggregated the dominant haplotypes of 1 SNP site (1 SNP site was the dominant haplotype, and the other 3 SNP sites were non-dominant haplotypes), with an average root dry weight of 4.14 mg; and 31 wheat materials did not aggregate the dominant haplotype (all the haplotypes of the 4 SNP sites were non-dominant haplotypes), with an average root dry weight of 3.55 mg. The root dry weight of wheat with polydominant haplotypes was significantly different from that of wheat with non-polydominant haplotypes ( Figure 1 ,in Figure 1A represents the relationship between the number of dominant unit types and root dry weight under hydroponic conditions of 255 materials. Figure 1 B represents the relationship between different SNP aggregation types and root dry weight under hydroponic conditions, + represents dominant unit type, and - represents non-dominant unit type).

[0148] Figure 2 Comparison of wheat root systems of different aggregation levels (AC).

[0149] Under soil culture conditions, the average root dry weight of wheat with four dominant haplotypes of marker types in 255 materials was 12.42 mg; the average root dry weight of wheat with three dominant haplotypes of marker types was 12.05 mg; the average root dry weight of wheat with two dominant haplotypes of marker types was 11.03 mg; the average root dry weight of wheat with one dominant haplotype of marker type was 10.50 mg; the average root dry weight of wheat without dominant haplotypes was 9.00 mg. There was a significant difference in root dry weight between wheat with dominant haplotypes and non-aggregated wheat materials ( Figure 3 A, 0 indicates wheat without aggregated dominant unit type).

[0150] The above results show that the root dry weight of the tested wheat with aggregated multiple site dominant unit types (Ta-1B-SNP-AA, Ta-2A-SNP-AA, Ta-5D-SNP-GG and Ta-6A-SNP-TT) is significantly higher than that of the non-aggregated tested wheat.

[0151] The 255 materials were divided into grades. The results showed that there were 93 grade I materials, with an average root dry weight of 3.94 mg under hydroponic conditions and 9.97 mg under soil conditions; there were 139 grade II materials, with an average root dry weight of 4.56 mg under hydroponic conditions and 11.03 mg under soil conditions; there were 23 grade III materials, with an average root dry weight of 5.62 mg under hydroponic conditions and 12.14 mg under soil conditions. Among them, the average root dry weight of grade I materials was significantly lower than that of grade II and grade III materials ( Figure 3 B and Figure 3 C).

[0152] This indicates that wheat of type III or II has a higher root biomass (measured by root dry weight) than wheat of type I.

[0153] Therefore, the root biomass of the wheat to be tested can be identified by detecting the unit type and aggregation type level of SNP sites Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP.

[0154] The specific method is as follows:

[0155] Detecting the unit type of SNP sites Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP in the wheat to be tested;

[0156] The root dry weight of wheat carrying the clustered SNP loci (level III or II) is greater than or potentially greater than the root dry weight of wheat carrying the non-clustered SNP loci (level I).

[0157] Among them, wheat carrying the aggregated SNP loci is wheat in which the haplotype of at least two of the four SNP loci Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP is a dominant haplotype; specifically, wheat in which the haplotype of two of the four SNP loci Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP is a dominant haplotype (i.e., the aggregated type The wheat with the dominant haplotype is Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP (level Ⅱ), or the wheat with the dominant haplotype is Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP (level Ⅲ), or the wheat with the dominant haplotype is Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP (level Ⅲ).

[0158] Wheat carrying non-aggregated SNP loci is wheat in which the haplotypes of Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP loci are all non-dominant haplotypes (i.e., aggregation type level I), or wheat in which only one of the SNP loci among Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP loci has a dominant haplotype, and the haplotypes of the other three SNP loci are all non-dominant haplotypes (i.e., aggregation type level I);

[0159] The dominant haplotype of the Ta-1B-SNP site is AA, and the nondominant haplotype of the Ta-1B-SNP site is CC;

[0160] The dominant haplotype of the Ta-2A-SNP site is AA, and the nondominant haplotype of the Ta-2A-SNP site is GG;

[0161] The dominant haplotype of the Ta-5D-SNP locus is GG, and the nondominant haplotype of the Ta-5D-SNP locus is AA;

[0162] The dominant unit type of Ta-6A-SNP locus is TT, and the non-dominant unit type of Ta-6A-SNP locus is CC.

[0163] Example 3: Application of SNP site markers in breeding populations

[0164] The F1 generation after hybridization of Lin5726 (ZH588 / / Jinmai919 / Yunhan1818) and ZH119 [F5 (Jinmai919 / Linfen5064) / / F3 (ZH211 / Yunhan1818)] was used, and then the F3 generation was obtained by self-pollination to detect the application of SNP locus markers in the breeding offspring population.

[0165] The method in Example 2 was used to perform genotyping of the population using markers, a Bio-RAD CFX96 fluorescence quantitative PCR instrument was used for PCR reaction and data analysis, and the method in Example 2 was used for grading.

[0166] The results showed that there were 70 Grade I materials, 121 Grade II materials, and 42 Grade III materials.

[0167] The root characteristics of the population were investigated using the method in Example 1, and the dry root weight was measured.

[0168] The root dry weight of wheat carrying the clustered SNP loci (grade II or III) is greater than or potentially greater than the root dry weight of wheat carrying the non-clustered SNP loci (grade I).

[0169] The above genotyping results and their corresponding average root dry weight were analyzed. The results showed that the root dry weight of grade I materials was significantly lower than the average root dry weight of grade II and grade III materials.

[0170] The above results indicate that the tested wheat (grade III) with aggregated site unit types (Ta-1B-SNP-AA, Ta-2A-SNP-AA, Ta-5D-SNP-GG and Ta-6A-SNP-TT) has higher root biomass than the wheat without aggregated advantageous unit type (grade I).

[0171] It can be seen that the SNP sites Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP and their aggregation type levels can be used to quickly identify whether the tested wheat has a higher root biomass.

[0172] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. Application of a substance for detecting the unit type of four SNP sites Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP in the wheat genome in any of the following: Or, the use of a substance for detecting the unit type of any one of the four SNP sites Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP in the wheat genome in any of the following: A1) Identify or assist in identifying wheat root biomass; A2) Screening or assisting in the selection of wheat with high root biomass; A3) Breeding wheat with high root biomass; A4) Wheat genetics and breeding; The SNP site Ta-1B-SNP is position 83 of SEQ ID NO: 1; The SNP site Ta-2A-SNP is position 92 of SEQ ID NO: 2; The SNP site Ta-5D-SNP is position 59 of SEQ ID NO: 3; The SNP site Ta-6A-SNP is position 41 of SEQ ID NO:

4.

2. The use according to claim 1, Features: The unit type of the SNP site Ta-1B-SNP is AA or CC; The unit type of the SNP site Ta-2A-SNP is AA or GG; The unit type of the SNP site Ta-5D-SNP is GG or AA; The unit type of the SNP site Ta-6A-SNP is TT or CC.

3. The use according to claim 1 or 2, Features: The substance is B1) or B2): B1) Primer set; B2) a PCR reagent or a kit containing the set of primers; The primer set includes primer F, primer H and primer C; The nucleotide sequence of the primer F includes the sequence shown in SEQ ID NO: 5, 22-43, SEQ ID NO: 8, 22-42, SEQ ID NO: 11, 22-41, or SEQ ID NO: 14, 22-43; The nucleotide sequence of the primer H includes the sequence shown in SEQ ID NO: 6, 22-43, SEQ ID NO: 9, 22-42, SEQ ID NO: 12, 22-41, or SEQ ID NO: 15, 22-43; The nucleotide sequence of the primer C is SEQ ID NO: 7 or SEQ ID NO: 10 or SEQ ID NO: 13 or SEQ ID NO:

16.

4. The use according to claim 3, Features: The nucleotide sequence of the primer F is the sequence shown in SEQ ID NO: 5 or SEQ ID NO: 8 or SEQ ID NO: 11 or SEQ ID NO: 14; The nucleotide sequence of the primer H is the sequence shown in SEQ ID NO: 6, SEQ ID NO: 9, SEQ ID NO: 12 or SEQ ID NO:

15.

5. Any of the following substances: The set of primers as claimed in claim 3; Or, a PCR reagent or kit containing the set of primers described in claim 3.

6. Use of the primer set, PCR reagent or kit according to claim 5 in any of the following: A1) Identify or assist in identifying wheat root biomass; A2) Screening or assisting in the selection of wheat with high root biomass; A3) Breeding wheat with high root biomass; A4) Wheat genetics and breeding.

7. Method C1 or C2 as follows: C1. A method for identifying or assisting in identifying wheat root biomass, comprising the following steps: detecting the unit type of SNP sites Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP in the wheat genome, and the root biomass of wheat carrying the aggregated SNP sites is greater than or has a candidate greater than that of wheat carrying the non-aggregated SNP sites; The wheat carrying the aggregated SNP loci is wheat in which the haplotypes of at least two of the four SNP loci, Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP, are dominant haplotypes; The wheat carrying the non-aggregated SNP loci is wheat in which the haplotypes of Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP loci are all non-dominant haplotypes, or wheat in which the haplotype of only one of the Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP loci is a dominant haplotype, and the haplotypes of the other three SNP loci are all non-dominant haplotypes; The dominant unit type of the Ta-1B-SNP site is AA, and the non-dominant unit type of the Ta-1B-SNP site is CC; The dominant unit type of the Ta-2A-SNP site is AA, and the non-dominant unit type of the Ta-2A-SNP site is GG; The dominant unit type of the Ta-5D-SNP site is GG, and the non-dominant unit type of the Ta-5D-SNP site is AA; The dominant unit type of the Ta-6A-SNP site is TT, and the non-dominant unit type of the Ta-6A-SNP site is CC; C2. A method for identifying or assisting in identifying wheat root biomass, comprising the following steps: detecting any unit type of SNP sites Ta-1B-SNP, Ta-2A-SNP, Ta-5D-SNP and Ta-6A-SNP in the wheat genome, and the root biomass of wheat carrying a dominant unit type of a certain SNP site is greater than or has the potential to be greater than that of wheat carrying a non-dominant unit type of the SNP site.

8. The method according to claim 7, Features: The method for detecting the unit type of each SNP site in the wheat genome comprises the following steps: using the wheat genome to be tested as a template, using the primers corresponding to each SNP site in claim 4 to perform KASP reaction respectively, and obtaining the unit type of each SNP site.

9. A method for breeding wheat with high root biomass, comprising the following steps: breeding wheat carrying the aggregated SNP loci as claimed in claim 7 or 8.

Images