Primer probe combination, kit and method for detecting and identifying porcine parvovirus type 1-8

Abstract

The invention discloses a primer probe combination, a kit and a method for detecting and identifying porcine parvovirus type 1-8, and relates to the technical field of molecular biology. The primer probe combination comprises a forward primer, a reverse primer and a probe which are used for detecting and identifying porcine parvoviruses 1-8, the nucleotide sequence of the forward primer is shown as SEQ ID NO.1-8, the nucleotide sequence of the reverse primer is shown as SEQ ID NO.9-16, and the nucleotide sequence of the probe is shown as SEQ ID NO.17-24. The invention further discloses a kit for detecting and identifying the porcine parvoviruses 1-8. The primer probe combination provided by the invention can be used for simultaneously detecting eight genotypes of porcine parvoviruses in one reaction system, and is wide in coverage range; the kit is high in specificity, and has no cross reaction with common engineering cell genomes such as PK-15, 293, CHO-K1, Vero and the like and common swine-origin pathogens such as PCV-2, PRV and the like; the sensitivity is high, and the detection limit of each PPV genotype is 100 copies / reaction; the two quadruple qPCR detection systems are coupled with different fluorophores through probes, and the specific infected PPV genotypes in a sample to be detected can be identified.

Description

Technical Field

[0001] The present invention relates to the technical field of biological detection of parvovirus, and in particular to a primer-probe combination, a kit and a method for detecting and identifying porcine parvovirus types 1-8. Background Art

[0002] Porcine parvovirus (PPV) belongs to the Parvoviridae family, and the diameter of the virus particles is about 20-22nm. PPV has no envelope, can replicate autonomously, and is a single-stranded linear DNA virus. The PPV genome is 4-6Kb in length and has two open reading frames, encoding the structural protein VP and the non-structural protein NS. In the early 1860s, porcine parvovirus was first discovered in cell culture contaminants in Germany, and PPV1 was subsequently isolated through etiological studies. At present, new genotypes of PPV have been discovered at home and abroad through high-throughput sequencing and other technical means. The reported PPV is divided into 8 genotypes according to gene sequence homology, namely PPV1-PPV8.

[0003] Porcine parvovirus is a common pathogen that causes reproductive disorders in pigs, with strong infectivity and environmental resistance. After infection with PPV, primiparous sows will give birth to deformed fetuses, mummified fetuses, etc. In severe cases, sows will have miscarriages, leading to embryo and fetal death. Studies have shown that PPV is also related to non-suppurative myocarditis, dermatitis, enteritis and viremia in pigs. Porcine parvovirus is often mixed with porcine circovirus type 2 (PCV-2), pseudorabies virus (PRV) and other mixed cross-infections, jointly causing multi-systemic diseases in pigs. For example, infection with PPV will enhance the multi-systemic wasting syndrome of weaned piglets caused by PCV-2. PPV infection is common in farms at home and abroad, seriously affecting and restricting the development of the pig industry, causing huge economic losses to the pig industry.

[0004] In addition, PPV can grow and reproduce on almost all primary porcine cells and porcine kidney passage cells. In the production process of biological products, relevant raw materials from pigs, such as pancreatic enzymes, are often used. The General Rules for Biological Products in the Chinese Pharmacopoeia, "Preparation and Quality Control of Animal Cell Matrix for Biological Product Production Inspection", states that if pancreatic enzymes are used in the establishment or passage history of the cell matrix before the producer builds a cell bank, the established MCB or WCB and (or) cells exceeding the production limit level should be tested at least once for exogenous viruses related to the pancreatic enzyme source animal, including porcine parvovirus or bovine parvovirus. The detection methods for porcine parvovirus include cell method, blood adsorption method, immunofluorescence method, real-time fluorescence quantitative PCR molecular detection technology, etc. The cell method is complex and time-consuming, the blood adsorption method is cumbersome and has relatively low sensitivity, and the immunofluorescence method has high requirements for instruments. Real-time fluorescence quantitative PCR (TaqMan probe method) has the advantages of strong specificity, high sensitivity, simplicity and rapidity, and is widely used for virus detection. Currently, the existing technology cannot provide a detection method that can simultaneously cover 8 porcine parvovirus genotypes and has strong specificity and high sensitivity for identifying 8 porcine parvoviruses. Summary of the invention

[0005] In view of the problems existing in the prior art, the present invention provides a primer-probe combination for detecting and identifying porcine parvovirus types 1-8. The method is based on TaqMan probe fluorescent quantitative PCR technology, and a PPV-qPCR detection system that can simultaneously cover 8 genotypes is established. At the same time, two quadruple qPCR detection systems are established, which can identify PPV genotypes, and have the characteristics of wide coverage, strong specificity and high sensitivity. The method is specifically implemented by the following technical solutions:

[0006] In a first aspect of the present invention, a primer-probe combination for detecting and identifying porcine parvovirus types 1-8 is provided, which comprises a forward primer, a reverse primer and a probe for detecting PPV1-PPV8; the nucleotide sequences of the forward primers of PPV1-PPV8 are respectively shown as SEQ ID NOs.1-8, the nucleotide sequences of the reverse primers of PPV1-PPV8 are respectively shown as SEQ ID NOs.9-16, the nucleotide sequences of the probes of PPV1-PPV8 are respectively shown as SEQ ID NOs.17-24, and in the nucleotide sequences, the degenerate base Y represents C or T, and R represents A or G;

[0007] The 5' ends of the 8 probes are respectively coupled with fluorescent groups, and the 3' ends are respectively coupled with quenching groups. Specifically, the 5' ends of the probes of PPV1-PPV8 are respectively coupled with the first fluorescent group, the second fluorescent group, the third fluorescent group, the fourth fluorescent group, the fifth fluorescent group, the sixth fluorescent group, the seventh fluorescent group, and the eighth fluorescent group, and the above fluorescent groups can be the same or different.

[0008] Furthermore, the fluorescent group is selected from any one of FAM, Texas Red, CY3, CY5, VIC, TET, NED, ROX, JOE or HEX fluorescent groups; and the quenching group is selected from any one of TAMRA, NFQ, ECLIPSE, DABCYL, MGB, BHQ1 or BHQ2 quenching groups.

[0009] A second aspect of the present invention provides a kit comprising the above primer-probe combination, and further comprising ProbeMaster Mix, RNase-free water, a negative control, a positive control, a sensitivity control, and a no-template control;

[0010] The negative control is PBS buffer, the positive control is one of the PPV1-PPV8 virus solutions, the sensitivity control is one of the PPV1-PPV8 plasmid standards, and the no-template control is RNase-free water.

[0011] It should be noted that the positive control is a virus solution of one of PPV1-PPV8 diluted with PBS buffer.

[0012] It should be noted that in the above kits, the sensitivity control varies according to the purpose of the kit; when the kit is used to detect whether PPV1-PPV8 is infected, the sensitivity control is one of the pUC57-PPV1 to pUC57-PPV8 plasmid standards; when the kit is used to identify PPV1-PPV8, 8 PPV plasmid standards pUC57-PPV1 to pUC57-PPV8 are selected as sensitivity controls for each PPV genotype; its function is to monitor the effectiveness of the qPCR reaction and detect whether the test results are affected by abnormalities in experimental materials such as enzymes and primers. It is a control that must be set when testing test products in the pharmacopoeia. The difference from the positive control is that the positive control participates in extraction and qPCR, monitoring the entire detection process.

[0013] Furthermore, the above-mentioned kit also includes a suitability control, an internal control plasmid and a corresponding internal control probe; the suitability control is a mixture of the positive control and the sample to be tested, the nucleotide sequence of the target fragment of the internal control plasmid is shown in SEQ ID NO.26, the nucleotide sequence of the internal control probe is shown in SEQ ID NO.25, the 5' end of the internal control probe is coupled with a ninth fluorescent group different from the fluorescent group, and the 3' end is coupled with a quenching group.

[0014] It should be noted that in the above-mentioned kit, the suitability control is to add the same virus solution as the positive control to the sample to be tested. Its function is to monitor whether the sample to be tested contains qPCR inhibitors that inhibit the detection of porcine parvovirus types 1-8, so as to avoid false negative test results.

[0015] It should be noted that the internal control plasmid and the corresponding internal control probe are used to monitor the PCR inhibition phenomenon in the sample to be tested.

[0016] It should be noted that the ninth fluorescent group is selected from any one of FAM, Texas Red, CY3, CY5, VIC, TET, NED, ROX, JOE or HEX fluorescent groups; the quenching group is selected from any one of TAMRA, NFQ, ECLIPSE, DABCYL, MGB, BHQ1 or BHQ2 quenching groups.

[0017] The third aspect of the present invention provides the use of the above primer-probe combination in the preparation of a kit for detecting and / or identifying porcine parvovirus types 1-8.

[0018] The fourth aspect of the present invention provides the use of the above primer-probe combination or the above kit in detecting and / or identifying porcine parvovirus types 1-8.

[0019] The fifth aspect of the present invention provides the use of the above primer-probe combination in detecting and / or identifying porcine parvovirus types 1-8 using TaqMan probe fluorescent quantitative PCR.

[0020] The sixth aspect of the present invention provides a TaqMan probe fluorescent quantitative PCR detection method for porcine parvovirus type 1-8 using the above primer-probe combination;

[0021] It should be noted that when the above primer-probe combination is used to detect infection with porcine parvovirus type 1-8, the 5' end of the probes of PPV1-PPV8 are coupled with a first fluorescent group, and the first fluorescent group is selected from any one of FAM, Texas Red, CY3, CY5, VIC, TET, NED, ROX, JOE or HEX fluorescent groups;

[0022] The following steps are involved:

[0023] (1) taking DNA of the sample to be tested, the negative control, the positive control, the suitability control, the sensitivity control and the no-template control, diluting the sensitivity control to a predetermined concentration, and preparing them into qPCR working solutions respectively;

[0024] (2) Add the DNA of the test sample, negative control, positive control, suitability control, sensitivity control and no-template control to the qPCR reaction system containing Probe Master Mix, internal control probe, internal control plasmid, RNase-free water and the forward primer, reverse primer and probe of PPV1-PPV8;

[0025] (3) Create a first fluorescent group detection channel and a ninth fluorescent group detection channel on a fluorescent quantitative PCR instrument, perform qPCR reactions on the test sample, negative control, positive control, suitability control, sensitivity control and no-template control, respectively, read the Ct values ​​of the first fluorescent group detection channel and the ninth fluorescent group detection channel, and determine the validity of the test and the test results of the test sample based on the Ct values;

[0026] The criteria for judging the effectiveness of the test are:

[0027] No-template control: There is no Ct value in the first fluorescent group detection channel and the ninth fluorescent group detection channel, and there is no obvious amplification curve.

[0028] Sensitivity control: Both the first fluorescent group detection channel and the ninth fluorescent group detection channel have obvious amplification curves, and the Ct value is <38.

[0029] Negative control: The first fluorescent group detection channel has no Ct value and no obvious amplification curve; the ninth fluorescent group detection channel has an obvious amplification curve and the Ct value is <38.

[0030] Positive control: The first fluorescent group detection channel has an obvious amplification curve, and the Ct value is ≤35; the ninth fluorescent group detection channel has an obvious amplification curve, and the Ct value is <38.

[0031] Suitability control: There is an obvious amplification curve. If the Ct value increases, the difference with the positive control Ct value is within 3 Ct values.

[0032] As an example of the test validity judgment standard, the first fluorescent group detection channel is the FAM channel and the ninth fluorescent group detection channel is the HEX channel, as shown below:

[0033] No template control: There is no Ct value in both the FAM channel and the HEX channel, and no obvious amplification curve.

[0034] Sensitivity control: Both the FAM channel and the HEX channel had obvious amplification curves, and the Ct value was <38.

[0035] Negative control: FAM channel has no Ct value and no obvious amplification curve; HEX channel has an obvious amplification curve and the Ct value is <38.

[0036] Positive control: The FAM channel has an obvious amplification curve, and the Ct value is ≤35; the HEX channel has an obvious amplification curve, and the Ct value is <38.

[0037] Suitability control: There is an obvious amplification curve. If the Ct value increases, the difference with the positive control Ct value is within 3 Ct values.

[0038] The criteria for judging the test results of the samples to be tested are shown in Table 1 below.

[0039] Table 1 Criteria for judging PPV qPCR test results

[0040]

[0041] The seventh aspect of the present invention provides a TaqMan probe fluorescent quantitative PCR identification method for porcine parvovirus type 1-8 using the above primer-probe combination;

[0042] It should be noted that when the above primer-probe combination is used to identify porcine parvovirus types 1-8, the first fluorescent group, the second fluorescent group, the third fluorescent group, and the fourth fluorescent group coupled to the 5' end of the probes of PPV1-PPV4 are four different fluorescent groups, and the fifth fluorescent group, the sixth fluorescent group, the seventh fluorescent group, and the eighth fluorescent group coupled to the 5' end of the probes of PPV5-PPV8 are four different fluorescent groups;

[0043] The following steps are involved:

[0044] (1) taking DNA of the sample to be tested, the negative control, the positive control, the sensitivity control and the no-template control, diluting the sensitivity control to a predetermined concentration, and preparing them into qPCR working solutions respectively;

[0045] (2) Establish two qPCR reaction systems, namely the PPV1-PPV4 quadruple qPCR reaction system and the PPV5-PPV8 quadruple qPCR reaction system;

[0046] The DNA of the sample to be tested, the negative control, the positive control, the sensitivity control and the no-template control were respectively added to the PPV1-PPV4 quadruple qPCR reaction system containing Probe Master Mix, RNase-free water and the forward primer, reverse primer and probe of PPV1-PPV4;

[0047] The DNA of the sample to be tested, the negative control, the positive control, the sensitivity control and the no-template control were respectively added to the PPV5-PPV8 quadruple qPCR reaction system containing Probe Master Mix, RNase-free water and the forward primer, reverse primer and probe of the PPV5-PPV8;

[0048] Create a first fluorescent group detection channel, a second fluorescent group detection channel, a third fluorescent group detection channel, and a fourth fluorescent group detection channel on a fluorescent quantitative PCR instrument, perform PPV1-PPV4 qPCR reactions on the test sample, negative control, positive control, sensitivity control, and no-template control, respectively, read the Ct values ​​of the first fluorescent group detection channel to the fourth fluorescent group detection channel, respectively, and determine the validity of the test and the test result of the test sample based on the Ct value;

[0049] Create a fifth fluorescent group detection channel, a sixth fluorescent group detection channel, a seventh fluorescent group detection channel, and an eighth fluorescent group detection channel on a fluorescent quantitative PCR instrument, perform PPV5-PPV8 qPCR reactions on the test sample, negative control, positive control, sensitivity control, and no-template control, respectively, read the Ct values ​​of the fifth fluorescent group detection channel to the eighth fluorescent group detection channel, respectively, and determine the validity of the test and the test result of the test sample based on the Ct value;

[0050] The criteria for judging the effectiveness of the test are:

[0051] The negative control has no Ct value and no obvious amplification curve; and the positive control has a Ct value ≤35 and has an obvious amplification curve; and the sensitivity control has an obvious amplification curve and a Ct value <38; and the no-template control has no Ct value and no obvious amplification curve; then the test is judged to be valid; otherwise, the test is judged to be invalid.

[0052] Furthermore, the first fluorescent group is FAM, the second fluorescent group is HEX, the third fluorescent group is CY5, the fourth fluorescent group is Texas Red, the fifth fluorescent group is HEX, the sixth fluorescent group is FAM, the seventh fluorescent group is Texas Red, the eighth fluorescent group is CY5, and the ninth fluorescent group is HEX; the quenching group of the PPV1 is BHQ1, the quenching group of the PPV2 is BHQ1, the quenching group of the PPV3 is MGB, the quenching group of the PPV4 is MGB, the quenching group of the PPV5 is MGB, the quenching group of the PPV6 is BHQ1, the quenching group of the PPV7 is MGB, and the quenching group of the PPV8 is MGB.

[0053] The criteria for judging the test results of the samples to be tested are shown in Table 2 below.

[0054] Table 2 Criteria for judging the results of quadruple qPCR detection

[0055]

[0056] Compared with the prior art, the present invention has the following beneficial effects:

[0057] 1. The primer-probe combination provided by the present invention is used for fluorescent quantitative PCR, and the presence of porcine parvovirus in the sample can be quickly determined based on the Ct value and the amplification curve. Eight genotypes of porcine parvovirus can be detected simultaneously, covering a wide range.

[0058] 2. It has strong specificity and has no cross-reaction with common engineered cell genomes such as PK-15, 293, CHO-K1, Vero, and common pig pathogens such as PCV-2 and PRV.

[0059] 3. High sensitivity, the detection limit of each PPV genotype is 100 copies / reaction.

[0060] 4. The two quadruple qPCR detection systems can identify the specific PPV genotype infected in the sample by coupling probes with different fluorescent groups. BRIEF DESCRIPTION OF THE DRAWINGS

[0061] Figure 1 The standard curve and linearity of the plasmid standards of PPV1-PPV8 in Example 3;

[0062] Figure 2 The specificity verification result of the PPV qPCR detection system in Example 4;

[0063] Figure 3 The standard curve and linearity of the PPV1-PPV4 quadruple qPCR reaction system in Example 5;

[0064] Figure 4 The standard curve and linearity of the PPV5-PPV8 quadruple qPCR reaction system in Example 5;

[0065] Figure 5 This is the identification and verification result of PPV in Example 6. DETAILED DESCRIPTION

[0066] The technical solution of the present invention will be described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0067] The detection primers used in the following examples were all synthesized by Wuhan Tianyi Huiyuan Biotechnology Co., Ltd., and the probes, internal control probes and internal control plasmids of PPV1-PPV8 were all synthesized by Sangon Biotechnology (Shanghai) Co., Ltd.

[0068] Unless otherwise specified, the technical solutions used in the following examples all use conventional molecular biological techniques. The human cells (e.g., human embryonic kidney cells 293), monkey cell lines (e.g., African green monkey kidney cells Vero), hamster cell lines (e.g., Chinese hamster ovary cells CHO-K1), and porcine cell lines (e.g., porcine kidney cells PK-15) used are all preserved by the company. The porcine parvovirus PPV1-PPV8 used are all preserved by the company.

[0069] Optionally, when the internal control plasmid is added to the qPCR reaction system, the internal control plasmid is 1000 copies / μL.

[0070] Unless otherwise specified, the reagents (such as qPCR reaction solution, reagents of nucleic acid extraction system, buffer solutions, etc.), kits and technical solutions used in the following examples are all commercially available reagents, kits, and conventional molecular biology techniques in the industry.

[0071] Example 1: Synthesis of primer probe

[0072] 1. Design and synthesis of primers and probes for PPV1-PPV8

[0073] The genomes of PPV1-PPV8 were downloaded from NCBI and sequenced. Primers and probes that can specifically detect and identify each PPV genotype were designed. The primers were synthesized by Tianyi Huiyuan and purified by PAGE. The probes were synthesized by Sangon Biotechnology and purified by HPLC. The sequences are shown in Table 3 below.

[0074] Table 3 Nucleotide sequences of primer-probe combinations

[0075]

[0076] 2. Synthesis of internal control plasmid and probe sequence

[0077] The target fragment of the internal control plasmid was artificially synthesized and the recombinant plasmid pUC57-IC was constructed. The plasmid was used as a template and added to the PPV qPCR detection system. The nucleotide sequence of the target fragment is shown in SEQ ID NO.26, specifically: ctacaacaaagatacaacagatgcggctatgccggtgcctagcttaacaccaacttgcctaggtgctagagcctcacaaaacggcaagt, and the nucleotide sequence of the corresponding internal control probe is shown in SEQ ID NO.25, specifically: ccggtgcctagcttaacacc.

[0078] Example 2: Establishment of PPV qPCR detection system

[0079] Synthesize the pUC57-IC recombinant plasmid and determine its concentration. Calculate the pUC57-IC plasmid copy number according to Formula 1 and dilute it to 1000 copies / μL for later use.

[0080] Using AceQ Universal U +Probe Master Mix V2, configure the PPVqPCR detection reaction system according to Table 4, and perform dual-channel qPCR according to the reaction program in Table 5, where the detection targets of the detection channels are PPV and internal control plasmid respectively.

[0081] It should be noted that the fluorescent group coupled to the 5' end of the probes of PPV1-PPV8 is the same fluorescent group, which is the first fluorescent group; the fluorescent group coupled to the 5' end of the internal control probe corresponding to the internal control plasmid is the ninth fluorescent group.

[0082] Formula 1:

[0083] Copy number (copies / μL)

[0084] Table 4 PPV-qPCR detection reaction system

[0085]

[0086] Table 5 PPV qPCR reaction procedure

[0087]

[0088] Example 3: Linearity and sensitivity verification of PPV qPCR detection system

[0089] Eight PPV genome sequences were artificially synthesized and recombinant plasmids were constructed to prepare standards. A standard curve was established. Eight PPV plasmid standards (pUC57-PPV1, pUC57-PPV2, pUC57-PPV3, pUC57-PPV4, pUC57-PPV5, pUC57-PPV6, pUC57-PPV7, and pUC57-PPV8) and an internal control plasmid standard pUC57-IC were artificially constructed. The plasmid standards were extracted using the Plasmid MiniKit I kit (OMEGA, D6943-02), and the plasmid concentration was measured. The plasmid copy number was calculated and diluted to 2 × 10 6 copies / μL-2×10 2 copies / μL as each point of the standard curve. 1 500 copies / μL PPV plasmid standard solution was used as a plasmid sensitivity control, and 500 copies of pUC57-IC plasmid standard were added to each reaction as an internal control of the reaction system.

[0090] qPCR was performed using the amplification system and program in Tables 3 and 4. The experiment was repeated three times independently on three different days, and the plasmid sensitivity control was repeated 8 wells each time.

[0091] The test results show that the PPV-qPCR detection reaction system in this scheme uses 8 kinds of PPV plasmid standards as templates, and the linear correlation coefficient R 2 >0.99, and the plasmid sensitivity reached 100 copies / reaction. The experimental results are shown in Table 6 and Figure 1 .

[0092] Table 6 PPV plasmid standard test results

[0093]

[0094] Therefore, the following PPV qPCR detection method can be established:

[0095] It should be noted that when the above primer-probe combination is used to detect infection with porcine parvovirus types 1-8, the 5' ends of the PPV1-PPV8 probes are coupled with the first fluorescent group, and the 5' end of the internal control probe is coupled with the ninth fluorescent group;

[0096] The following steps are involved:

[0097] (1) Take DNA from the sample to be tested, negative control, positive control, suitability control, sensitivity control and no-template control, dilute the sensitivity control to a predetermined concentration, and prepare them into qPCR working solutions respectively;

[0098] (2) Add the DNA of the test sample, negative control, positive control, suitability control, sensitivity control and no-template control to the qPCR reaction system containing Probe Matser Mix, internal control probe, internal control plasmid, RNase-free water and PPV1-PPV8 forward primer, reverse primer and probe;

[0099] (3) Create a first fluorescent group detection channel and a ninth fluorescent group detection channel on a fluorescent quantitative PCR instrument, perform qPCR reactions on the test sample, negative control, positive control, suitability control, sensitivity control and no-template control, respectively, read the Ct values ​​of the first fluorescent group detection channel and the ninth fluorescent group detection channel, and determine the validity of the test and the test results of the test sample based on the Ct values;

[0100] The criteria for judging the effectiveness of the test are:

[0101] No-template control: There is no Ct value in the first fluorescent group detection channel and the ninth fluorescent group detection channel, and there is no obvious amplification curve.

[0102] Sensitivity control: Both the first fluorescent group detection channel and the ninth fluorescent group detection channel have obvious amplification curves, and the Ct value is <38.

[0103] Negative control: The first fluorescent group detection channel has no Ct value and no obvious amplification curve; the ninth fluorescent group detection channel has an obvious amplification curve and the Ct value is <38.

[0104] Positive control: The first fluorescent group detection channel has an obvious amplification curve, and the Ct value is ≤35; the ninth fluorescent group detection channel has an obvious amplification curve, and the Ct value is <38.

[0105] Suitability control: There is an obvious amplification curve. If the Ct value increases, the difference with the positive control Ct value is within 3 Ct values.

[0106] As an example of the test validity judgment standard, the first fluorescent group detection channel is the FAM channel and the ninth fluorescent group detection channel is the HEX channel, as shown below:

[0107] No template control: There is no Ct value in both the FAM channel and the HEX channel, and no obvious amplification curve.

[0108] Sensitivity control: Both the FAM channel and the HEX channel had obvious amplification curves, and the Ct value was <38.

[0109] Negative control: FAM channel has no Ct value and no obvious amplification curve; HEX channel has an obvious amplification curve and the Ct value is <38.

[0110] Positive control: The FAM channel has an obvious amplification curve, and the Ct value is ≤35; the HEX channel has an obvious amplification curve, and the Ct value is <38.

[0111] Suitability control: There is an obvious amplification curve. If the Ct value increases, the difference with the positive control Ct value is within 3 Ct values.

[0112] The criteria for judging the test results of the samples to be tested are shown in Table 1.

[0113] Example 4 Specificity verification of PPV qPCR detection method

[0114] 1. Extraction of genomic DNA from various biological cells

[0115] (1) Human and animal cell genomic DNA

[0116] Porcine kidney cells PK-15, African green monkey kidney cells Vero, Chinese hamster ovary cells CHO-K1, and human embryonic kidney cells 293 were all preserved by our company and used QIAamp ® Genomic DNA was extracted using Mini kit (50) (QIAGEN, 51304).

[0117] (2) Viral genomic DNA

[0118] Porcine circovirus PCV-2 and pseudorabies virus PRV were both preserved by our company, and genomic DNA was extracted using Viral Nucleic Acid purification kit (simgen, 4002050).

[0119] 2. Preparation of working concentration genomic DNA

[0120] The concentrations of the cell and viral genome DNA mentioned above were measured using a micro-spectrophotometer. According to the measured concentrations, the human and animal cell genomes were diluted to 20 ng / μL with RNase-free water, and the physical titers of the viruses PCV-2 and PRV were 10 8 After extracting DNA from the virus solution with 100 copies / mL, 5 μL was taken as template for qPCR. The pUC57-PPV1 plasmid standard 100 copies / reaction was used as the qPCR sensitivity control.

[0121] The qPCR reaction system and procedure were the same as those in Tables 4 and 5 above.

[0122] The results are as follows Figure 2 As shown in Table 7, the PPV qPCR detection system had no cross-reaction with common engineered cell genomes and common swine viruses PCV-2 and PRV genomes. The amplification of non-PPV genomic DNA is summarized in Table 7.

[0123] Table 7 PPV specificity

[0124]

[0125] Example 5: Linearity and sensitivity verification of PPV quadruple qPCR system

[0126] Dilute 8 PPV plasmid standards (pUC57-PPV1, pUC57-PPV2, pUC57-PPV3, pUC57-PPV4, pUC57-PPV5, pUC57-PPV6, pUC57-PPV7, pUC57-PPV8) to 2 × 10 6 copies / μL-2×10 2 copies / μL as each point of the standard curve, 2×10 1 copies / μL PPV plasmid standard solution was used as a sensitivity control.

[0127] qPCR was performed using the amplification systems in Tables 8 and 9 and the reaction program in Table 5, respectively. The experiment was repeated three times independently on three different days, and the plasmid sensitivity control was repeated 8 wells each time.

[0128] The first to fourth fluorescent groups coupled to the 5' ends of the probes PPV1-PPV4 are four different fluorescent groups, and the fifth to eighth fluorescent groups coupled to the 5' ends of the probes PPV5-PPV8 are four different fluorescent groups.

[0129] The test results showed that when the PPV1-PPV4 quadruple qPCR reaction system used PPV1-PPV4 plasmid standards as templates, and the PPV5-PPV8 quadruple qPCR reaction system used PPV5-PPV8 plasmid standards as templates, the linear correlation coefficients of the calibration curves were R 2 >0.99, and the plasmid sensitivity reached 100 copies / reaction. Figure 3 , Figure 4 And Table 10.

[0130] Table 8 PPV1-PPV4 quadruple qPCR reaction system

[0131]

[0132] Table 9 PPV5-PPV8 quadruple qPCR reaction system

[0133]

[0134] Table 10 PPV standard test results of quadruple qPCR system

[0135]

[0136] It can be seen from this that the following PPV quadruple qPCR identification method can be established:

[0137] It should be noted that when the above primer-probe combination is used to identify porcine parvovirus types 1-8, the first fluorescent group, the second fluorescent group, the third fluorescent group, and the fourth fluorescent group coupled to the 5' end of the probes of PPV1-PPV4 are four different fluorescent groups, and the fifth fluorescent group, the sixth fluorescent group, the seventh fluorescent group, and the eighth fluorescent group coupled to the 5' end of the probes of PPV5-PPV8 are four different fluorescent groups;

[0138] The following steps are involved:

[0139] (1) Take DNA from the sample to be tested, negative control, positive control, sensitivity control and no-template control, dilute the sensitivity control to a predetermined concentration, and prepare them into qPCR working solutions respectively;

[0140] (2) Establish two qPCR reaction systems, namely the PPV1-PPV4 quadruple qPCR reaction system and the PPV5-PPV8 quadruple qPCR reaction system;

[0141] The DNA of the sample to be tested, the negative control, the positive control, the sensitivity control and the no-template control were respectively added to the PPV1-PPV4 quadruple qPCR reaction system containing Probe Master Mix, RNase-free water and the forward primer, reverse primer and probe of PPV1-PPV4;

[0142] The DNA of the sample to be tested, the negative control, the positive control, the sensitivity control and the no-template control were respectively added to the PPV5-PPV8 quadruple qPCR reaction system containing Probe Master Mix, RNase-free water and the forward primer, reverse primer and probe of the PPV5-PPV8;

[0143] Create a first fluorescent group detection channel, a second fluorescent group detection channel, a third fluorescent group detection channel, and a fourth fluorescent group detection channel on a fluorescent quantitative PCR instrument, perform PPV1-PPV4 qPCR reactions on the test sample, negative control, positive control, sensitivity control, and no-template control, respectively, read the Ct values ​​of the first fluorescent group detection channel to the fourth fluorescent group detection channel, respectively, and determine the validity of the test and the test result of the test sample based on the Ct value;

[0144] Create a fifth fluorescent group detection channel, a sixth fluorescent group detection channel, a seventh fluorescent group detection channel, and an eighth fluorescent group detection channel on a fluorescent quantitative PCR instrument, perform PPV5-PPV8 qPCR reactions on the test sample, negative control, positive control, sensitivity control, and no-template control, respectively, read the Ct values ​​of the fifth fluorescent group detection channel to the eighth fluorescent group detection channel, respectively, and determine the validity of the test and the test result of the test sample based on the Ct value;

[0145] The criteria for judging the effectiveness of the test are:

[0146] The negative control has no Ct value and no obvious amplification curve; and the positive control has an obvious amplification curve with a Ct value ≤ 35; and the sensitivity control has an obvious amplification curve and a Ct value < 38; and the no-template control has no Ct value and no obvious amplification curve; then the test is determined to be valid; otherwise, the test is determined to be invalid;

[0147] The criteria for judging the test results of the samples to be tested are shown in Table 2.

[0148] Example 6: Identification and verification of PPV1-8

[0149] Using 8 pUC57-PPV plasmid standards as templates, the qPCR reaction systems in Tables 8 and 9 and the amplification program in Table 5 were used to detect PPV1, PPV2, PPV3, PPV4, PPV5, PPV6, PPV7 and PPV8, respectively.

[0150] The results are as follows Figure 5 As shown, the FAM channel of the PPV1-PPV4 quadruple qPCR detection system only amplifies PPV1, the HEX channel only amplifies PPV2, the Texas Red channel only amplifies PPV4, and the Cy5 channel only amplifies PPV3. The FAM channel of the PPV5-PPV8 quadruple qPCR detection system only amplifies PPV6, the HEX channel only amplifies PPV5, the Texas Red channel only amplifies PPV7, and the Cy5 channel only amplifies PPV8. This shows that the two quadruple qPCR reaction systems can quickly and accurately identify porcine parvovirus 1-8 genotypes.

[0151] Example 7: Application example of PPV detection method

[0152] (1) PPV test in pancreatic enzyme

[0153] According to the pancreatic enzyme production process, porcine pancreatic enzymes are usually derived from a mixture of multiple enzymes extracted from pig tissues. Pancreatic enzymes are widely used for adherent cell passage. To avoid the risk of porcine virus contamination introduced by the use of pancreatic enzymes, the PPVqPCR method in this protocol is used to perform PPV inspection on pancreatic enzymes to determine whether there is PPV contamination. The DNA extraction of the following samples uses the ViralNucleic Acid purification kit (Simgen, 4002050) to extract DNA, and the operation can be carried out according to the product instructions. The specific method is:

[0154] Negative control: 200 μL PBS;

[0155] Sample to be tested: Take 200 μL of pancreatic enzyme as the sample to be tested and extract DNA;

[0156] Positive control: Take 200 μL and dilute to 10 with PBS. 2 PPV1 at PFU / mL was used as a positive control, and DNA was extracted;

[0157] Suitability control: Take 200 μL of the mixture of positive control and the sample to be tested and extract DNA;

[0158] No template control: RNase-free water;

[0159] Sensitivity control: Take the plasmid standard pUC57-PPV1 and dilute it to 20 copies / μL. Take 5 μL of the template, that is, 100 copies / reaction of PPV1, as the sensitivity control.

[0160] The reaction system and procedure are the same as those in Table 4 and Table 5.

[0161] The test results are shown in Table 11: According to the PPV qPCR test result judgment standard in Table 1, it was determined that there was no PPV contamination in the pancreatic enzyme.

[0162] Table 11 Test results

[0163]

[0164] The result judgment criteria of the above PPV qPCR detection method are shown in Table 1.

[0165] Trial validity:

[0166] The following requirements must be met in the same experiment, otherwise, this experiment will be invalid.

[0167] No template control: There is no Ct value in both the FAM channel and the HEX channel, and no obvious amplification curve.

[0168] Sensitivity control: Both the FAM channel and the HEX channel had obvious amplification curves, and the Ct value was <38.

[0169] Negative control: FAM channel has no Ct value and no obvious amplification curve; HEX channel has an obvious amplification curve and the Ct value is <38.

[0170] Positive control: The FAM channel has an obvious amplification curve, and the Ct value is ≤35; the HEX channel has an obvious amplification curve, and the Ct value is <38.

[0171] Suitability control: There is an obvious amplification curve. If the Ct value increases, the difference with the positive control Ct value is within 3 Ct values.

[0172] The criteria for judging the sample test results are shown in Table 1.

[0173] (2) Identification of PPV contamination in 293T cells

[0174] The PPV1-PPV4 and PPV5-PPV8 quadruple qPCR in this protocol was used to examine the 293T cells artificially contaminated with PPV1 to determine the PPV contamination genotype. The DNA extraction of the following samples was performed using the Viral Nucleic Acid purification kit (Simgen, 4002050) DNA extraction kit, and the operation was performed according to the product instructions. The specific method is:

[0175] Negative control: Take 200 μL PBS as negative control;

[0176] Sample to be tested: Take 10 6 293T cells were added with 200 μL of PBS gradient dilution to 10 2PFU / mL of PPV1 virus solution was used as the test sample, and DNA was extracted;

[0177] Positive control: Take 200 μL and dilute to 10 with PBS. 2 PPV1 at PFU / mL was used as a positive control, and DNA was extracted;

[0178] No template control: RNase-free water;

[0179] Sensitivity control: Take 8 PPV plasmid standards and dilute them to 20 copies / μL respectively. Take 5 μL as template, that is, PPV1-PPV8 with 100 copies / reaction as the sensitivity control of each PPV genotype.

[0180] The reaction system is the same as Table 8 and Table 9, and the procedure is the same as Table 5.

[0181] The test results are shown in Table 12: According to the judgment standard Table 2, the 293T cells were judged to be contaminated with PPV1, and not PPV2-PPV8.

[0182] Table 12 Quadruple qPCR detection results

[0183]

[0184] The result judgment criteria of the above four-plex qPCR identification method are:

[0185] Trial validity:

[0186] The following requirements must be met in the same experiment, otherwise, this experiment will be invalid.

[0187] 1) No template control: no Ct value and no obvious amplification curve.

[0188] 2) Sensitivity control: There is an obvious amplification curve and the Ct value is <38.

[0189] 3) Negative control: no Ct value and no obvious amplification curve.

[0190] 4) Positive control: There is an obvious amplification curve and the Ct value is ≤35.

[0191] The criteria for judging the sample test results are shown in Table 2.

Claims

1. A primer-probe combination for detecting and identifying porcine parvovirus types 1-8, characterized in that: The primer-probe combination includes a forward primer, a reverse primer and a probe for detecting and / or identifying PPV1-PPV8; the nucleotide sequences of the forward primers of PPV1-PPV8 are respectively shown as SEQ ID NO.1-8, the nucleotide sequences of the reverse primers of PPV1-PPV8 are respectively shown as SEQ ID NO.9-16, and the nucleotide sequences of the probes of PPV1-PPV8 are respectively shown as SEQ ID NO.17-24, in which the degenerate base Y represents C or T, and R represents A or G; the 5' ends of the 8 probes are respectively coupled with fluorescent groups, and the 3' ends are respectively coupled with quenching groups.

2. The primer-probe combination for detecting and identifying porcine parvovirus types 1-8 according to claim 1, characterized in that: The fluorescent group is selected from any one of FAM, Texas Red, CY3, CY5, VIC, TET, NED, ROX, JOE or HEX fluorescent groups; the quenching group is selected from any one of TAMRA, NFQ, ECLIPSE, DABCYL, MGB, BHQ1 or BHQ2 quenching groups.

3. A kit, characterized in that: A primer-probe combination according to claim 1, further comprising ProbeMaster Mix, RNase-free water, a negative control, a positive control, a sensitivity control, and a no-template control; The negative control is PBS buffer, the positive control is one of the PPV1-PPV8 virus solutions, the sensitivity control is one of the PPV1-PPV8 plasmid standards, and the no-template control is RNase-free water.

4. The kit according to claim 3, characterized in that: It also includes a suitability control, an internal control plasmid and a corresponding internal control probe; the suitability control is a mixture of the positive control and the sample to be tested, the nucleotide sequence of the target fragment of the internal control plasmid is shown in SEQ ID NO.26, the nucleotide sequence of the internal control probe is shown in SEQ ID NO.25, the 5' end of the internal control probe is coupled with a ninth fluorescent group different from the fluorescent group, and the 3' end is coupled with a quenching group.

5. Use of the primer-probe combination according to claim 1 in preparing a kit, characterized in that: The kit is used for detecting and / or identifying porcine parvovirus types 1-8.

6. Use of the primer-probe combination according to claim 1 or the kit according to claim 3 or claim 4 in detecting and / or identifying porcine parvovirus types 1-8.

7. Use of the primer-probe combination of claim 1 in detecting and / or identifying porcine parvovirus types 1-8 using TaqMan probe fluorescent quantitative PCR.

8. A method for detecting porcine parvovirus type 1-8 using a TaqMan probe fluorescent quantitative PCR using the kit of claim 4, characterized in that: The 5' ends of the probes PPV1-PPV8 are all coupled with a first fluorescent group; The following steps are involved: (1) taking DNA of the sample to be tested, the negative control, the positive control, the suitability control, the sensitivity control and the no-template control, diluting the sensitivity control to a predetermined concentration, and preparing them into qPCR working solutions respectively; (2) Add the DNA of the test sample, negative control, positive control, suitability control, sensitivity control and no-template control to the qPCR reaction system containing Probe Master Mix, internal control probe, internal control plasmid, RNase-free water and the forward primer, reverse primer and probe of PPV1-PPV8; (3) Create a first fluorescent group detection channel and a ninth fluorescent group detection channel on a fluorescent quantitative PCR instrument, perform qPCR reactions on the test sample, negative control, positive control, suitability control, sensitivity control and no-template control, respectively, read the Ct values ​​of the first fluorescent group detection channel and the ninth fluorescent group detection channel, and determine the validity of the test and the test results of the test sample based on the Ct values; The criteria for judging the effectiveness of the test are: No template control: There is no Ct value in the first fluorescent group detection channel and the ninth fluorescent group detection channel, and no obvious amplification curve; Sensitivity control: Both the first fluorescent group detection channel and the ninth fluorescent group detection channel have obvious amplification curves, and the Ct value is <38; Negative control: the first fluorescent group detection channel has no Ct value and no obvious amplification curve; the ninth fluorescent group detection channel has an obvious amplification curve and the Ct value is <38; Positive control: the first fluorescent group detection channel has an obvious amplification curve, and the Ct value is ≤35; the ninth fluorescent group detection channel has an obvious amplification curve, and the Ct value is <38; Suitability control: There is an obvious amplification curve. If the Ct value increases, the difference with the positive control Ct value is within 3 Ct values; The criteria for judging the test results of the samples to be tested are: When the Ct of the first fluorescent group detection channel of the sample to be tested is less than 40 and there is a normal amplification curve, the porcine parvovirus detection result is determined to be positive; When the first fluorescent group detection channel of the sample to be tested has no Ct value and no normal amplification curve, and the ninth fluorescent group detection channel has an obvious amplification curve and the Ct value is less than 38, the porcine parvovirus detection result is determined to be negative; When the first fluorescent group detection channel and the ninth fluorescent group detection channel of the sample to be tested have no Ct value and no normal amplification curve; or when the first fluorescent group detection channel has a Ct ≥ 40 and a normal amplification curve, and the ninth fluorescent group detection channel has no Ct value and no obvious amplification curve, it is determined that the qPCR reaction is inhibited; When the Ct of the first fluorescent group detection channel of the sample to be tested is ≥40 and has a normal amplification curve, and the Ct of the ninth fluorescent group detection channel is <38 and has an obvious amplification curve, the result is determined to be invalid.

9. A method for identifying porcine parvovirus by using the TaqMan probe fluorescent quantitative PCR of the kit according to claim 3, characterized in that: The first fluorescent group, the second fluorescent group, the third fluorescent group, and the fourth fluorescent group coupled to the 5' end of the PPV1-PPV4 probes are four different fluorescent groups, and the fifth fluorescent group, the sixth fluorescent group, the seventh fluorescent group, and the eighth fluorescent group coupled to the 5' end of the PPV5-PPV8 probes are four different fluorescent groups; The following steps are involved: (1) taking DNA of the sample to be tested, the negative control, the positive control, the sensitivity control and the no-template control, diluting the sensitivity control to a predetermined concentration, and preparing them into qPCR working solutions respectively; (2) Establish two qPCR reaction systems, namely the PPV1-PPV4 quadruple qPCR reaction system and the PPV5-PPV8 quadruple qPCR reaction system; The DNA of the sample to be tested, the negative control, the positive control, the sensitivity control and the no-template control were respectively added to the PPV1-PPV4 quadruple qPCR reaction system containing ProbeMaster Mix, RNase-free water and the forward primer, reverse primer and probe of PPV1-PPV4; The DNA of the sample to be tested, the negative control, the positive control, the sensitivity control and the no-template control were respectively added to the PPV5-PPV8 quadruple qPCR reaction system containing ProbeMaster Mix, RNase-free water and the forward primer, reverse primer and probe of the PPV5-PPV8; Create a first fluorescent group detection channel, a second fluorescent group detection channel, a third fluorescent group detection channel, and a fourth fluorescent group detection channel on a fluorescent quantitative PCR instrument, perform PPV1-PPV4 qPCR reactions on the sample to be tested, the no-template control, the negative control, and the positive control, respectively, read the Ct values ​​of the first fluorescent group detection channel to the fourth fluorescent group detection channel, respectively, and determine the validity of the test and the test result of the sample to be tested based on the Ct values; Create a fifth fluorescent group detection channel, a sixth fluorescent group detection channel, a seventh fluorescent group detection channel, and an eighth fluorescent group detection channel on a fluorescent quantitative PCR instrument, perform PPV5-PPV8 qPCR reactions on the sample to be tested, the no-template control, the negative control, and the positive control, respectively, read the Ct values ​​of the fifth fluorescent group detection channel to the eighth fluorescent group detection channel, respectively, and determine the validity of the test and the test result of the sample to be tested based on the Ct values; The criteria for judging the effectiveness of the test are: If the negative control has no Ct value and no obvious amplification curve; and the positive control has a Ct value ≤ 35 and has an obvious amplification curve; and the sensitivity control has an obvious amplification curve and a Ct value < 38; and the no-template control has no Ct value and no obvious amplification curve; then the test is determined to be valid; otherwise, the test is determined to be invalid; The criteria for judging the test results of the samples to be tested are: When in the PPV1-PPV4 qPCR reaction, the Ct value of the first fluorescent group detection channel and / or the second fluorescent group detection channel and / or the third fluorescent group detection channel and / or the fourth fluorescent group detection channel of the sample to be tested is <40 and there is an obvious amplification curve, the corresponding PPV1 and / or PPV2 and / or PPV3 and / or PPV4 detection results of the sample to be tested are determined to be positive; When in the PPV1-PPV4 qPCR reaction, the Ct value of the first fluorescent group detection channel and / or the second fluorescent group detection channel and / or the third fluorescent group detection channel and / or the fourth fluorescent group detection channel of the sample to be tested is ≥40 and there is an obvious amplification curve, the test result is determined to be invalid; When in the PPV1-PPV4 qPCR reaction, the first fluorescent group detection channel and / or the second fluorescent group detection channel and / or the third fluorescent group detection channel and / or the fourth fluorescent group detection channel of the sample to be tested has no Ct value and no obvious amplification curve, the detection result of PPV1 and / or PPV2 and / or PPV3 and / or PPV4 of the sample to be tested is determined to be negative; When in the PPV5-PPV8 qPCR reaction, the Ct value of the fifth fluorescent group detection channel and / or the sixth fluorescent group detection channel and / or the seventh fluorescent group detection channel and / or the eighth fluorescent group detection channel of the sample to be tested is <40 and there is an obvious amplification curve, then the corresponding PPV5 and / or PPV6 and / or PPV7 and / or PPV8 detection results of the sample to be tested are determined to be positive; When in the PPV5-PPV8 qPCR reaction, the Ct value of the fifth fluorescent group detection channel and / or the sixth fluorescent group detection channel and / or the seventh fluorescent group detection channel and / or the eighth fluorescent group detection channel of the sample to be tested is ≥40 and there is an obvious amplification curve, the test result is determined to be invalid; When in the PPV5-PPV8 qPCR reaction, the fifth fluorescent group detection channel and / or the sixth fluorescent group detection channel and / or the seventh fluorescent group detection channel and / or the eighth fluorescent group detection channel of the sample to be tested has no Ct value and no obvious amplification curve, the detection results of PPV5 and / or PPV6 and / or PPV7 and / or PPV8 of the sample to be tested are determined to be negative.

Images