Mogroside V11-G as well as biosynthesis method and application thereof

Abstract

The invention belongs to the technical field of natural product biosynthesis, and particularly relates to mogroside V11-G as well as a biosynthesis method and application thereof, the mogroside V11-G is disclosed, the mogroside V11-G is prepared by catalyzing siamenoside I by a mutant L302A of UDP-glucose dependent glycosyl transferase OleD from streptomyces antibioticus, and the conversion efficiency can reach 96.11%; compared with known mogroside V, the mogroside V11-G has the advantages that the sweetness is improved, the mogroside V11-G can be used as a substitute for traditionally obtained mogroside, and the method is low in cost, simple in process and high in conversion efficiency.

Description

Technical Field

[0001] The present invention belongs to the technical field of natural product biosynthesis, and specifically relates to a mogroside V11-G and a biosynthesis method and application thereof. Background Art

[0002] Monk fruit (Siraitiagrosvenorii) is a traditional Chinese medicinal and edible plant (Gong X, Crit Rev Food Sci Nutr., 2020, 60(14): 2303-26). Its main component, mogroside compounds, is a type of cucurbitane-type tetracyclic triterpenoid saponin with mogroside alcohol as aglycone (Wu J, Molecules., 2020, 60(14): 2303-26). The main difference between this type of compound is the number, position and glycosidic bond configuration of the glucose groups contained. The main components have the functions of lowering blood pressure and blood lipids, anti-oxidation and anti-inflammatory, and anti-cancer, which can ensure the normal operation of complex life activities in the human body. In addition to having multiple pharmacological activities, highly glycosylated mogrosides have the characteristics of high sweetness and low calories. For example, Siamenoside I is 563 times sweeter than a 5% sucrose aqueous solution, and has great application prospects (PawarR S, Anal Bioanal Chem., 2013, 405(13): 4397-407). As modern people pay more attention to health issues, finding a substitute for sugar has gradually become one of the research hotspots (Serra-Majem L, Nutrients., 2018, 10(7): 818-48). Monk fruit extract (including mogroside V) has been included in the GRAS (Generally Recognized as Safe) list by the U.S. FDA. Countries such as Japan, Singapore, and China have approved the use of monk fruit extract as a food additive. Compared with artificial sweeteners such as aspartame and sucralose, mogroside, a low-calorie, high-sweetness natural compound, is undoubtedly the most competitive sweetener to replace sucrose (Dai L, Plant & Cell Physiology., 2015, 56(6): 1172-82).

[0003] Simagroside I has four sugar groups and is the sweetest compound of this type of glycoside isolated so far. It tastes similar to sucrose, but its content in dried monk fruit is only 0.04%. Therefore, it is necessary to find more or completely new structures of monk fruit glycosides as sweeteners.

[0004] Studies on the relationship between biological structure and taste show that sweetness mainly depends on the number of glucosyl groups, the oxygen-containing function of the 11th C, the position of the glycosyl group, and the hydroxylation of the side chain. In terms of the number of glycosyl groups, only mogrosides with a total number of more than three glycosyl groups at C-3 and C-24 have sweetness, and β-glycosidic bonds enhance sweetness, while α-glycosidic bonds do not have this ability (Soejarto, D, Plant Physiology., 2019, 243, 112056). For example, mogroside IIE, mogroside IIIE, and mogroside III do not have sweetness because the basic structural requirements of at least three glycosyl groups are not met. Secondly, if the 11th hydroxyl group is in the α configuration, it tastes sweet, if the 11th hydroxyl group is in the β configuration, it tastes tasteless, and if the 11th hydroxyl group is oxidized, it tastes bitter. Finally, the oxygen function of C-11 also affects sweetness. Glycosides of 11-hydroxy compounds taste sweet, while 11-oxo compounds and dehydrogenated derivatives taste bitter (Pawar R S, Anal Bioanal Chem., 2013, 405(13): 4397-407). For example, compounds mogroside III A1, mogroside III E and mogroside II A1 are sweet, while glycosides with 11-keto groups are bitter. Summary of the invention

[0005] The purpose of the present invention is to establish a specific and economical new biosynthetic method of a novel mogroside compound by using a glycosyltransferase with strong substrate specificity, so as to obtain a large amount of high-purity (purity greater than 95%) mogroside V11-G.

[0006] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0007] A mogroside V11-G, the structural formula of which is shown below:

[0008]

[0009] The biosynthesis method of mogroside V11-G is characterized in that the mogroside V11-G is obtained by using simonoside I of momordica grosvenori, a reaction buffer, and an exogenous active sugar donor UDP-glucose to react with a wild-type glycosyltransferase or a mutant to obtain mogroside V11-G.

[0010]

[0011] The method is characterized in that the reaction buffer is selected from disodium hydrogen phosphate-citrate buffer with a pH of 8.0; the dosage of simonoside I is 1 mg / mL; the wild-type glycosyltransferase is OleD derived from Streptomyces; the mutant is L302A, which is obtained by mutating the leucine at position 302 of the wild-type glycosyltransferase OleD amino acid sequence shown in SEQ ID NO.1 to alanine, and the mutant amino acid sequence is shown in SEQ ID NO.2.

[0012] The method is characterized in that the steps include: adding glycosyltransferase OleD and its mutant L302A to a buffer solution respectively, adding substrate simonoside I and sugar donor UDPG, mixing evenly, and obtaining a reaction system, wherein the reaction pH of the enzymatic reaction system is 8, the reaction temperature is 30°C, and the reaction time is 24 hours.

[0013] The reaction amplification preparation of the mogroside V11-G is to expand the reaction system to 200 mL, and measure the concentration of the product in the reaction in real time during the reaction. The product is then purified by macroporous resin D101 and gradient eluted with ethanol-water solution to remove impurities such as sucrose, miscellaneous proteins and inorganic salts present in the reaction. The eluate containing high-purity mogroside compounds is collected and combined, and after rotary evaporation and freeze-drying, the recovery rate reaches 76.53% and the purity is 96.11%.

[0014] Sensory evaluation experiment of mogroside V11-G: Using 5% sucrose solution as the control group, 5% mogroside V solution and 5% mogroside V11-G solution were prepared as the mother solution and diluted accordingly to compare the taste and flavor of the two compound solutions, including the warm and cool feeling, aftertaste, irritation and persistence, etc.

[0015] The application of the mogroside V11-G in the preparation of a sweetener.

[0016] Beneficial Effects

[0017] 1. The mogroside V11-G involved in the present invention is a brand-new compound, and its structure has not been reported. The compound is a cucurbitane-type tetracyclic triterpenoid compound derived from Momordica grosvenori, and has two glycosyl groups and three glycosyl groups on C3 and C24, respectively. Based on the structural information, semi-rational transformation is carried out to improve the activity of glycosyltransferase, and the UDP-glucose-dependent glycosyltransferase OleD from Streptomyces antibioticus is mutated. Its mutant L302A can catalyze Siamenoside I to prepare mogroside V11, and the conversion efficiency can reach 96.11%. The purification process is simple. After sweetness and taste tests, the sweetness of mogroside V11-G is 409 times that of 5% sucrose, while the sweetness of mogroside V, which also has five glycosyl groups, is only 363 times that of 5% sucrose. Compared with the two compounds, the sweetness of mogroside V11-G is long-lasting, and more than 90% of the subjects believe that there is no bad taste.

[0018] 2. The preparation method of mogroside V11-G of the present invention involves wild-type glycosyltransferase OleD, which is a UDP-glucose-dependent glycosyltransferase derived from Streptomyces. Its natural substrates in vivo are oleandomycin, erythromycin and tylosin. It can transfer glucose from UDP-glucose to the 2-OH of the deoxyglucosamine structure of macrolide antibiotics to form a β-1,2-glycosidic bond (Quiros LM, et al. J Biol Chem, 1995, 27: 18234-18239.). In an aqueous reaction system, the yield of preparing mogroside V11-G by catalyzing 1 mg / mL simenoside I by wild-type glycosyltransferase OleD is less than 50%, the product is not single and the efficiency is not high. From the perspective of substrate concentration and efficiency, this cannot meet the needs of large-scale preparation. Therefore, the present invention mutates the leucine at position 302 of the glycosyltransferase to alanine to construct a mutant L302A. In the same reaction system, the mutant L302A can achieve a yield of 96.11% of mogroside V11-G without any by-products. Moreover, after a sweetness test, the sweetness of mogroside V11-G is higher than that of mogroside V. The reaction conditions are simple and easy to control, which is convenient for product purification and industrial scale-up.

[0019] 3. In the aqueous phase reaction system, the efficiency of synthesizing mogroside V11-G catalyzed by wild-type glycosyltransferase OleD is low and cannot meet the needs of large-scale preparation. The mutant L302A constructed in the present invention has a higher efficiency in synthesizing mogroside V11-G, with a yield of 96.11%.

[0020] 4. The present invention adopts macroporous resin D101 and reverse separation column C18 to purify and prepare mogroside V11-G, which has the advantages of large sample loading amount and reusability, and is conducive to low-cost large-scale preparation.

[0021] 5. The sweetness of the mogroside V11-G produced by the catalysis of the present invention was tested. Compared with the known mogroside V, its sweetness is much higher.

[0022] In summary, the biosynthesis of a novel mogroside V11-G established in the present invention is of great significance for the in-depth development of mogroside compounds. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 It is the soluble protein expression diagram of glycosyltransferase OleD and its mutant L302A, where M is the protein molecular weight standard (kD), lane 1 is the wild-type OleD, and lane 2 is the mutant L302A;

[0024] Figure 2 The HPLC profiles of the synthesis of mogroside V11-G by simanoside I catalyzed by wild-type glycosyltransferase OleD and mutant L302A, wherein i is the HPLC profile of simanoside I reference substance, ii is the HPLC profile of the system after the reaction of wild-type glycosyltransferase OleD, and iii is the HPLC profile of the system after the reaction of mutant L302A;

[0025] Figure 3 is the C spectrum of the product mogroside V11-G;

[0026] Figure 4 is the H spectrum of the product mogroside V11-G;

[0027] Figure 5 is the HSQC spectrum of the product mogroside V11-G;

[0028] Figure 6 This is the HMBC spectrum of the product mogroside V11-G. DETAILED DESCRIPTION

[0029] The specific steps of the present invention are described below by way of examples, but the scope of the present invention is not limited by these examples.

[0030] Example 1 Establishment of the wild-type glycosyltransferase OleD reaction system

[0031] Take OleD crude enzyme solution, simenoside I solution, UDPG-Na2 solution and Tris-HCl buffer to establish the reaction system according to Table 1 (the crude enzyme solution is calculated based on the amount of bacteria), place it in a shaking incubator at 30°C and 220rpm for reaction for 12h, then terminate the reaction with an equal volume of methanol in the reaction solution, centrifuge at 12000rpm for 10min, filter the supernatant with a 0.22μm organic filter head, take about 200μL and add it to the inner liner of a liquid phase injection vial for HPLC detection.

[0032] Table 1 Activity assay system

[0033] Components Final concentration (mg / mL) Simagroside I 1 UDPG 2 Crude enzyme solution 40

[0034] HPLC detection conditions are as follows:

[0035] Chromatographic column: Inertsil ODS-3VHPLC Column, 5μm, 150×4.6mm

[0036] Mobile phase: A: ultrapure water (containing 0.1% formic acid) B: acetonitrile (containing 0.1% formic acid)

[0037] Analysis time: 28min Injection volume: 10μL Column temperature: 30℃ Detection wavelength: 205nm

[0038] Flow rate: 1 ml / min Gradient elution: 10% B-90% B

[0039] Under the above HPLC analysis conditions, the retention time of mogroside V11-G was 6.6 min ( Figure 2 The production rate of mogroside V11-G = A m / A t ×100%,A m is the peak area of ​​mogroside V11-G, A t is the total area of ​​mogroside V11-G and simenoside I. The results showed that the production rate of mogroside V11-G synthesized by wild-type glycosyltransferase OleD was 43.66%.

[0040] Example 2 Alanine mutation near the active pocket

[0041] In order to more reasonably analyze the binding mode of simenoside I with the amino acid residues near the active pocket of OleD, molecular docking was performed using the crystal structure of OleD and simenoside I. Based on the docking results, Residue L302 was selected within the binding site and subsequently mutated to alanine to determine its potential to enhance the catalytic activity of OleD.

[0042] Example 3 Construction of single-point mutants of glycosyltransferase OleD

[0043] Alanine mutation primers were designed according to the codon preference of E. coli, as shown in Table 2

[0044] Table 2 Alanine mutation primers

[0045] Primer name Primer sequences L302A-F GCAACGTTGCCAGTCATCCGCCGCGCTCCCT L302A-R ACTGGCGAACGTTGCCGGGTGCTCGGTGATCCC

[0046] Using the pET-22b(+)-OleD plasmid extracted from Escherichia coli DH5α as a template, a pair of primers F / R in Table 2 were added to perform PCR amplification. The amplification system and program were set according to the instruction manual of PhantaMax Super-Fidelity DNA Polymerase. The PCR reaction system is shown in Table 3, and the PCR program is shown in Table 4.

[0047] Table 3 Site-directed mutagenesis PCR reaction system

[0048]

[0049]

[0050] Table 4 Site-directed mutagenesis PCR program

[0051]

[0052] After the PCR reaction was completed, the PCR products were separated by 1% agarose gel electrophoresis. After the electrophoresis was completed, the gel was cut and recovered to obtain the purified product, which was stored at -20°C for future use.

[0053] Example 4 Cultivation and induction of mutant L302 strain

[0054] The E. coli DH5α containing the recombinant plasmid was inoculated into 2 mL of liquid LB medium containing the corresponding antibiotics, and after shaking culture at 37°C and 220 rpm for 12 h, 800 μL of the bacterial solution and an equal volume of sterile 50% glycerol were taken out and placed in a bacterial preservation tube for later use.

[0055] The stored glycerol bacteria containing the candidate enzyme were inoculated into 2 mL of liquid LB medium containing the corresponding antibiotics at an inoculation volume of 0.1%, and cultured at 37°C and 220 rpm for 8 hours as seed liquid. The inoculation volume of 1% was inoculated into 100 mL of liquid LB medium to expand the culture until OD600 = 0.6-0.8, and IPTG with a final concentration of 0.4 mM was added to induce expression at 20°C for 16 hours. The induced bacteria were collected by centrifugation at 4°C and 8000 rpm for 10 minutes, resuspended in Tris-HCl buffer and centrifuged again, and the bacteria were stored at -20°C for later use.

[0056] Weigh about 0.5g of candidate enzyme cells, add 1mL of Tris-HCl buffer to every 0.1g of cells, resuspend and place in a 10mL beaker in an ice bath, and ultrasonically disrupt for 3-5min at 60W power, with ultrasound on for 3s and off for 6s. Add the disrupted liquid to a 2mL centrifuge tube and centrifuge for 10min at 4℃ and 12000rpm. The supernatant after centrifugation is the crude enzyme solution.

[0057] Take 25 μL of crude enzyme solution and 5 μL of 6× Protein Loading Buffer respectively, put them into 1.5 mL centrifuge tubes, vortex and mix, boil in water bath for 10 min, cool to room temperature and centrifuge at 12000 rpm for 10 min, take 3-5 μL of protein pre-stained Marker 26616 and prepared crude enzyme solution sample respectively and load them into the channel of 10% SDS-PAGE gel, first set the voltage to 90 V, and when the blue band of the sample moves out of the concentrated gel, change the voltage to 120 V until the blue band moves to the bottom of the separation gel, turn off the electrophoresis instrument, peel the gel into Coomassie Brilliant Blue R250 staining solution, shake on a decolorization shaker for 1-2 h, then transfer the gel to a box containing decolorization solution and shake for decolorization, change the decolorization solution every 1-2 h until the background of the gel becomes transparent and clean, then use a gel imager to image the gel and save the image. The results are as follows: Figure 1 As shown.

[0058] Example 5 Activity determination of mutant L302 strain

[0059] Take OleD crude enzyme solution, simenoside I solution, UDPG-Na2 solution and Tris-HCl buffer to establish the reaction system according to Table 1 (the crude enzyme solution is calculated based on the amount of bacteria), place it in a shaking incubator at 30°C and 220rpm for reaction for 12h, then terminate the reaction with an equal volume of methanol in the reaction solution, centrifuge at 12000rpm for 10min, filter the supernatant with a 0.22μm organic filter head, take about 200μL and add it to the inner liner of a liquid phase injection vial for HPLC detection.

[0060] HPLC detection method is the same as in Example 1

[0061] Under the above HPLC analysis conditions, the retention time of mogroside V11-G was 6.6 min ( Figure 2 The production rate of mogroside V11-G = A m / A t ×100%,A m is the peak area of ​​mogroside V11-G, A t is the total area of ​​mogroside V11-G and simenoside I. The results showed that the production rate of mogroside V11-G synthesized by mutant L302A was 96.11%. Table 5 is a comparison of the conversion efficiency of wild glycosyltransferase OleD and mutant L302A.

[0062] Table 5 The yield results of mogroside V11-G

[0063]

[0064]

[0065] Example 6 Amplified reaction preparation of mogroside V11-G

[0066] After the mutant L302 was induced to express, the cells were collected and resuspended at a ratio of 0.1 g of cells to 1 mL of buffer. After ultrasonic disruption of the cells, the cells were centrifuged at 4°C and 12,000 rpm for 10 min, and the supernatant was taken as the crude enzyme solution. According to the reaction system in Table 6, a 200 mL reaction system was established. After the reaction was completed, an equal volume of methanol was added to terminate the reaction, and the protein precipitate was removed by centrifugation. The supernatant was collected and rotary evaporated to remove methanol and a portion of water for purification.

[0067] Table 6 Amplification reaction system

[0068] Components Add volume (mL) Simagroside I 10 UDPG 20 Crude enzyme solution 40 Buffer 130

[0069] Example 7 Purification of Mogroside V11-G

[0070] The method of purifying mogrosides by macroporous adsorption resin D101 is used to purify the mogroside alcohol glycosylation product. After the D101 wet column is loaded, it is soaked in 95% ethanol overnight, and then soaked in 4% NaOH and HCl solutions for 4 hours respectively, and then washed with deionized water until the pH is neutral. The reaction product to be purified is slowly loaded onto the D101 purification column, and the entire purification process is carried out at a flow rate of 1 mL / min. After the loading is completed, the excess sugar donor and other impurities are eluted with 10 times the column volume of deionized water, and the mogroside alcohol glycosylation product is eluted with 10 times the column volume of 50% ethanol. The eluate of the D101 purification column is collected and loaded onto the weakly basic anion exchange resin D900 purification column, and the effluent is collected. After rotary evaporation to remove ethanol and most of the water, freeze-drying is performed to obtain a solid sample.

[0071] The obtained solid sample (mogroside V11-G) was dissolved in deuterated pyridine-d5 and transferred to a nuclear magnetic resonance tube. The NMR spectrum was measured by the Analysis and Testing Center of China Pharmaceutical University. The results are as follows: Figure 3-6 As shown, the structural formula is determined as follows:

[0072]

[0073] Example 8 Sample preparation for sensory evaluation of the product Mogroside V11-G

[0074] A 5% sucrose solution was prepared with clean Wahaha purified water as the control group, and a 5% product Mogroside V1 solution was prepared as the mother liquor, which was diluted 50 times, 100 times, 200 times, 300 times, 400 times, 500 times, and 600 times to obtain Mogroside V1 solutions with different dilution ratios of 0.1%, 0.05%, 0.025%, 0.017%, 0.0125%, 0.01%, and 0.0083%.

[0075] Example 9: Taste and tasting of the sensory evaluation of the product Mogroside V11-G

[0076] 20 healthy tasters with correct taste and smell judgment abilities were selected to form an evaluation panel (10 males and 10 females), and the evaluation panel members were asked to compare the differences between 5% sucrose solution (w / v) and 0.1%, 0.05%, 0.025%, 0.017%, 0.0125%, 0.01%, and 0.0083% concentrations of mogroside V1 solution and mogroside V, and record the concentration of mogrosides with the same sweetness as 5% sucrose solution in different concentrations, and compare the taste and flavor of mogroside V1 and mogroside V solution with sucrose, including warm and cool feeling, bitter aftertaste, irritation and persistence, etc. The sweetness calculation formula is: sweetness = 5% / sample concentration, where the sample concentration refers to the concentration of mogrosides with the same sweetness as 5% sucrose solution.

[0077] The results showed that mogroside V is a low-calorie, high-sweetness sweetener. Previous studies have found that its sweetness is 425 times that of 5% sucrose. Referring to the sweetness of mogroside V, solutions of mogroside V and the product of the present invention, mogroside V11-G, at different dilution ratios of 0.1% (50 times), 0.05% (100 times), 0.025% (200 times), 0.017% (300 times), 0.0125% (400 times), 0.01% (500 times), and 0.0083% (600 times) were prepared.

[0078] According to the evaluation results of the evaluation team, the following conclusions are drawn:

[0079] ① Mogroside V: It tastes extremely sweet, between 300 and 400 times that of 5% sucrose, with a long-lasting sweetness. 30% of the subjects felt it had a slight aftertaste of bitterness.

[0080] ②Simonoside V1: It tastes extremely sweet, between 400 and 500 times that of 5% sucrose, with a long-lasting sweetness. More than 90% of the subjects found it had no unpleasant taste.

[0081] Table 7 Taste and sweetness test of product mogroside V11-G

[0082]

[0083]

[0084] Table 8 Taste and sweetness test of mogroside V

[0085]

[0086]

[0087] Table 9 Comparison of taste and sweetness of products Mogroside V and Mogroside V

[0088] Compound Relative Sweetness Quality of taste Mogroside V11-G 409 +2 Mogroside V 363 +1 。

Claims

1. A mogroside V11-G, the structural formula of which is as follows:

2. The biosynthesis method of mogroside V11-G according to claim 1, characterized in that: The mogroside V11-G was obtained by enzymatic reaction of simanoside I of momordica grosvenori, reaction buffer, exogenous active sugar donor UDP-glucose with wild-type glycosyltransferase or mutant.

3. The method according to claim 2, characterized in that The reaction buffer is selected from disodium hydrogen phosphate-citric acid buffer with a pH of 8.0; the dosage of simonoside I is 1 mg / mL; the wild-type glycosyltransferase is OleD from Streptomyces; the mutant is L302A, which is obtained by mutating the leucine at position 302 of the wild-type glycosyltransferase OleD amino acid sequence shown in SEQ ID NO.1 to alanine, and the amino acid sequence of the mutant is shown in SEQ ID NO.

2.

4. The method according to claim 3, characterized in that: Glycosyltransferase OleD and its mutant L302A were added to the buffer respectively, and substrate simonoside I and sugar donor UDPG were added and mixed evenly to obtain a reaction system. The reaction pH of the enzymatic reaction system was 8, the reaction temperature was 30° C., and the reaction time was 24 hours.

5. Use of the mogroside V11-G according to claim 1 in the preparation of a sweetener.

Images