Anti-Jo-1 antibody or antigen binding fragment thereof, detection reagent, kit and application

Abstract

The invention discloses an anti-Jo-1 antibody or an antigen binding fragment thereof, a detection reagent, a kit and application, and relates to the technical field of in-vitro detection. The anti-Jo-1 antibody and the antigen binding fragment comprise a heavy chain variable region sequence and a light chain variable region sequence, the amino acid sequence of the heavy chain variable region is shown as SEQ ID NO. 1, and the amino acid sequence of the light chain variable region is shown as SEQ ID NO. 2. The problems of positive traceability and large-scale supply of the anti-Jo-1 antibody are solved. The Jo-1 antibody or the antigen binding fragment disclosed by the invention has the characteristics of high affinity, high specificity and good stability, and a raw material source with excellent performance is provided for preparation of a calibration product / a positive control product / a quality control product of a Jo-1 antibody detection kit.

Description

Technical Field

[0001] The present invention relates to the field of in vitro detection technology, and in particular to an anti-Jo-1 antibody or an antigen-binding fragment thereof, a detection reagent, a kit and applications. Background Art

[0002] Autoimmune diseases (abbreviated as "autoimmune diseases") are diseases caused by the immune system's immune response to the body's own components, causing damage. Under normal circumstances, the immune system only responds to foreign substances that invade the body, such as bacteria, viruses, parasites, and transplants, and eliminates or rejects these foreign substances. Under the influence of certain factors, the body's tissue components or the immune system itself have certain abnormalities, causing the immune system to mistakenly attack its own components as foreign substances. At this time, the immune system will produce antibodies and active lymphocytes against some of the body's own components, damaging and destroying its own tissues and organs, leading to disease.

[0003] Due to the large number of types of autoimmune diseases, autoimmune diseases are usually divided into two categories. One is systemic autoimmune disease, which is characterized by the involvement of multiple organs or tissues throughout the body, such as rheumatoid arthritis, systemic lupus erythematosus, Sjögren's syndrome, systemic vasculitis, etc.; the other is organ-specific autoimmune disease, in which only one tissue or organ is affected, such as autoimmune liver disease, type 1 diabetes, etc.

[0004] Systemic sclerosis (SSc) is a connective tissue disease characterized by the hardening of collagen fibers in the skin. Systemic sclerosis that affects internal organs is also called systemic sclerosis. This disease is second only to lupus erythematosus among connective tissue diseases and is an "autoimmune disease."

[0005] Anti-Jo-1 antibody is a myositis-specific autoantibody that plays an important role in the diagnosis, differential diagnosis, and classification of inflammatory myopathies. This antibody is commonly used in the diagnosis of polymyositis (PM) and dermatomyositis (DM), with a positive rate of about 25% in polymyositis and 7.1% in dermatomyositis. In PM / DM patients with combined interstitial lung disease, the positive rate is as high as 60%.

[0006] The Jo-1 antigen is a histidyl tRNA synthetase that appears in the form of a small ribonucleoprotein in the cytoplasm. Anti-Jo-1 antibodies are closely associated with the occurrence and development of polymyositis and dermatomyositis. The clinical manifestations of these diseases are diverse and complex, often involving the proximal limb girdle muscles, neck muscles, and pharyngeal muscles, and may also affect multiple systems such as the skin, heart, gastrointestinal tract, and lungs.

[0007] Typical symptoms of patients with anti-Jo-1 antibody syndrome include polymyositis, polyarticular synovitis, arthralgia, non-invasive degenerative arthritis, tenosynovitis, alveolar fibrosis or pulmonary fibrosis. In addition, symptoms related to scleroderma may also be associated with it. This syndrome is called Jo-1 syndrome or anti-synthetase syndrome. Common methods for diagnosing anti-Jo-1 antibodies include enzyme-linked immunosorbent assay and immunoblotting. In addition, the diagnostic process may also include the detection of serum muscle enzyme spectrum, myogenic damage shown by electromyography, and symptoms such as muscle fiber degeneration or necrosis found by muscle biopsy.

[0008] Stable in-house quality control products can effectively monitor the precision and accuracy of test results. However, most of the commercial anti-Jo-1 antibody quality control products on the market are positive serum from patients, but the serum is difficult to source, and there are large differences between batches. The batch size is small and it comes from imports, which is expensive, limiting the clinical application of the test products. Therefore, there is an urgent need to independently develop anti-Jo-1 antibodies that can be mass-produced and have high affinity and specificity to achieve daily quality control testing in clinical laboratories. Summary of the invention

[0009] The technical problem to be solved by the present invention is to provide an anti-Jo-1 antibody or an antigen-binding fragment thereof, a detection reagent and an application thereof, so as to solve the problem of the difficulty in sourcing commercial anti-Jo-1 antibodies.

[0010] In order to solve the above problems, the present invention proposes the following technical solutions:

[0011] In a first aspect, the present invention provides an anti-Jo-1 antibody or an antigen-binding fragment thereof, comprising a heavy chain variable region and a light chain variable region;

[0012] The amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.1, and the amino acid sequence of the light chain variable region is shown in SEQ ID NO.2.

[0013] The antibody or antigen-binding fragment thereof is a monoclonal antibody or a polyclonal antibody. The monoclonal antibody can be prepared by a variety of approaches and techniques, including hybridoma technology, phage display technology, single lymphocyte gene cloning technology, etc.

[0014] Furthermore, the antibody or antigen-binding fragment thereof further comprises a heavy chain constant region, and the heavy chain constant region comprises:

[0015] The amino acid sequence of CH1 is as shown in SEQ ID NO.3;

[0016] Hinge having an amino acid sequence as shown in SEQ ID NO.4;

[0017] CH2 having an amino acid sequence as shown in SEQ ID NO.5; and

[0018] The amino acid sequence of CH3 is shown in SEQ ID NO.6.

[0019] Furthermore, the heavy chain constant region is selected from the conserved amino acid sequence of the human IgG1 heavy chain constant region.

[0020] Furthermore, the antibody or antigen-binding fragment thereof further comprises a light chain constant region CL, and the amino acid sequence of the light chain constant region CL is shown in SEQ ID NO.7.

[0021] Furthermore, the light chain constant region CL is selected from the conserved amino acid sequence of the human IgG1 light chain constant region.

[0022] Furthermore, the heavy chain amino acid sequence of the antibody or antigen-binding fragment thereof is shown in SEQ ID NO.8, and the light chain amino acid sequence is shown in SEQ ID NO.9.

[0023] The method for preparing the antibody or its antigen-binding fragment is a conventional method in the art. The method for preparing the antibody or its antigen-binding fragment is preferably: isolating and obtaining from a host cell expressing the antibody or its antigen-binding fragment or obtaining by artificially synthesizing a protein sequence. The method for isolating and obtaining from a host cell expressing the antibody or its antigen-binding fragment is preferably as follows: cloning a nucleic acid molecule encoding the antibody or its antigen-binding fragment and having a point mutation into a vector, transforming the obtained vector into a host cell, and culturing the obtained host cell to isolate and purify the antibody or its antigen-binding fragment.

[0024] In a second aspect, the present invention provides a nucleic acid molecule encoding the anti-Jo-1 antibody or antigen-binding fragment thereof described in the first aspect.

[0025] Furthermore, the nucleotide sequence of the heavy chain variable region of the anti-Jo-1 antibody or its original binding fragment is shown as SEQ ID NO.10, and the nucleotide sequence of the light chain variable region is shown as SEQ ID NO.11.

[0026] Furthermore, the anti-Jo-1 antibody or antigen-binding fragment thereof, the nucleotide sequence of the heavy chain constant region CH1 region is shown in SEQ ID NO.12; the nucleotide sequence of the Hinge region is shown in SEQ ID NO.13; the nucleotide sequence of the CH2 region is shown in SEQ ID NO.14; and the nucleotide sequence of the CH3 region is shown in SEQ ID NO.15.

[0027] Furthermore, the nucleotide sequence of the light chain constant region CL of the anti-Jo-1 antibody or its original binding fragment is shown in SEQ ID NO.16.

[0028] Furthermore, the heavy chain nucleotide sequence of the anti-Jo-1 antibody or antigen-binding fragment thereof is shown as SEQ ID NO.17, and the light chain nucleotide sequence is shown as SEQ ID NO.18.

[0029] The method for preparing the nucleic acid molecule is a conventional method in the art, and preferably comprises the following steps: obtaining a nucleic acid molecule encoding the above-mentioned antibody or its antigen-binding fragment by gene cloning technology, or obtaining a nucleic acid molecule encoding the above-mentioned antibody or its antigen-binding fragment by artificial full sequence synthesis.

[0030] Those skilled in the art know that the base sequence encoding the amino acid sequence of the above-mentioned antibody or antigen-binding fragment thereof can be appropriately introduced with substitution, deletion, change, insertion or addition to provide a homologue of a polynucleotide. The homologue of the polynucleotide in the present invention can be prepared by replacing, deleting or adding one or more bases of the gene encoding the sequence of the antibody or antigen-binding fragment thereof within the range of maintaining the activity of the antibody, which is also included in the present invention.

[0031] In a third aspect, the present invention provides a vector comprising the nucleic acid molecule described in the second aspect.

[0032] The vector can be obtained by conventional methods in the art, that is, by connecting the nucleic acid molecule of the present invention to various expression vectors. The expression vector is any conventional vector in the art, as long as it can carry the aforementioned nucleic acid molecule. The vector preferably includes various plasmids, cosmids, phages or virus vectors, etc.

[0033] In a fourth aspect, the present invention provides a host cell comprising the nucleic acid molecule or the vector.

[0034] The preparation method of the host cell is a conventional preparation method in the art, preferably: the above-mentioned vector is transformed into a host cell to obtain it. The host cell is any conventional host cell in the art, as long as it can satisfy the above-mentioned vector to stably replicate itself and the nucleic acid carried can be effectively expressed. Preferably, the host cell is E.coli TG1 or BL21 cell (expressing single-chain antibody or Fab antibody), or CHO-K1 cell (expressing full-length IgG antibody). The aforementioned recombinant expression plasmid is transformed into a host cell to obtain a preferred host cell of the present invention. The transformation method is a conventional transformation method in the art, preferably a chemical transformation method, a heat shock method or an electroporation method.

[0035] The present invention also provides a use of the anti-Jo-1 antibody or its antigen-binding fragment for detecting the presence or level of Jo-1 in a sample, or for preparing a kit for detecting the presence or level of Jo-1 in a sample.

[0036] In a fifth aspect, the present invention provides a detection reagent, wherein the detection reagent comprises the anti-Jo-1 antibody or antigen-binding fragment thereof described in the first aspect.

[0037] Furthermore, it is characterized in that the detection reagent is a quality control product, a positive control product or a standard product.

[0038] In a sixth aspect, the present invention provides a kit comprising the anti-Jo-1 antibody or antigen-binding fragment thereof according to the first aspect of claim 1, or the detection reagent according to the fifth aspect.

[0039] The present invention also provides the use of the anti-Jo-1 antibody or its antigen-binding fragment in detecting the presence or level of Jo-1 antibody in a sample, or in preparing a kit for detecting the presence or level of Jo-1 antibody in a sample; or the use of the detection reagent or the kit in detecting the presence or level of Jo-1 antibody in a sample.

[0040] It should be noted that the kit generally includes one or more detection reagents, which contain the specific antibody to be measured, which can be used as a quality control, positive control or standard. The standard is used to establish a standard curve for assigning antibody concentrations, or a single positive control can be used near the positive / negative cutoff value. Preferably, the standard or positive control is prepared with the specific antibody to be tested or a material chemically similar thereto. Ideally, the standard or control is manufactured to interact with other assay components in a manner similar to the test analyte (specific antibody). Usually, multiple standards are included, which contain specific antibodies of different concentrations, and the concentrations of these antibodies span the concentration range of the object to be tested. When the detection agent is used as a standard, positive control or quality control for Jo-1 antibody detection, the concentration of the Jo-1 antibody in the detection agent is indicated, that is, clear, and its concentration can be adjusted according to the needs of the detection.

[0041] Of course, the kit also includes other necessary detection reagent components for detecting Jo-1 antibodies, such as chemiluminescent immunoassay-related reagent components, specifically Jo-1 antigen-coated solid phase carrier components and labeled antibody reagent components.

[0042] Compared with the prior art, the technical effects achieved by the present invention include:

[0043] The anti-Jo-1 antibody or antigen-binding fragment thereof provided by the present invention solves the problem of traceability of positive blood and large-scale supply. The scheme of the present invention can be used to prepare Jo-1 antibodies or antigen-binding fragments with high titer, high accuracy and good stability, providing a source of raw materials with excellent performance for the preparation of calibrators / positive controls / quality control products of Jo-1 antibody detection kits. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 The agarose gel electrophoresis results of RNA extracted from positive whole blood of the present invention;

[0045] Figure 2 The agarose gel electrophoresis result of the heavy chain variable region amplified by the present invention;

[0046] Figure 3 The agarose gel electrophoresis result of the light chain variable region amplified by the present invention;

[0047] Figure 4 This is the amplification result of the ScFv fragment of the present invention;

[0048] Figure 5 This is an antibody with high affinity and specificity screened by the present invention, and the SDS-PAGE test result;

[0049] Figure 6 The figure is the immunoblotting membrane strip detection result of the Jo-1 antibody of the present invention. DETAILED DESCRIPTION

[0050] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments. Obviously, the embodiments described below are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0051] It should be noted that, in the following embodiments, unless otherwise specified, the reagents and consumables used are all commercially available products, such as a DNA extraction kit, and the specific steps of preliminary DNA extraction can be performed according to the instructions of the kit.

[0052] Example 1: Construction of protein display library and screening of anti-Jo-1 antibodies

[0053] 1.1 Positive blood collection

[0054] 2 ml of whole blood was collected from 30 Jo-1 autoimmune patients aged between 20 and 50 years old.

[0055] 1.2 Lymphocyte isolation and total RNA extraction

[0056] The positive whole blood was collected and lymphocytes were separated using the QIAamp RNABlood Mini kit (50) instructions. Total RNA was extracted according to the Trizol kit instructions. The results are shown in Figure 1As shown. Add RNase-free water to dissolve and store as needed. Note that the materials used throughout the process must be RNase-free. Note that you need to wear a mask during the operation to prevent yourself from bringing in RNase and causing RNA degradation.

[0057] 1.3 Amplification of antibody heavy chain variable region and light chain variable region

[0058] According to the instructions of Takara reverse transcription kit PrimeScriptTMII 1st strand cDNA synthesiskit, the RNA obtained in 1.2 was used as a template for reverse transcription to synthesize cDNA. The obtained cDNA was then used as a template for PCR reaction to amplify the heavy chain variable region and light chain variable region sequences. The PCR reaction conditions and procedures were: 95°C for 5 minutes; 95°C for 30 seconds, 55°C for 60 seconds, 68°C for 60 seconds, 30 cycles; 68°C for 5 minutes. The PCR product was identified by 1.2% agarose gel electrophoresis. The length of the heavy chain variable region gene was about 375 bp; the length of the light chain variable region gene was about 330 bp. The primer sequences are shown in Table 1; the gel electrophoresis of the heavy chain variable region and the light chain variable region is shown in Table 1. Figure 2-Figure 3 shown.

[0059] Table 1 Primers for amplification of heavy chain variable region and light chain variable region

[0060]

[0061]

[0062] 1.4 Amplification of ScFv fragments

[0063] The amplified heavy chain variable region and light chain variable region genes were used as templates and specific primers were used for PCR reaction. The PCR reaction conditions and procedures were as follows: 95°C for 5 minutes; 95°C for 30 seconds, 55°C for 60 seconds, 68°C for 60 seconds, 30 cycles; 68°C for 5 minutes. The PCR product was identified by 1.2% agarose gel electrophoresis. The length of the ScFv fragment gene was about 750 bp. The primer sequences are shown in Table 2; the ScFv gel electrophoresis results are shown in Figure 4 shown.

[0064] Table 2 Amplification primer sequences of ScFv fragments

[0065] Primer name Primer sequences MH-VH-scFv-F gtcctcgcaccatggcc MHkappaCLscFv-NotI raccgcctccgcggccgcgaagacagatggtgcagccacagt MH-VH-scFv-F gtcctcgcaccatggcc MHLambdaCLscFv-NotI raccgcctccgcggccgcagaggasggygggaacagagtgac

[0066] 1.5 Construction of antibody gene library

[0067] The vector pCANTAB-5E and the second round amplification product were double-digested with Not I and Nco I, respectively, and the digestion products were recovered using a gel recovery kit and ligated using T4 DNA ligase. The ligation products were purified using a PCR product purification kit. All the purified ligation products were added to 50 μL TTG1 electroporation competent cells for electroporation under the conditions of 1 mm electroporation cup and 1800 V voltage. After adding culture medium for recovery culture, 10 μL gradient dilutions were taken for plating, and the number of colonies was calculated to obtain an antibody library capacity of 2.4×10 8 .

[0068] 1.6 Phage library amplification

[0069] Take 50 μL of the above bacterial library and inoculate it into 50 mL of 2*YT medium containing 2% glucose and ampicillin, culture at 37℃220rpm until OD600=0.5, add 500 μL of helper phage M13KO7, and infect at 37℃ for 1 hour. Centrifuge and change to 50 μg / mL kanamycin and 100 μg / mL ampicillin, and culture overnight at 26℃, 220rpm. Centrifuge and take 40 mL of supernatant, add 10 mL of PEG / NaCl (20% / 2.5M) solution and mix thoroughly, centrifuge and discard the supernatant, wash the precipitate with 1 mL of ice-cold PBS, and remove insoluble matter by high-speed centrifugation.

[0070] 1.7 Antibody Screening

[0071] The streptavidin magnetic beads were blocked with 3% milk-PBS for 2 hours, and the phage library was blocked for 1 hour. An appropriate amount of biotinylated SCL70 antigen was added to the blocked phage library, and the mixture was mixed at room temperature and 36°C for 1 hour; the blocked magnetic beads were added, washed 10 times with PBST, and the phage bound to the antigen was eluted with 0.2M glycine solution. The eluted phages were transfected with TG1 and entered the next round of screening. The screening operation was repeated. After 3 rounds of screening, the positive clones were verified by ELISA, and an antibody with high affinity was obtained, named Jo-1-T4. The amino acid sequence of the heavy chain variable region of Jo-1-T4 was obtained by sequencing analysis as shown in SEQ ID NO.1, and the nucleotide sequence encoded by it was shown in SEQ ID NO.10; the amino acid sequence of the light chain variable region was SEQ ID NO.2, and the nucleotide sequence encoded by it was shown in SEQ ID NO.11.

[0072] Example 2 Recombinant preparation and performance verification of Jo-1 antibody

[0073] 2.1 Gene synthesis

[0074] 2.1.1 This embodiment provides an anti-Jo-1 antibody, comprising a light chain and a heavy chain. The amino acid composition of the light chain: the sequence from the N-terminus to the C-terminus is VL-CL, and the sequence is SEQ ID NO.2-SEQ ID NO.7; the amino acid composition of the heavy chain: the sequence from the N-terminus to the C-terminus is VH-CH1-Hinge-CH2-CH3, and the sequence is SEQ ID NO.1-SEQ ID NO.3-SEQ ID NO.4-SEQ ID NO.5-SEQ ID NO.6.

[0075] 2.1.2 Based on the anti-Jo-1 antibody sequence, the Kozak sequence was introduced: GCCGCCACC; the signal peptide, the nucleotide sequence is shown in SEQ ID NO 19; the stop codon: TAA. The expression sequence was designed and sent to a gene synthesis company (Beijing Qingke) for codon optimization and gene synthesis.

[0076] Signal peptide sequence SEQ ID NO19:

[0077] atggactggacgtggcgcatcctgttcctggttgcagcagctacgggagcgcacagc.

[0078] 2.2 Antibody expression vector construction

[0079] 2.2.1 Amplification of antibody heavy and light chain fragments

[0080] The synthetic light chain and heavy chain genes were used as templates, and the PCR reaction solution was prepared according to the following components: 50 ng DNA template, 1 μL forward primer, 1 μL reverse primer, 5 μL 10×ExTaq buffer, 0.25 μL HS ExTaq, and ddH 2 O to 50 μL. Reaction conditions: 98℃ for 3 minutes; 94℃ for 50 seconds, 55℃ for 30 seconds, 68℃ for 40 seconds, 40 cycles; 72℃ for 10 minutes. 1% agarose gel electrophoresis, recover DNA and determine the concentration, short-term storage at -20℃. The heavy chain and light chain fragment amplification primers are shown in Table 3.

[0081] Table 3 Primers for heavy chain and light chain fragment amplification

[0082]

[0083]

[0084] 2.2.2pcDNA3.1 vector digestion and vector-antibody ligation

[0085] The vector enzyme digestion reaction system is as follows: take 5 μg pcDNA3.1 empty vector, 2 μL Hind III, 2 μL EcoR I, 10 μL 10x buffer, and use ddH 2 Add 100 μL of 1% agarose gel electrophoresis, recover DNA and determine its concentration, and store at -20°C for a short term.

[0086] The vector and antibody connection system is as follows: take 50ng vector fragment, 10ng antibody fragment, 5μg 2x buffer, 1μL seamless cloning ligase, and use ddH 2 Add 0 to 10 μL and react at 37°C for 30 min.

[0087] 2.2.3 Plating and sequencing

[0088] The transformation system is as follows: Take 100 μL Top10 competent cells, 10 μL ligation reaction solution, mix well, and place on ice for 30 minutes. Heat shock at 42°C for 90 seconds, and place on ice for 5 minutes. Then spread on LB solid plate containing 100 μg / mL ampicillin antibiotics, and culture at 37°C inverted overnight. Pick a single clone and transfer it to LB liquid medium containing 100 μg / mL ampicillin antibiotics, culture it at 37°C, 220rpm in a shaker for 6 hours, and send it for sequencing.

[0089] 2.2.4 Plasmid extraction

[0090] Sequence alignment sequencing results, the correct sequence of the bacterial solution was inoculated into 400mL LB liquid containing 100μg / mL ampicillin antibiotics, and cultured overnight at 37°C, 220rpm in a shaker. The plasmid was extracted using a plasmid extraction kit (OMEGA, D6924-04), the plasmid concentration was detected by UV spectrophotometer, and frozen at -20°C for future use. The concentration detection results are shown in Table 4.

[0091] Table 4 Heavy chain and light chain concentration detection results

[0092] Heavy chain Light chain Concentration (ng / μL) 1342 1447 Volume (mL) 2.3 2.2

[0093] 2.3 Preparation of anti-Jo-1 antibody

[0094] 2.3.1 Resuscitate 293F cells with serum-free medium (Expi 293 medium) until the density reaches 3-5×10 6 cells / mL, 0.5×10 6 Cells were subcultured every 3-4 days, and the cells were adapted to the third generation. 6cells / mL, subculture 500mL / bottle, take 250μg of the extracted heavy chain plasmid and 300μg of the light chain plasmid, mix them with 25mL of reduced serum medium (Opti-MEMTM); take 1.65mL PEI (1mg / mL), mix it with 25mL of serum-free medium (Expi 293 medium), then add PEI to the plasmid, mix it, let it stand for 15min, add 500mL of the subcultured cells, and culture it in a shaker (culture conditions are 37℃, 8% CO 2 , 120rpm).

[0095] 2.3.2 24 hours after plasmid addition, feed (0.5% enhancer 1 and 5% enhancer 2) was added, and then cultured for 4-6 days until the cell density reached about 60%. Centrifuge at 1000rpm and room temperature for 10min. Take the supernatant, centrifuge at 12000rpm and room temperature for 30min, filter at 0.22μm, purify the quality control antibody with Protein G (cytiva) filler, dialyze and ultrafilter with PBS, and detect the protein concentration with a spectrophotometer and the protein purity with SDS-PAGE. The test results are shown in Table 5 and Figure 5 .

[0096] Table 5 Protein concentration test results

[0097] Jo-1-T4 Expression volume (mL) 500 Detection concentration (mg / mL) 4.72 Final yield (mg / L) 141.6

[0098] 2.4 ELISA activity verification of antibodies

[0099] The expressed antibodies were tested by ELISA. The Jo-1 antigen was coated on the enzyme label strip, coated overnight at 4°C, and washed 3 times; the enzyme label strip was blocked with blocking solution, incubated at 37°C for 2h, and washed 3 times; the sample was added, incubated at 37°C for 30min, and washed 3 times; the human secondary antibody HRP was added, incubated at 37°C for 30min, and washed 3 times; color development, 10min, stop, and read. The test results are shown in Table 6.

[0100] Table 6 Antibody activity verification results

[0101]

[0102] Example 3 Antibody stability verification

[0103] In this example, the anti-Jo-1 antibody was prepared into a quality control product using negative blood for stability evaluation.

[0104] 3.1 Thermal stability: The prepared Jo-1 quality control product was divided into four equal portions, 1 mL / portion. One portion was placed at -20°C as a control, and the other three portions were placed at 37°C. One portion was taken out at the 7th day, 14th day, and 1 month time points and then placed at -20°C. After 1 month, the four quality control products were tested, and the ELISA test results of the samples taken out at each time point were compared with those of the samples that had been stored at -20°C.

[0105] 3.2 Freeze-thaw stability: The prepared Jo-1 quality control product was divided into four equal portions, 1 mL / portion. One portion was placed at -20°C as a control, and the other three portions were placed at -20°C and then freeze-thawed 3 times, 5 times, and 10 times, respectively. After the samples were collected, their activity was analyzed by ELISA. The results are shown in Table 7.

[0106] Table 7 Antibody stability test results

[0107]

[0108] From the ELISA test results, the anti-Jo-1 antibody of the present invention has good stability after 1 month of accelerated stability test at 37°C, and its performance is equivalent to that of the control group (stored at -20°C). After 3 freeze-thaw cycles, its activity is equivalent to that before freeze-thaw. After 5 freeze-thaw cycles, its activity will decrease, and the decrease will not exceed 10%. After 10 freeze-thaw cycles, its activity decreases significantly, close to 50%. The thermal stability of the antibody of the present invention is qualified, and the storage cannot exceed 5 freeze-thaw cycles.

[0109] Example 4: Application of the Jo-1 antibody to immunoblotting

[0110] 4.1 Prepare the kit (antinuclear antibody spectrum IgG detection kit, DL1590-6401-3G) and operate according to the kit operating instructions.

[0111] 4.1.1 All reagents must be equilibrated at room temperature (18-25°C) for 30 minutes before use.

[0112] 4.1.2 Antigen-coated test strips: Use directly. To prevent condensation of the strips, open the package only after the strips have reached room temperature. After taking out the strips, seal the original package immediately and store it at 2-8°C.

[0113] 4.1.3 Washing buffer: 10 times concentrated. When using, use a clean pipette to draw the required amount from the bottle and dilute it with distilled water 1:10. If you need to incubate one test strip, dilute 1mL of concentrated buffer with 9mL of distilled water. The diluted buffer should be used up on the same working day.

[0114] 4.1.4 Sample buffer: Use directly.

[0115] 4.1.5 Substrate solution: Use directly. It is light sensitive and the bottle cap should be tightly closed immediately after use.

[0116] 4.1.6 Enzyme conjugate: 10-fold concentrated. When using, draw the required enzyme conjugate from the bottle with a clean pipette and dilute it 1:10 with sample buffer. If you need to incubate one test membrane strip, dilute 0.15mL of enzyme conjugate with 1.35mL of sample buffer. The diluted enzyme conjugate should be used up on the same working day.

[0117] 4.1.7 Jo-1 antibody dilution: dilute Jo-1 antibody 1:101 with sample buffer. For example, dilute 15 μL Jo-1 antibody with 1.5 mL sample buffer and mix thoroughly. The diluted Jo-1 antibody should be used up on the same working day.

[0118] 4.2 Immunoblotting

[0119] 4.2.1 Preprocessing:

[0120] Take out the required membrane strips and place them in the incubation tank. The numbered side of the membrane strips faces upward. Add 1.5 mL of sample buffer to the incubation tank, incubate at room temperature on a rocking shaker for 5 minutes, and then aspirate the liquid in the incubation tank.

[0121] 4.2.2 Jo-1 antibody incubation

[0122] 1.5 mL of diluted Jo-1 antibody was added to each incubation chamber, and the mixture was incubated on a rocking shaker at room temperature (18° C. to 25° C.) for 30 minutes.

[0123] 4.2.3 Cleaning:

[0124] Aspirate the liquid in the tank and wash the membrane strips 3 times with 1.5 mL of washing buffer on a rocking platform, each time for 5 minutes.

[0125] 4.2.4 Enzyme conjugate incubation:

[0126] 1.5 mL of diluted enzyme conjugate (alkaline phosphatase-labeled anti-human IgG) was added to the incubation chamber and incubated at room temperature for 30 minutes on a rocking shaker.

[0127] 4.2.5 Cleaning:

[0128] Aspirate the liquid in the tank and wash the membrane strips 3 times with 1.5 mL of washing buffer on a rocking platform, each time for 5 minutes.

[0129] 4.2.6 Substrate incubation:

[0130] 1.5 mL of substrate solution was added to each incubation tank, and incubated on a rocking shaker at room temperature (18°C to 25°C) in the dark for 10 minutes.

[0131] 4.2.8 Result judgment:

[0132] Place the test membrane strip in the result determination template and determine the result after air drying.

[0133] Results Figure 6 Judging from the membrane strip results, the screened Jo-1 antibody can specifically bind to the Jo-1 antigen and can be used for Jo-1 autoimmunity detection.

[0134] In the above embodiments, the description of each embodiment has its own emphasis. For parts that are not described in detail in a certain embodiment, reference can be made to the relevant descriptions of other embodiments.

[0135] The above is a specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can easily think of various equivalent modifications or replacements within the technical scope disclosed by the present invention, and these modifications or replacements should be included in the protection scope of the present invention. Therefore, the protection scope of the present invention shall be based on the protection scope of the claims.

Claims

1. An anti-Jo-1 antibody or an antigen-binding fragment thereof, characterized in that: including a heavy chain variable region and a light chain variable region; The amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.1, and the amino acid sequence of the light chain variable region is shown in SEQ ID NO.

2.

2. The anti-Jo-1 antibody or antigen-binding fragment thereof according to claim 1, wherein: Also included is a heavy chain constant region, the heavy chain constant region comprising: The amino acid sequence of CH1 is shown in SEQ ID NO.3; Hinge having an amino acid sequence as shown in SEQ ID NO.4; CH2 having an amino acid sequence as shown in SEQ ID NO.5; and The amino acid sequence of CH3 is shown in SEQ ID NO.

6.

3. The anti-Jo-1 antibody or antigen-binding fragment thereof according to claim 1, wherein: The antibody or antigen-binding fragment thereof further comprises a light chain constant region CL, and the amino acid sequence of the light chain constant region CL is shown in SEQ ID NO.

7.

4. The anti-Jo-1 antibody or antigen-binding fragment thereof according to any one of claims 1 to 3, characterized in that: The heavy chain amino acid sequence of the antibody or antigen-binding fragment thereof is shown in SEQ ID NO.8, and the light chain amino acid sequence is shown in SEQ ID NO.

9.

5. A nucleic acid molecule, characterized in that Encodes the anti-Jo-1 antibody or antigen-binding fragment thereof according to any one of claims 1 to 4.

6. A carrier, characterized in that Comprising the nucleic acid molecule of claim 5.

7. A host cell, characterized in that Comprising the nucleic acid molecule according to claim 5, or the vector according to claim 6.

8. A detection reagent, characterized in that: The detection reagent comprises the anti-Jo-1 antibody or antigen-binding fragment thereof according to any one of claims 1 to 4.

9. A kit, characterized in that The method comprises the anti-Jo-1 antibody or antigen-binding fragment thereof according to any one of claims 1 to 4, or the detection reagent according to claim 8.

10. Use of the anti-Jo-1 antibody or antigen-binding fragment thereof according to any one of claims 1 to 4 in detecting the presence or level of Jo-1 antibody in a sample, or in preparing a kit for detecting the presence or level of Jo-1 antibody in a sample; or use of the detection reagent according to claim 8 or the kit according to claim 9 in detecting the presence or level of Jo-1 antibody in a sample.

Images