Lactobacillus salivarius combination capable of promoting calcium absorption and improving bone health as well as metagen and application of lactobacillus salivarius combination

Abstract

The invention discloses a strain of combined lactobacillus salivarius for promoting calcium absorption and improving bone health and a metagen and application thereof, and belongs to the field of food and health-care food, the combined lactobacillus salivarius WZA-LS82 is subjected to fermentation culture, a citron extract solution is added for further fermentation to prepare a weakly acidic metagen product, and the metagen has the advantages that the metagen can be used for promoting calcium absorption and improving bone health; the effects of promoting calcium absorption and improving bone health are obvious, and a new thought is provided for developing a post-generation product for promoting calcium absorption and improving the bone health function through dietetic invigoration and dietetic therapy.

Description

Technical Field

[0001] The invention belongs to the field of food and health food, and specifically relates to a saliva-associated lactobacillus for promoting calcium absorption and improving bone health, and a postbiotic and application thereof. Background Art

[0002] Calcium is an important component of bone and is closely related to human bone health. The intestine is the main organ that mediates calcium absorption. The microbial communities and metabolites in the intestine play an important role in this process. Insufficient calcium absorption can increase the risk of bone dysplasia in children and osteoporosis in the elderly. Ligilactobacillus salivarius ), a Gram-positive bacillus, has good acid and bile resistance and can survive in the intestines and stomachs of humans and animals. In recent years, salivary Lactobacillus has become a hot topic of research as a probiotic lactobacillus with great potential.

[0003] Postbiotics refer to inanimate microorganisms and (or) their component preparations that are beneficial to the health of the host. They have multiple biological activities such as anti-inflammatory, immunomodulatory, antioxidant, anti-tumor and antibacterial, and are relatively safe and stable, and are increasingly favored by the market. Patent CN118452475A discloses a preparation method and application of a postbiotic that promotes calcium absorption. The patent uses Lactobacillus helveticus CCFM1263 to be inoculated into a casein solution in a certain proportion for fermentation. The prepared postbiotics can promote calcium absorption and bone health. Patent CN118389380B discloses a plant lactobacillus NTK-061 that promotes calcium absorption, postbiotics and their calcium products, which have the effect of efficiently promoting calcium absorption in the human body and significantly promoting human bone growth and health.

[0004] As people's awareness of nutrition and health care increases, achieving health care goals through food supplements and promoting health effects through food supplements are gradually accepted and tried by the public. At present, the development of postbiotic products for promoting calcium absorption or improving bone health function in the existing technology is still in its infancy, and there are few reports on related products. The development of postbiotic products that promote calcium absorption and improve bone health function through "food supplements and diet therapy" is of great significance and has broad market prospects. Summary of the invention

[0005] According to the above prior art, the purpose of the present invention is to provide a saliva-associated lactobacillus strain that promotes calcium absorption and improves bone health, and its postbiotics and applications.

[0006] To achieve the above object, the present invention adopts the following technical solution: In a first aspect, the present invention provides a strain of Lactobacillus salivarius ( Ligilactobacillus salivarius ) WZA-LS82, the saliva combined with Lactobacillus ( Ligilactobacillus salivarius ) WZA-LS82 It was deposited in China Center for Type Culture Collection (CCTCC, address: Wuhan University, Wuchang District, Wuhan City, Hubei Province) on August 9, 2024. Its deposit number is CCTCC No: M 20241765. Classification name: Ligilactobacillus salivarius WZA-LS82 .

[0007] In a second aspect, the present invention provides a postbiotic that promotes calcium absorption and improves bone health. The postbiotic is a saliva-based lactobacillus ( Ligilactobacillus salivarius ) WZA-LS82 The fermentation metabolites are active ingredients.

[0008] The postbiotics are prepared by the following method: The activated saliva is combined with Lactobacillus ( Ligilactobacillus salivarius ) WZA-LS82 The mixture was inoculated into a liquid culture medium and subjected to constant temperature anaerobic fermentation for 24-36 hours. Then, a citron extract solution was added and the fermentation was continued for 18 hours to terminate the fermentation. The fermentation liquid was inactivated and the pH of the inactivated fermentation liquid was adjusted to 5.8-6.0 to prepare a postbiotic that promotes calcium absorption and improves bone health.

[0009] The saliva combined with Lactobacillus ( Ligilactobacillus salivarius ) WZA-LS82 The number of viable bacteria when inoculating liquid culture medium is not less than 4×10 8 CFU / mL.

[0010] The volume ratio of the citron extract solution to the liquid culture medium is (0.3-0.5):10.

[0011] In a third aspect, the present invention provides the above-mentioned saliva combined with lactobacillus ( Ligilactobacillus salivarius ) WZA-LS82 Application in (1) or (2) below: (1) Preparation of products for promoting calcium absorption; (2) Preparation of products for improving bone health.

[0012] Beneficial effects of the present invention: The present invention isolates and screens a strain of Lactobacillus salivais that promotes calcium absorption and improves bone health ( Ligilactobacillus salivarius ) WZA-LS82 The present invention combines saliva with Lactobacillus ( Ligilactobacillus salivarius ) WZA-LS82 The weakly acidic postbiotic product, which is prepared by fermentation and further fermentation with citron extract solution, is effective in promoting calcium absorption and improving bone health, providing a new idea for the development of postbiotic products that promote calcium absorption and improve bone health function through "dietary supplements and diet therapy". BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 for Figure 1 It is a strain WZA-LS82 Colony morphology photos.

[0014] Figure 2 It is a strain WZA-LS82 Gram staining photo under 1000× microscope.

[0015] Figure 3 This is the HE staining image of mouse intestinal villi morphology; Figure 3 A is the intestinal villi morphology of mice in the comparative example 1 group. Figure 3 Middle B is the intestinal villi morphology of mice in group 2 of the comparative example. Figure 3 Middle C is the intestinal villi morphology of mice in the experimental group.

[0016] Figure 4 For different groups CaMK Detection of relative mRNA expression levels of genes. DETAILED DESCRIPTION

[0017] It should be noted that the following detailed descriptions are illustrative and are intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present application belongs.

[0018] As mentioned above, calcium is an important inorganic element in the human body. Insufficient calcium absorption can increase the risk of bone dysplasia in children and osteoporosis in the elderly. Through the method of dietary supplementation and health preservation, the development of postbiotic products that can promote calcium absorption and improve bone health has broad market prospects.

[0019] Based on this, the present invention discloses a saliva-associated Lactobacillus that promotes calcium absorption and improves bone health, and its postbiotics and applications. The present invention first isolates and screens a saliva-associated Lactobacillus that promotes calcium absorption and improves bone health ( Ligilactobacillus salivarius ) WZA-LS82 , further, after fermenting and culturing it for a period of time, a citron extract solution is added to prepare a postbiotic product with a weakly acidic pH (pH=5.8-6.0). A weakly acidic environment is more conducive to dissolving calcium and increasing the calcium ion concentration in the intestinal cavity, thereby causing a calcium ion concentration difference between the intestinal cavity and the intestinal epithelial cells, which is conducive to the passive diffusion of calcium, thereby enhancing the absorption of calcium by intestinal epithelial cells. Therefore, when the postbiotic product prepared by the present invention is taken and absorbed in the intestine, the pH of the intestinal environment is lowered, which is conducive to the absorption of calcium.

[0020] Citron is an evergreen shrub of the genus Citrus in the Rutaceae family. It is an economic tree species with medicinal and edible properties. Citron fruit can be used in traditional Chinese medicine, and has the effects of regulating qi and relieving fullness, relieving swelling and reducing phlegm, and relieving stomach and abdominal distension and pain. Chinese medicine compound based on citron can be used to treat functional dyspepsia. Food-grade citron extract products are also relatively common on the market, but their development and utilization in the field of health foods with medicinal and edible properties is far from enough. Since citron fruit itself has a certain effect on protecting the gastrointestinal tract, the present invention uses citron extract as an ingredient for the preparation of postbiotic products, thereby enhancing the gastrointestinal mucosal barrier and further improving the calcium absorption level of the intestine.

[0021] Further, subsequent experiments found that in saliva combined with Lactobacillus ( Ligilactobacillus salivarius ) WZA-LS82 After a period of fermentation and cultivation, citron extract solution is added to prepare a weakly acidic postbiotic product, which can enhance the calcium level in serum, significantly promote the growth of intestinal microvilli, increase the surface area of ​​intestinal mucosa, and protect the gastrointestinal mucosal barrier. The significant increase in intestinal wall microvilli will help the absorption of calcium. CaMK Genes play an important role in promoting osteogenic differentiation and proliferation, which is beneficial to maintaining bone homeostasis and bone health. CaMK The relative mRNA expression level of the gene was significantly higher than that of the comparative example 1 group and the comparative example 2 group. The dual-energy X-ray bone absorptiometry was used to detect the whole body bone mineral content and bone density of each group of mice. It can be seen that the product provided by the present invention can significantly increase the whole body bone mineral content and bone density of mice and improve bone health. The experimental results show that by taking the postbiotics prepared by the present invention, the growth of intestinal microvilli can be promoted, thereby increasing the level of calcium absorption, which helps to promote bone health and achieve the purpose of food supplement health care.

[0022] The following detailed description is for illustrative purposes only and is intended to provide further explanation of the present application, rather than to limit the scope of the present invention.

[0023] The saliva combined with lactobacillus ( Ligilactobacillus salivarius ) WZA-LS82 It has been deposited in China Center for Type Culture Collection on August 9, 2024, with the deposit number CCTCC No: M 20241765. The classification name is: Ligilactobacillus salivarius WZA-LS82 .

[0024] The formula of the MRS agar plate used in the present invention is: weigh 10g of peptone, 8g of beef extract powder, 4g of yeast powder, 20g of glucose, 0.2g of magnesium sulfate, 5g of sodium acetate, 2g of diammonium hydrogen citrate, 2g of dipotassium hydrogen phosphate, 0.04g of manganese sulfate, 1g of Tween 80, and 14g of agar, dissolve in distilled water, adjust pH=5.7±0.2 (25°C), dilute to 1L, and pour the plate for standby after high-temperature sterilization. The only difference between the MRS liquid culture medium preparation method and the MRS agar plate is that agar is no longer added to the formula.

[0025] The food-grade citron extract used in the embodiments of the present invention is a water-soluble citron powder with an effective content of 99%, which is purchased from Shaanxi Sihai Biotechnology Co., Ltd.

[0026] The clean-grade SD rats used in the present invention were purchased from Jinan Pengyue Experimental Animal Breeding Co., Ltd.

[0027] Example 1: Isolation, purification and identification of strains: Weigh 10 g of fecal sample from an 8-month-old infant and add it to 90 mL of sterile saline, and shake at 150 r / min for 2 h. Take 1 mL of the suspension and add it to a test tube containing 9 mL of sterile water. Use a pipette tip to blow and mix 5 times to obtain a 0.01 g / mL sample suspension. The sample suspension was then gradiently diluted to 0.1×10 -6 Take 100 μL of gradient dilution and spread it evenly on MRS agar plate, culture it at 37°C under anaerobic conditions for 24 hours until colonies grow, pick a single colony, and use Gram staining to observe the morphological characteristics of the bacteria. WZA-LS82 The colonies are white ( Figure 1 ). The microscopic morphology of the strain was observed under a 1000× microscope and it was found that the bacteria were rod-shaped and were Gram-positive bacteria ( Figure 2 ).

[0028] Will WZA-LS82 The single strain was sent to the Biotechnology Department for 16S rDNA gene sequencing and the sequencing results were compared with NCBI by BLAST-N. Ligilactobacillus salivarius The species sequence identity reached 100% and was identified as Lactobacillus salivarius, named Lactobacillus salivarius ( Ligilactobacillus salivarius ) WZA-LS82 , and the strain was biologically deposited. The deposit information is as follows: Bacterial species: Lactobacillus salivarius ( Ligilactobacillus salivarius ) WZA-LS82 ; Category naming: Ligilactobacillus salivariusWZA-LS82 ; Depository: China Center for Type Culture Collection; Abbreviation of depository institution: CCTCC; Address: Wuhan University, Wuchang District, Wuhan City, Hubei Province; Deposit date: August 9, 2024; Deposit number: CCTCC No: M 20241765.

[0029] Example 2: Preparation of postbiotics Take 1g of citron extract and dissolve it in 100mL of water and stir evenly to prepare the citron extract solution. Ligilactobacillus salivarius ) WZA-LS82 According to 4×10 8 The inoculum was inoculated with an inoculum of 100 CFU / mL into 1 L of MRS liquid culture medium, and after constant temperature anaerobic fermentation at 37°C for 24 hours, 50 mL of the prepared citron extract solution was added and the fermentation was continued for 18 hours before terminating the fermentation. The fermentation broth was inactivated at 95°C for 15 min, and the pH of the inactivated fermentation broth was adjusted to 5.8 to prepare the postbiotic prepared by the present invention.

[0030] Comparative Example 1: Preparation of postbiotics Take 1g of citron extract and dissolve it in 100mL of water and stir evenly to prepare the citron extract solution. Ligilactobacillus salivarius ) WZA-LS82 According to 4×10 8 The inoculum was inoculated with an inoculum of 100 CFU / mL into 1 L of MRS liquid culture medium. After constant temperature anaerobic fermentation at 37°C for 24 h, 50 mL of the prepared citron extract solution was added and the fermentation was continued for 18 h before terminating the fermentation. The fermentation broth was inactivated at 95°C for 15 min, and the pH of the inactivated fermentation broth was adjusted to 7.2 to obtain the prepared postbiotics.

[0031] Comparative Example 2: Preparation of postbiotics The activated saliva is combined with Lactobacillus ( Ligilactobacillus salivarius ) WZA-LS82 According to 4×10 8 The inoculum was inoculated with an inoculum of 100 CFU / mL into 1 L of MRS liquid culture medium. After constant temperature anaerobic fermentation at 37°C for 24 h, 50 mL of MRS liquid culture medium was added and the fermentation was continued for 18 h before terminating the fermentation. The fermentation broth was inactivated at 95°C for 15 min, and the pH of the inactivated fermentation broth was adjusted to 5.8 to obtain the prepared postbiotics.

[0032] Test Example 1: Serum Ca 2+ Detection Twenty healthy 4-week-old male SD rats were divided into an experimental group, a comparative example 1 group, a comparative example 2 group and a control group, with 5 rats in each group. The experimental group was fed with 15 g of a basic diet (30% wheat flour, 30% corn flour, 14% bran, 16% soybean meal, 5% sesame meal, and 5% fish meal) + 5 ml of the postbiotics prepared in Example 2 daily; the comparative example 1 group was fed with 15 g of a basic diet + 5 ml of the postbiotics prepared in comparative example 1 daily; the comparative example 2 group was fed with 15 g of a basic diet + 5 ml of the postbiotics prepared in comparative example 2 daily, and the control group was fed with 20 g of a basic diet daily. The four groups of rats were raised in an environment with a temperature of (22.0 ± 0.5) ° C, a relative humidity of (50 ± 10)%, and a light intensity of 12 h / 12 ​​h alternating light and dark for 21 days, and then the rat serum was collected, and the Ca in the serum was detected by the azo arsenic III method. 2+ Level, the average value of statistical test results.

[0033] The test results showed that the daily basal diet of mice supplemented with Lactobacillus salivae Ligilactobacillus salivarius ) WZA-LS82 The acidic postbiotic product prepared by fermentation of citron extract can significantly increase the Ca content in mouse serum. 2+ level (Table 1).

[0034] Table 1: Serum Ca 2+ Level detection Test Example 2: Intestinal villus morphology detection After blood sampling was completed in the experimental group 1, one mouse was randomly selected from the experimental group, the comparative example 1 group, and the comparative example 2 group and treated with 1% sodium pentobarbital (50 mg kg -1 ) The mouse was anesthetized by intraperitoneal injection, and the mouse was fixed on the experimental table in a supine position. The abdominal skin of the mouse was disinfected, the fur of the lower abdomen was cut, the abdominal cavity was cut open, the small intestine was fully exposed, and the small intestine from the stomach to the cecum, including the duodenum, jejunum and ileum, was taken. The isolated small intestine was then rinsed with pre-cooled saline. The whole process was gentle to avoid damaging the villi of the small intestine. The specimen was then fixed in a 4% paraformaldehyde solution.

[0035] The cleaned middle jejunum of each group of mice was selected for making intestinal tissue sections. The specific operation was as follows: (1) Take out the jejunal intestinal segment sample from the centrifuge tube containing 4% paraformaldehyde, cut the middle segment, wash off the fixative with physiological saline, dehydrate with gradient alcohol (75%-85%-95%-100%), then place in xylene to make it transparent, embed in paraffin, and fix and cool in a mold; (2) Use a rotary slicer to slice the sample continuously to a thickness of 5 μm, then use a brush to transfer the slices to distilled water at an appropriate temperature. After the slices are fully unfolded, pick them up and stick them on the slides. Then transfer them to a slide drying machine to dry them. After dewaxing and hydration, use hematoxylin-eosin (H&E) staining. After dehydration with alcohol and transparency with xylene, use neutral gum to seal the samples. (3) Place the prepared intestinal slices under a fluorescence microscope to observe the intestinal tissue morphology and take photos. Select a slice image with a scale of 50 μm and a magnification of 200 times to observe the height of the intestinal villi.

[0036] from Figure 3 It can be seen that the height of the intestinal villi of the experimental group of mice was significantly longer than that of the comparison group 1 and the comparison group 2. The longer the length of the small intestinal villi, the larger the surface area, indicating that the calcium absorption capacity is stronger, and the protective effect on the intestinal mucosa is more significant.

[0037] Experimental Example 3: Detection of the expression level of calcium ion transporter in the mouse intestine and bone health level (1) Detection of expression level of calcium transporter in mouse intestine CaMK Genes play an important role in promoting osteogenic differentiation and proliferation, and are beneficial to maintaining bone homeostasis and bone health. Further, one mouse was randomly selected from the remaining mice in the experimental group, comparative example 1 group, and comparative example 2 group, and the small intestine of the mouse was taken using the method described in Experimental Example 2. After washing away the intestinal contents, the intestinal mucosa was gently scraped with a broken piece as the sample to be tested to extract RNA, and the extracted RNA was reverse transcribed into cDNA, and the primer sequences shown in SEQ ID NO.1-SEQ ID NO.2 were used to detect the calcium ion transporter on the intestinal mucosa of each group of mice using real-time fluorescence quantitative PCR. CaMK Relative mRNA expression level of gene (OriGene: NM_177407).

[0038] SEQ ID NO.1: GTGACACCTGAAGCCAAAGACC; SEQ ID NO.2: CCTGTGCATCATGGAGGCAACA.

[0039] The test results showed that the intestinal mucosa of the experimental group of mice CaMK The relative mRNA expression level of the gene was significantly higher than that of the control group 1 and the control group 2 ( Figure 4 ).

[0040] (2) Mouse bone health level detection After feeding for 21 days, the mice in each group of Experimental Example 1 were tested for whole body bone mineral content and bone density using a dual-energy X-ray bone absorptiometry (GE Lunar iDNA), and the average values ​​were calculated. The test results showed that the daily basic feed supplemented with saliva combined with Lactobacillus ( Ligilactobacillus salivarius ) WZA-LS82 The weakly acidic postbiotic product prepared by fermenting citron extract can significantly increase the bone mineral content and bone density of mice and improve bone health (Table 2).

[0041] Table 2: Comparison of whole body bone mineral content and bone density in mice of different groups The above description is only a preferred embodiment of the present application and is not intended to limit the present application. For those skilled in the art, the present application may have various modifications and variations. Any modification made within the spirit and principle of the present application shall be deemed to be appropriate. Equivalent replacements, improvements, etc. should all be included in the protection scope of this application.

Claims

1. A strain of Lactobacillus salivarius that promotes calcium absorption and improves bone health ( Ligilactobacillus salivarius ) WZA-LS82 , characterized in that, The saliva combined with Lactobacillus ( Ligilactobacillus salivarius ) WZA-LS82 It has been deposited in China Center for Type Culture Collection on August 9, 2024, with the deposit number CCTCC No: M 20241765, and the classification name is: Ligilactobacillus salivarius WZA-LS82 .

2. A postbiotic for promoting calcium absorption and improving bone health, characterized in that: The postbiotics are saliva combined with Lactobacillus ( Ligilactobacillus salivarius ) WZA-LS82 The fermentation metabolites are active ingredients.

3. The postbiotic according to claim 2, characterized in that The postbiotics are prepared by the following method: The activated saliva is combined with Lactobacillus ( Ligilactobacillus salivarius ) WZA-LS82 The mixture was inoculated into a liquid culture medium and subjected to constant temperature anaerobic fermentation for 24-36 hours. Then, a citron extract solution was added and the fermentation was continued for 18 hours to terminate the fermentation. The fermentation liquid was inactivated and the pH of the inactivated fermentation liquid was adjusted to 5.8-6.0 to prepare a postbiotic that promotes calcium absorption and improves bone health.

4. The postbiotic according to claim 3, characterized in that The saliva combined with Lactobacillus ( Ligilactobacillus salivarius ) WZA-LS82 The number of viable bacteria when inoculating liquid culture medium is not less than 4×10 8 CFU / mL.

5. The postbiotic according to claim 3, characterized in that The volume ratio of the citron extract solution to the liquid culture medium is (0.3-0.5):

10.

6. The saliva-associated lactobacillus of claim 1 ( Ligilactobacillus salivarius ) WZA-LS82 Application in (1) or (2) below: (1) Preparation of products for promoting calcium absorption; (2) Preparation of products for improving bone health.

Images