Preparation method of DNA mismatch repair protein
By constructing artificial strains for synthetic DNA mismatch repair protein MutS, the problems of low biosynthesis and high usage cost of MutS protein are solved, efficient DNA error correction and low-cost DNA synthesis are achieved, and the development of the DNA synthesis industry has been promoted.
Patent Information
- Application Number
- CN202411171317.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-08-23
- Publication Date
- 2024-12-13
AI Technical Summary
The biosynthesis amount of MutS protein in the prior art is low and the cost of use is high, which limits the application of large-scale DNA synthesis processes, especially when handling error correction of long DNA fragments.
An artificial strain of synthetic DNA mismatch repair protein MutS was constructed. The MutS protein was realized by connecting the MutS gene and isopropyl-β-D-thiogalactosinogenin-induced promoter to the expression vector and introducing it into Bacillus subtilis to achieve the MutS protein. The efficient expression and purification of the system reduces the error rate and production costs.
It significantly increases the biosynthesis amount of MutS protein, reduces the error rate during DNA synthesis, reduces the difficulty of screening and sequencing costs of synthetic products, and promotes the development of the DNA synthesis industry.
Smart Images
Figure CN119120334A_ABST
Abstract
Description
Technical Field
[0001] The present disclosure relates to the field of microbial technology, and in particular to a method for preparing a DNA mismatch repair protein. Background Art
[0002] Nucleic acid is the genetic material of most organisms in nature, encoding a series of life activities such as growth, reproduction, aging and death of organisms. DNA synthesis technology is the cornerstone of synthetic genomics and even modern molecular biology. The de novo synthesis of DNA is to obtain artificially designed specific DNA fragments through the splicing of oligos (oligonucleotide chains). Currently, the mature and commercialized method for the synthesis of oligos is chemical method. A series of errors will occur in the process of chemically synthesized oligonucleotides and long-fragment DNA assembly, such as the insertion, deletion, displacement and substitution of nucleotides.
[0003] In the process of evolution, various nucleases have emerged, which can accurately edit nucleic acids, such as polymerases, ligases, restriction enzymes, hydrolases, etc., and play an important role in the life process. However, the components of natural nucleases are mostly proteins, and the protein structure is unstable. It is easy to be inactivated in the environment of acid, alkali, high temperature, denaturant, etc., thus losing its biological function. In addition, the requirements for the reaction system are relatively strict. It needs to be in a specific buffer solution system to play the greatest role, which poses a great challenge to its large-scale application. Studies have shown that adding an error correction step to the DNA synthesis process can effectively reduce the error rate, thereby reducing the difficulty of screening the correct synthetic product and the sequencing cost. Enzymatic error correction based on mismatch cutting enzymes and physical separation methods based on mismatch binding enzyme MutS protein are currently two commonly used error correction methods, but they still have great limitations. The error correction method based on MutS protein mainly uses MutS protein to specifically bind to the mismatch site of DNA double strands and form a DNA-MutS protein complex, and then separates the mismatched double strands by electrophoresis or solid phase carrier adsorption to achieve the purification of mismatched double strands. Some researchers have established an immobilized MutS cellulose gel column error correction method, which is suitable for error correction of oligonucleotide libraries and assembly fragments synthesized on chips, and reduces the synthesis error from 14 / kb to 0.56 / kb. However, this method uses a column recovery method, which has complicated steps and a long operation time. In theory, the recovery operation of this method can be simplified by replacing the solid phase carrier. At present, MutS protein is mainly used for small fragment error correction processing, and no reports have been reported on the error correction of DNA fragments >1kb.
[0004] At present, the biosynthesis amount of MutS protein is low and the use cost is expensive, which has great limitations for its application in large-scale DNA synthesis. Therefore, improving the biosynthesis efficiency of MutS protein is of great significance to the development of DNA synthesis industry. Summary of the invention
[0005] The present disclosure provides a method for preparing a DNA mismatch repair protein to at least solve the above technical problems existing in the prior art.
[0006] According to a first aspect of the present disclosure, a method for constructing an artificial strain for synthesizing a DNA mismatch repair protein is provided, comprising the following steps:
[0007] The gene encoding the DNA mismatch repair protein MutS and the isopropyl-β-D-thiogalactoside (IPTG) inducible promoter Pspac are connected in series to the expression vector pHT43 to obtain the recombinant plasmid pHT-MP; the recombinant plasmid pHT-MP is introduced into Bacillus subtilis, thereby constructing the artificial strain for synthesizing the DNA mismatch repair protein.
[0008] In one embodiment, the DNA mismatch repair protein MutS is from Escherichia coli MG1655.
[0009] In one embodiment, the nucleic acid sequence of the gene encoding the DNA mismatch repair protein MutS is shown as SEQ ID NO:1.
[0010] In one embodiment, PCR primers are designed based on the known nucleic acid sequence of the MutS gene, and the genome of the Escherichia coli MG1655 is used as a template for amplification to obtain the gene encoding the DNA mismatch repair protein MutS.
[0011] In one embodiment, the nucleic acid sequence of the isopropyl-β-D-thiogalactoside inducible promoter Pspac is as shown in SEQ ID NO:2.
[0012] In one embodiment, PCR primers are designed based on the known nucleic acid sequence of the promoter Pspac, and the synthetic sequence of the promoter Pspac is used as a template to amplify the isopropyl-β-D-thiogalactoside inducible promoter Pspac.
[0013] In one embodiment, the tandem connection is carried out by forming a fusion gene fragment by fusion PCR with the gene encoding the DNA mismatch repair protein MutS and the isopropyl-β-D-thiogalactoside inducible promoter Pspac.
[0014] In one embodiment, the recombinant plasmid pHT-MP is introduced into the Bacillus subtilis cells by transformation.
[0015] In one embodiment, the Bacillus subtilis is the fengycin-synthesizing strain Bacillus subtilis 168.
[0016] According to a second aspect of the present disclosure, a method for preparing a DNA mismatch repair protein is provided, comprising the following steps:
[0017] S1: Cultivating the artificial strain obtained according to the above construction method, and then inducing the expression of DNA mismatch repair protein MutS;
[0018] S2: Purifying the expressed DNA mismatch repair protein MutS.
[0019] In one embodiment, the culture method of step S1 includes activation culture and expansion culture.
[0020] In one embodiment, the activation culture comprises the following step: activating the artificial strain on a solid culture medium.
[0021] In one embodiment, the expanded culture comprises the following steps: picking a single bacterial colony on the solid culture medium after the activation culture and placing it in a liquid culture medium to obtain a seed solution; inoculating the seed solution into the fermentation medium and waiting for the OD 600 When the pH value is 0.6 to 0.8, isopropyl-β-D-thiogalactoside (IPTG) is added and cultured at 15 to 18° C. for 20 to 25 hours to induce the expression of the DNA mismatch repair protein MutS.
[0022] Specifically, the culture conditions for obtaining the seed solution are: temperature 37-40° C., rotation speed 220-250 rpm / min, and time 12-14 h.
[0023] Specifically, the seed liquid is inoculated into the fermentation medium at an inoculation rate of 5-7% by volume.
[0024] Specifically, the rotation speed of adding the isopropyl-β-D-thiogalactoside for cultivation is 220-250 rpm / min.
[0025] In one embodiment, step S2 specifically includes the following steps: after inducing the expression of the DNA mismatch repair protein MutS, collecting the cultured bacteria, crushing and centrifuging the bacteria, and purifying the obtained supernatant by nickel column affinity chromatography.
[0026] Specifically, during the nickel column affinity chromatography purification process, the equilibration buffer used was 10 mM phosphate buffer (PBS, pH 7.4), the washing buffers were 20 mM and 50 mM phosphate buffer (pH 7.4), and the elution buffer was 500 mM imidazole phosphate buffer (pH 7.4).
[0027] According to an implementable embodiment of the present disclosure, at least the following beneficial effects are achieved:
[0028] The present invention discloses that an artificial strain for synthesizing the DNA mismatch repair protein MutS can significantly increase the biosynthesis amount of the MutS protein, and the synthesis is convenient and low-cost. The error rate can be effectively reduced during the DNA synthesis process, thereby reducing the difficulty of screening the synthetic products and the sequencing cost, which is of great significance to the development of the DNA synthesis industry.
[0029] It should be understood that the content described in this section is not intended to identify the key or important features of the embodiments of the present disclosure, nor is it intended to limit the scope of the present disclosure. Other features of the present disclosure will become easily understood through the following description. BRIEF DESCRIPTION OF THE DRAWINGS
[0030] The above and other objects, features and advantages of the exemplary embodiments of the present disclosure will become readily understood by reading the detailed description below with reference to the accompanying drawings. In the accompanying drawings, several embodiments of the present disclosure are shown in an exemplary and non-limiting manner, in which:
[0031] In the drawings, the same or corresponding reference numerals represent the same or corresponding parts.
[0032] Figure 1 An agarose gel electrophoresis diagram showing the results of MutS gene amplification detection in Example 1 of the present disclosure is shown;
[0033] Figure 2 The result diagram of agarose gel electrophoresis verification of sequencing results in Example 1 of the present disclosure is shown;
[0034] Figure 3 The SDS-PAGE result diagram in Example 2 of the present disclosure is shown. DETAILED DESCRIPTION
[0035] In order to make the purpose, features, and advantages of the present disclosure more obvious and easy to understand, the technical solutions in the embodiments of the present disclosure will be clearly and completely described below in conjunction with the drawings in the embodiments of the present disclosure. Obviously, the described embodiments are only part of the embodiments of the present disclosure, not all of the embodiments. Based on the embodiments in the present disclosure, all other embodiments obtained by those skilled in the art without creative work are within the scope of protection of the present disclosure.
[0036] Example 1
[0037] This example constructs an artificial strain that synthesizes DNA mismatch repair protein. The specific process is:
[0038]
[0039] (2) Extraction of E. coli MG1655 genome. Take 3-5 mL of E. coli MG1655 culture medium in LB liquid medium, cultured at 37°C, 220 rpm / min for 12-16 h, centrifuge at 4°C, 12000 rpm for 30 s, and collect the precipitate. Add 500 μL of cell lysis solution to the precipitate, shake it upside down 7-8 times, and keep it in a 37°C metal bath for 30 min. Add 264 μL of 5M NaCl solution to the above lysate, shake it upside down 7-8 times, centrifuge it at 12000 rpm for 10 min, and transfer the supernatant to a new clean sterile centrifuge tube. Add 500 μL of saturated phenol / chloroform, gently aspirate with a pipette, mix thoroughly, centrifuge it at 12000 rpm for 30 min, transfer the supernatant to a new clean sterile centrifuge tube, and repeat the above steps once. Add 500 μL of chloroform, shake upside down 7-8 times, centrifuge at 12000 rpm for 30 minutes, and transfer the supernatant to a clean and sterile centrifuge tube. Add 200 μL of anhydrous ethanol precooled at 4°C, place at -20°C to precipitate for 30 minutes, then centrifuge at 12000 rpm for 10 minutes, pour off the liquid, and collect the white filamentous precipitate. Add 500 μL of 70% ethanol precooled at 4°C to wash, repeat the wash twice, dry at room temperature, and dissolve the precipitate with 60 μL of sterile deionized water to complete the genome extraction process, and store in the refrigerator for later use.
[0040] (3) Amplification of MutS gene. The genome of Escherichia coli MG1655 extracted above was used as a template, and the above-mentioned MutS-F and MutS-R were used as primers to amplify the MutS gene. The PCR reaction system is: total volume 50μL, sterile water 17μL, 2×Phanta Max Buffer 25μL, dNTP Mix 1μL, upstream primer 2μL, downstream primer 2μL, Phanta Max SuperFidelity DNA Polymerase 1μL, template 2μL; PCR reaction program is: 95℃, 3min; 95℃, 15s; 72℃, 60s / kb; 72℃, 5min; 4℃ insulation, number of cycles: 35. After the amplification, 1% agarose gel electrophoresis was performed for verification. The results are as follows: Figure 1 shown. Figure 1 It showed that the MutS gene was successfully amplified through the above procedure.
[0041] (4) Design and synthesis of primers for amplification of the Pspac promoter. Based on the sequence of the Pspac promoter (SEQ ID NO: 2: ATGTCTCATGCAGTTAAAATATACGATACATGTATCG GCTGTTCTCAGTGTGTACGAGCATGTCCTACTGATGTTTTAGAAATGGTGTCTTGGGATGGATGTAAAGCAGGCCAGATCGCTTCAGCACCTCGAACAGAAGATTGTGTTGGTTGTAAGCGTTGTGAATCAGCTTGTCCTACCGATTTCTTAAGTGTACGTGTCTACTTAGGTGCAGAAACAACAAGAAGTATGGGATTAGCATATTAA), amplification primers Pspac-F, the nucleic acid sequence of which is shown in SEQ ID NO: 5: AAGAAGTATGGGATTAGCATATTAA; and Pspac-R, the nucleic acid sequence of which is shown in SEQ ID NO: 6: CGTATATTTTAACTGCATGAGACAT. These two primers were synthesized by Sangon Biotechnology Co., Ltd.
[0042] (5) Synthesis of Pspac promoter. Based on the nucleic acid sequence of the Pspac promoter, Sangon Biotechnology Co., Ltd. was commissioned to perform full synthesis as a template, and the above-mentioned Pspac-F and Pspac-R were used as primers to amplify the Pspac promoter. The PCR reaction system was: total volume 50 μL, sterile water 17 μL, 2×Phanta Max Buffer 25 μL, dNTP Mix 1 μL, upstream primer 2 μL, downstream primer 2 μL, Phanta Max Super Fidelity DNA Polymerase 1 μL, template 2 μL; PCR reaction program was: 95°C, 3 min; 95°C, 15 s; 72°C, 60 s / kb; 72°C, 5 min; 4°C insulation, number of cycles: 35.
[0043] (6) Primer design and synthesis of the fusion fragment of MutS gene and Pspac promoter. Based on the sequences of MutS gene and Pspac promoter, the amplification overlap extension primers were designed as follows:
[0044] MP-F1, the nucleic acid sequence is shown in SEQ ID NO:7: TTATCGCTTGAAGAGCCTGGT GTAA;
[0045] MP-R1, the nucleic acid sequence is shown in SEQ ID NO:8: CGTCGAATTTCTATTGCACT CATAAGAAGTATGGG;
[0046] MP-F2, the nucleic acid sequence is shown in SEQ ID NO:9: TCTATTGCACTCATAAGAAGT ATGGGATTAGCATATTAA;
[0047] MP-R2, the nucleic acid sequence is shown in SEQ ID NO:10: CGTATATTTTAACTGCATGAG ACAT;
[0048] These primers were synthesized by Sangon Biotechnology Co., Ltd.
[0049] (7) Preparation of the fusion fragment of MutS gene and Pspac promoter. The MutS gene amplified in (3) was used as a template, and MP-F1 and MP-R1 were used as primers to amplify the MutS gene. The PCR reaction system was: total volume 50 μL, sterile water 17 μL, 2×Phanta Max Buffer 25 μL, dNTP Mix 1 μL, upstream primer 2 μL, downstream primer 2 μL, Phanta Max SuperFidelity DNA Polymerase 1 μL, template 2 μL; PCR reaction program was: 95°C, 3 min; 95°C, 15 s; 72°C, 60 s / kb; 72°C, 5 min; 4°C insulation, number of cycles: 35.
[0050] The Pspac promoter amplified in (5) was used as a template, and MP-F2 and MP-R2 were used as primers to amplify the Pspac promoter. The PCR reaction system was: total volume 50 μL, sterile water 17 μL, 2×Phanta Max Buffer 25 μL, dNTP Mix 1 μL, upstream primer 2 μL, downstream primer 2 μL, Phanta Max Super Fidelity DNA Polymerase 1 μL, template 2 μL; PCR reaction program was: 95°C, 3 min; 95°C, 15 s; 72°C, 60 s / kb; 72°C, 5 min; 4°C insulation, number of cycles: 35.
[0051] The MutS gene and Pspac promoter amplified in (7) were used as templates, and MP-F1 and MP-R2 were used as primers to amplify the MutS gene and Pspac promoter fusion fragment. The PCR reaction system was: total volume 50 μL, sterile water 17 μL, 2×PhantaMax Buffer 25 μL, dNTP Mix 1 μL, upstream primer 2 μL, downstream primer 2 μL, Phanta Max SuperFidelity DNA Polymerase 1 μL, template 2 μL; PCR reaction program was: 95°C, 3 min; 95°C, 15 s; 72°C, 60 s / kb; 72°C, 5 min; 4°C insulation, number of cycles: 35.
[0052] (8) The fusion fragment in (7) was digested with restriction endonucleases NdeⅠ and XbaⅠ, and the plasmid pHT43 was also digested with NdeⅠ and XbaⅠ. The fusion fragment containing the digestion ends was ligated with the plasmid pHT43 containing the same digestion ends overnight using T4 ligase. The ligation product was transformed into DH5α competent cells and spread on LB solid medium (LB solid medium formula: peptone 10g / L, yeast powder 5g / L, sodium chloride 10g / L, agar 20g / L) containing 50μg / mL kanamycin and 0.2% mannitol. The culture was carried out at 37℃ for 16-18h, and the grown single colonies were picked for colony PCR verification. The verification fragment was consistent with the theoretical fragment size, and the correct double-gene vector pHT-MP was screened. The correct single colony was expanded in liquid culture, and the plasmid was extracted and sent to Sangon Biotech Co., Ltd. for sequencing verification and 1% agarose gel electrophoresis verification. The results are as follows: Figure 2 As shown. Figure 2 It can be seen that the fragment size is consistent with the theoretical fragment size, indicating that the picked single colony indeed includes the correct pHT-MP, and the MutS gene and Pspac promoter fusion fragment is successfully connected to the expression vector pHT43.
[0053] (9) The expression plasmid pHT-MP was introduced into B. subtilis 168 by transformation, spread on chloramphenicol selection pressure plates for solid plate culture, and incubated upside down at 37°C for 13 to 17 h. Single colonies were selected for verification, and the correct conjugates were screened and the plasmids were extracted for verification, and finally the B. subtilis mp strain was obtained.
[0054] Example 2
[0055] This example prepares the DNA mismatch repair protein MutS. The specific process is:
[0056] (1) The DNA mismatch repair protein MutS synthetic strain B. subtilis mp constructed in Example 1 was cultured on a solid plate, inverted and statically cultured at 37°C for 12 to 16 hours, a single colony was taken, and the solid plate culture was continued, inverted and statically cultured at 37°C for 24 hours, and a single colony was taken in a 50 mL liquid culture medium for seed culture, and cultured at 37°C and 220 rpm / min for 12 hours to obtain a seed solution; the seed solution was inoculated into the fermentation medium at a volume ratio of 5%, and the OD was increased. 600 =0.6-0.8, add isopropyl-β-D-thiogalactoside (IPTG) to a final concentration of 1.0 mM, induce expression at 15°C for 24 h, and then harvest the bacteria; resuspend the cells in water and disrupt them by ultrasonication.
[0057] (2) The disrupted bacteria were centrifuged and the supernatant was purified by nickel column affinity chromatography, wherein the equilibration buffer used 10 mM phosphate buffer (PBS, pH 7.4), the washing buffer used 20 mM and 50 mM imidazole phosphate buffer (pH 7.4), respectively, and the elution buffer used 500 mM imidazole phosphate buffer (pH 7.4); after purification, the sample was prepared and analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The results are as follows: Figure 3 shown. Figure 3 The results showed that the DNA mismatch repair protein MutS was successfully prepared with high purity. The eluted protein was dialyzed into 10 mM PBS (pH 7.4), filtered through a 0.22 μm filter membrane, and stored at -80°C for later use.
[0058] It should be understood that the various forms of processes shown above can be used to reorder, add or delete steps. For example, the steps recorded in this disclosure can be executed in parallel, sequentially or in different orders, as long as the desired results of the technical solution of this disclosure can be achieved, and this document is not limited here.
[0059] In addition, the terms "first" and "second" are used for descriptive purposes only and should not be understood as indicating or implying relative importance or implicitly indicating the number of technical features indicated. Thus, a feature defined as "first" or "second" may explicitly or implicitly include at least one of the features. In the description of the present disclosure, the meaning of "plurality" is two or more, unless otherwise clearly and specifically defined.
[0060] The above is only a specific embodiment of the present disclosure, but the protection scope of the present disclosure is not limited thereto. Any person skilled in the art who is familiar with the technical field can easily think of changes or substitutions within the technical scope disclosed in the present disclosure, which should be included in the protection scope of the present disclosure. Therefore, the protection scope of the present disclosure should be based on the protection scope of the claims.
Claims
1. A method for constructing an artificial strain for synthesizing DNA mismatch repair protein, characterized in that: The following steps are involved: The gene encoding the DNA mismatch repair protein MutS and the isopropyl-β-D-thiogalactoside inducible promoter Pspac are connected in series to the expression vector pHT43 to obtain the recombinant plasmid pHT-MP; the recombinant plasmid pHT-MP is introduced into Bacillus subtilis, thereby constructing the artificial strain for synthesizing the DNA mismatch repair protein.
2. The construction method according to claim 1, characterized in that: The DNA mismatch repair protein MutS is from Escherichia coli MG1655.
3. The construction method according to claim 2, characterized in that: PCR primers are designed according to the known nucleic acid sequence of the MutS gene, and the genome of the Escherichia coli MG1655 is used as a template for amplification to obtain the gene encoding the DNA mismatch repair protein MutS.
4. The construction method according to claim 1, characterized in that: PCR primers are designed according to the known nucleic acid sequence of the promoter Pspac, and the synthetic sequence of the promoter Pspac is used as a template to amplify the isopropyl-β-D-thiogalactoside inducible promoter Pspac.
5. The construction method according to claim 1, characterized in that: The tandem method is: the gene encoding the DNA mismatch repair protein MutS and the isopropyl-β-D-thiogalactoside inducible promoter Pspac are fused by PCR to form a fusion gene fragment.
6. The construction method according to claim 1, characterized in that: Introducing the recombinant plasmid pHT-MP into the cells of the Bacillus subtilis by transformation; Preferably, the Bacillus subtilis is the fengycin-synthesizing strain Bacillus subtilis 168.
7. A method for preparing a DNA mismatch repair protein, characterized in that: The following steps are involved: S1: culturing the artificial strain obtained by the construction method according to any one of claims 1 to 6, and then inducing the expression of the DNA mismatch repair protein MutS; S2: Purifying the expressed DNA mismatch repair protein MutS.
8. The preparation method according to claim 7, characterized in that: The culture method of step S1 includes activation culture and expansion culture; The activation culture comprises the following steps: activating and culturing the artificial strain on a solid culture medium; The expanded culture comprises the following steps: picking a single bacterial colony on the solid culture medium after the activation culture and placing it in a liquid culture medium to obtain a seed solution; inoculating the seed solution into a fermentation medium and waiting for the OD 600 When the pH value is 0.6 to 0.8, isopropyl-β-D-thiogalactoside is added, and the mixture is cultured at 15 to 18° C. for 20 to 25 hours to induce the expression of the DNA mismatch repair protein MutS.
9. The preparation method according to claim 8, characterized in that: The culture conditions for obtaining the seed solution are: temperature 37-40° C., rotation speed 220-250 rpm / min, and time 12-14 h; Preferably, the seed liquid is inoculated into the fermentation medium at an inoculation rate of 5-7% by volume.
10. The preparation method according to claim 7, characterized in that: Step S2 specifically includes the following steps: after inducing the expression of the DNA mismatch repair protein MutS, collecting the cultured bacteria, crushing and centrifuging the bacteria, and purifying the obtained supernatant by nickel column affinity chromatography.