Tyrosine phenol lyase mutant and application thereof in synthesis of tyrosine derivative

Abstract

The invention discloses a tyrosine phenol lyase mutant and application of the tyrosine phenol lyase mutant in synthesis of a tyrosine derivative. The mutant is obtained by performing single mutation or multiple mutation on the 18th site or the 417th site of an amino acid sequence shown in SEQ ID NO.2. Compared with a wild type, the tyrosine phenol lyase mutant provided by the invention has more excellent enzyme activity and more excellent catalytic performance. According to the TPL mutant, the cumulative concentration for synthesizing levodopa is up to 160 g / L or above, the cumulative concentration for synthesizing L-tyrosine is up to 80 g / L or above, the cumulative concentration for synthesizing 3, 4, 5-TOPA is up to 16.4 g / L or above, the cumulative concentration for synthesizing 3-fluoro-L-tyrosine is up to 33.1 g / L or above, the cumulative concentration for synthesizing 2-fluoro-L-tyrosine is up to 20.5 g / L or above, and the optical purity is greater than 99.9%.

Description

(I) Technical field

[0001] The invention belongs to the field of genetic engineering and enzyme engineering, and relates to a tyrosine phenol lyase mutant and the application of the mutant in synthesizing tyrosine derivatives. (II) Background technology

[0002] Tyrosine phenol lyase (TPL, EC 4.1.99.2) is a type of pyridoxal-5'-phosphate (PLP)-dependent lyase that catalyzes the reversible elimination of L-tyrosine to produce phenol, pyruvate and ammonia.

[0003] In addition to this physiological reaction, TPL can also catalyze the elimination and substitution reactions of a series of amino acids substituted by easy-leaving groups at the b-position, and is an important biocatalyst for the synthesis of tyrosine derivatives.

[0004] Optically pure tyrosine derivatives such as 3-methyl-L-tyrosine, 3-fluoro-L-tyrosine and L-3,4-dihydroxyphenylalanine (L-DOPA) are important drugs (intermediates) for the treatment of neurological diseases, and the development of green and efficient industrial synthesis technology is of great significance. Using cheap chemicals such as phenol derivatives, pyruvic acid and ammonia as raw materials, TPL stereoselective catalytic synthesis of optically pure tyrosine derivatives has significant advantages such as environmental friendliness and high atom economy.

[0005] Natural enzymes are the result of long-term adaptation to natural evolution. They have a tight structure and precise regulation. However, they usually have low catalytic efficiency for non-natural substrates and are difficult to adapt to high-intensity industrial production environments. With the rapid development of protein engineering technology, modifying enzymes to improve their catalytic performance has become an important means to obtain excellent biocatalysts. Effective regulation of TPL can improve its catalytic activity for non-natural substrates and the synthesis efficiency of target products, which is of great significance for the green industrial synthesis of optically pure tyrosine derivatives. (III) Summary of the invention

[0006] The present invention aims to provide a tyrosine phenol lyase mutant and its application in synthesizing tyrosine derivatives. Tyrosine phenol lyase (Fn-TPL) derived from nuclease-bearing Bacillus is modified by semi-rational design means to provide a tyrosine phenol lyase mutant. The tyrosine phenol lyase mutant can be used to efficiently catalyze the synthesis of L-tyrosine derivatives using phenol derivatives, sodium pyruvate and ammonia as substrates, and the enzyme activity and synthesis efficiency are significantly improved, thereby promoting the application of the enzyme in the synthesis of tyrosine derivatives.

[0007] The technical solution adopted by the present invention is:

[0008] The present invention provides a tyrosine phenol lyase mutant, wherein the mutant is obtained by subjecting the 18th or 417th position of the amino acid sequence shown in SEQ ID NO.2 to single mutation or multiple mutation.

[0009] Furthermore, the tyrosine phenol lyase mutant is a mutant in which the threonine at position 18 of the amino acid sequence shown in SEQ ID NO.2 is mutated to leucine (T18L, the amino acid sequence is SEQ ID NO.4, the nucleotide sequence is SEQ ID NO.3) or the tyrosine at position 417 is mutated to asparagine (Y417N, the amino acid sequence is SEQ ID NO.6, the nucleotide sequence is SEQ ID NO.5).

[0010] Any deletion, insertion or substitution of one or more amino acids in the amino acid sequences shown in SEQ ID NO.4 and SEQ ID NO.6 and having TPL activity still falls within the scope of protection of the present invention.

[0011] The amino acid sequence shown in SEQ ID NO.2 of the present invention is derived from Fusobacterium nucleatum (F. nucleatum subsp. CGMCC 1.2526), ​​and the coding gene sequence is shown in SEQ ID NO.1. The genome extracted from Fusobacterium nucleatum CGMCC 1.2526 was used as a template, and the gene encoding TPL (Fn-TPL) was successfully cloned, and the gene was expressed after transformation into Escherichia coli; then, a plasmid containing Fn-TPL was extracted from Escherichia coli, and the TPL gene was mutated using a gene site saturation mutagenesis method, and after being connected to an expression vector, it was also expressed in Escherichia coli, and a mutant with improved activity was obtained by a high-throughput screening method.

[0012] The present invention also relates to the gene encoding the tyrosine phenol lyase mutant, a recombinant vector constructed by the encoding gene, and a genetically engineered bacterium transformed by the recombinant vector, wherein the engineered bacterium is constructed using Escherichia coli E.coli BL21 (DE3) as a host. The recombinant vector can be constructed by connecting the nucleotide sequence of the TPL mutant to various vectors by conventional methods in the art. The basic vector used to construct the recombinant vector in the present invention is not limited, as long as it can maintain its replication or autonomous replication in various host cells of prokaryotic and / or eukaryotic cells. The basic vector can be various conventional vectors in the art, such as various plasmids, phages or viral vectors, etc., preferably pET-28b (+). There is no limitation on the host cell into which the DNA encoding the TPL mutant of the present invention is introduced, as long as a recombinant expression system has been established for it, and the recombinant expression vector can stably replicate itself and the TPL mutant gene of the present invention carried can be effectively expressed. For example, Escherichia coli, Bacillus subtilis, yeast, actinomycetes, Aspergillus, as well as animal cells and higher plant cells. The present invention preferably uses Escherichia coli, and more preferably uses Escherichia coli E.coli BL21 (DE3).

[0013] The preparation of the TPL mutant of the present invention comprises culturing the genetically engineered bacteria of the present invention, and inducing the TPL mutant protein. The culture medium used for culturing the genetically engineered bacteria can be a culture medium in the art that can make the transformant grow and produce the TPL of the present invention, preferably LB culture medium: peptone 10g / L, yeast extract 5g / L, sodium chloride 10g / L, solvent is distilled water, pH 7.2. There are no special restrictions on the culture method and culture conditions, as long as the transformant can grow and produce TPL. The following method is preferred: the genetically engineered bacteria of the present invention are inoculated into LB culture medium containing 50μg / ml kanamycin, and cultured at 37°C until the optical density OD600 reaches 0.5-0.7, and under the induction of a final concentration of 0.1-1.0mM isopropyl-β-D-thiogalactopyranoside (IPTG), the TPL mutant protein of the present invention can be efficiently expressed.

[0014] The present invention also relates to the application of the tyrosine phenol lyase mutant in the synthesis of L-tyrosine derivatives. The application method is: using wet bacteria obtained by fermentation culture of an engineered bacterium containing a gene encoding the tyrosine phenol lyase mutant as a catalyst, using a phenol derivative (I), sodium pyruvate and ammonium acetate as substrates, sodium sulfite and EDTA·Na2 as auxiliary agents, pyridoxal 5'-phosphate (PLP) as a coenzyme, and a buffer solution with a pH of 6.0 to 10.5 (preferably pH 8.5) as a reaction medium to form a conversion system, carrying out a conversion reaction at a temperature of 5 to 30° C. (preferably 15° C.) and a rotation speed of 100 to 200 rpm (preferably 150 rpm), and after the reaction is completed, separating and purifying the reaction solution to obtain an L-tyrosine derivative (II);

[0015]

[0016] In formula (Ⅰ), R is monosubstituted or polysubstituted, and R is H, 2-hydroxy, 2,3-dihydroxy, 2-F, or 3-F; in formula (Ⅱ), R is the same as R in formula (Ⅰ).

[0017] Furthermore, the phenol derivative is one of phenol, catechol, pyrogallol, o-fluorophenol and m-fluorophenol.

[0018] Furthermore, in the transformation system, phenol derivatives are added to a final concentration of 4 to 50 g / L (preferably 4-6 g / L), sodium pyruvate is added to a final concentration of 5 to 50 g / L (preferably 7 g / L), ammonium acetate is added to a final concentration of 7.7 to 108 g / L (preferably 77 g / L), sodium sulfite is added to a final concentration of 0.5 to 10 g / L (preferably 1 g / L), EDTA·Na2 is added to a final concentration of 0.5 to 10 g / L (preferably 2 g / L), pyridoxal phosphate is added to a final concentration of 0.05 to 5 mM (preferably 1 mM), and the amount of wet bacteria is 2 to 50 g / L (preferably 20 g / L).

[0019] Furthermore, when the phenol derivative is catechol, it is added to a final concentration of 5 to 50 g / L (preferably 5 g / L); when the phenol derivative is phenol, it is added to a final concentration of 4 to 40 g / L (preferably 4.2 g / L); when the phenol derivative is pyrogallol, it is added to a final concentration of 5 to 50 g / L (preferably 5.7 g / L); when the phenol derivative is o-fluorobenzene, it is added to a final concentration of 5 to 50 g / L (preferably 5 g / L); when the phenol derivative is m-fluorophenol, it is added to a final concentration of 5 to 50 g / L (preferably 5 g / L).

[0020] Furthermore, during the conversion reaction, the phenol derivative, sodium pyruvate and ammonium acetate are fed every 0.5 to 4 hours, wherein the phenol derivative is fed at 0.1 to 10 g / L (preferably 5 g / L) each time, the sodium pyruvate is fed at 0.1 to 10 g / L (preferably 5 g / L) each time, and the ammonium acetate is fed at 1 to 20 g / L (preferably 3.5 g / L) each time.

[0021] The TPL mutant provided by the present invention can catalyze the synthesis of tyrosine and tyrosine derivatives in the form of free enzyme, immobilized enzyme and recombinant free cell.

[0022] Further, the catalyst is prepared as follows:

[0023] (1) Slant culture: The engineered bacteria containing the gene encoding the tyrosine phenol lyase mutant were inoculated into a slant culture medium containing 50 μg / mL kanamycin, and cultured at 37°C for 8 to 16 hours to obtain slant bacteria; the final concentration of the slant culture medium was: 10 g / L peptone, 5 g / L yeast powder, 10 g / L sodium chloride, 20 g / L agar, the solvent was distilled water, pH 7.0;

[0024] (2) Seed culture: The slant bacteria were inoculated into a seed culture medium containing 50 μg / ml kanamycin and cultured at 37°C for 8-10 h to obtain a seed solution; the final concentration of the seed culture medium was: peptone 10 g / L, yeast powder 5 g / L, sodium chloride 10 g / L, the solvent was distilled water, pH 7.0;

[0025] (3) Fermentation culture: The seed solution was inoculated at a volume concentration of 2% into a sterile 5 L mechanical stirring and ventilated general fermenter containing 3 L of fermentation medium. Sterilized lactose was directly added to the fermenter at a final concentration of 15 g / L. The fermentation was carried out at 28°C, a stirring speed of 300 rpm, and a ventilation volume of 5 m 3 / h (ventilation ratio is about 2vvm) and pH is controlled at 5.5 (pH is adjusted with 30% ammonia water and 45% phosphoric acid), and then the tank is released to collect wet bacteria; the final concentration of the fermentation medium is as follows: peptone 25g / L, yeast powder 6.55g / L, NaCl 10g / L, sucrose 9.1g / L, pyridoxal phosphate (PLP) 0.05mM, MgSO4 5mM, KH2PO4 10mM, the solvent is distilled water, and the pH is natural.

[0026] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in:

[0027] (1) The tyrosine phenol lyase mutant provided by the present invention has better enzyme activity than the wild type.

[0028] The enzyme activity of the T18L mutant on the substrate phenol increased by 178.0%, on the substrate catechol increased by 97.6%, on the substrate pyrogallol increased by 105.4%, on the substrate o-fluorophenol increased by 22.7%, and on the substrate m-fluorophenol increased by 118.0%.

[0029] The enzyme activity of the Y417N mutant on the substrate phenol increased by 151.3%, on the substrate catechol increased by 89.4%, on the substrate pyrogallol increased by 16.3%, on the substrate o-fluorophenol increased by 185.0%, and on the substrate m-fluorophenol increased by 560.6%.

[0030] (2) The tyrosine phenol lyase mutant provided by the present invention has better catalytic performance than the wild type.

[0031] The cumulative concentration of L-DOPA synthesized by the TPL mutant is as high as 160 g / L or more, the optical purity is greater than 99.9%, and the conversion rate of the substrate catechol is more than 99.8%; the cumulative concentration of L-tyrosine synthesized is as high as 80 g / L or more, the optical purity is greater than 99.9%, and the conversion rate of the substrate phenol is more than 99.8%; the cumulative concentration of 3,4,5-TOPA synthesized is as high as 16.4 g / L or more, the optical purity is greater than 99.9%, and the conversion rate of the substrate pyrogallol is more than 99.8%; the cumulative concentration of 3-fluoro-L-tyrosine synthesized is as high as 33.1 g / L or more, the optical purity is greater than 99.9%, and the conversion rate of the substrate o-fluorophenol is more than 95.7%; the cumulative concentration of 2-fluoro-L-tyrosine synthesized is as high as 20.5 g / L or more, the optical purity is greater than 99.9%, and the conversion rate of the substrate o-fluorophenol is more than 61.9%. (IV) Description of the drawings

[0032] Figure 1 , liquid phase peak spectrum of L-DOPA produced by catalyzing the reaction of catechol.

[0033] Figure 2 , liquid phase peak spectrum of L-tyrosine produced by catalyzing phenol reaction.

[0034] Figure 3 , catalyzing the reaction of pyrogallol to produce 3,4,5-TOPA liquid phase peak spectrum.

[0035] Figure 4 , liquid phase peak spectrum of 3-fluoro-L-tyrosine produced by catalyzing the reaction of o-fluorophenol.

[0036] Figure 5 , liquid phase peak spectrum of 2-fluoro-L-tyrosine produced by catalyzing the reaction of m-fluorophenol. (V) Specific implementation methods

[0037] The present invention is further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto:

[0038] Example 1. Acquisition of TPL gene

[0039] The whole genomic DNA of Fusobacterium nucleatum (F. nucleatum subsp. CGMCC 1.2526, purchased from China Industrial Microbiological Culture Collection Center) was extracted using a DNA extraction kit (purchased from Thermo Fisher Scientific), and PCR amplification reaction was carried out using the DNA as a template and the upstream primer (5'TGTTAGCAGCCGGATCTCAGT3') and the downstream primer (5'GGAGATATACCATGCGCTTTGA3') as the working primers.

[0040] The amount of each component added to the PCR reaction system (total volume 50 μL): 5× PrimeSTAR TM HSDNA polymerase Buffer 10 μL, 10 mM dNTP mixture (2.5 mM each of dATP, dCTP, dGTP and dTTP) 4 μL, 50 μM upstream primer and downstream primer 1 μL each, genomic DNA 1 μL, PrimeSTAR TM HSDNA polymerase 0.5 μL, and nuclease-free water 32.5 μL.

[0041] The PCR reaction conditions were as follows: pre-denaturation at 95°C for 5 min, followed by temperature cycling at 95°C for 1 min, 55°C for 1 min, and 72°C for 90 s, for a total of 30 cycles, and finally extension at 72°C for 10 min, with a termination temperature of 4°C.

[0042] The results of sequencing analysis showed that the gene encoding TPL (Fn-TPL) was amplified by the above process, with a nucleotide sequence length of 1383 bp (its nucleotide sequence is shown in SEQ ID NO.1), which encodes a complete open reading frame, and the encoded amino acid sequence is shown in SEQ ID NO.2.

[0043] Example 2: Construction of TPL saturation mutation library

[0044] The TPL gene obtained in Example 1 was used as a template to obtain a mutant sequence by PCR amplification. The amplification primers for site-directed saturation mutagenesis of the 18th site were:

[0045] TPL-18F: 5'GTGGAANNKGTGAAAATGATTGATAAAGCG 3'

[0046] TPL-18R: 5'TTTCACMNTTCCACTGATTTAATGCGAAA 3'.

[0047] The amplification primers for site-directed saturation mutagenesis at position 417 are:

[0048] TPL-417F: 5'TATACCNNKAAACATATGGATGTTGTTGCC 3'

[0049] TPL-417R: 5'ATGTTTMNNGGTATACACACGACCGCGGAAT 3'.

[0050] The amplification system (50 μL) is: 2× phanta Max buffer 25 μL; 1 μL of 10 mM dNTP mixture (2.5 mM each of dATP, dCTP, dGTP and dTTP); 2 μL of upstream primer and downstream primer at a concentration of 50 μM; 1 μL of DNA template; 0.5 μL of Phanta Max DNA polymerase; and make up the system with double distilled water.

[0051] The PCR reaction conditions were as follows: pre-denaturation at 95°C for 5 min, followed by temperature cycling at 95°C for 30 s, 59°C for 30 s, and 72°C for 4 min and 30 s, for a total of 30 cycles, and finally extension at 72°C for 10 min, with a termination temperature of 4°C.

[0052] The PCR product was analyzed by 1% agarose gel electrophoresis, transformed into E. coli BL21 (DE3) competent cells, coated with LB plates containing kanamycin (50 μg / mL), cultured at 37°C overnight, and single colonies were picked for screening of the TPL mutant library.

[0053] Example 3, Screening of TPL Mutation Library

[0054] The TPL mutant library constructed in Example 2 was screened by salicylaldehyde spectrophotometry. The color development principle is: under alkaline conditions, sodium pyruvate and salicylaldehyde undergo a Claisen-Schmidt reaction to generate a yellow compound, the color depth of which is proportional to the content of sodium pyruvate. The absorbance of the reaction solution is measured at a specific wavelength using a spectrophotometer for screening.

[0055] (1) Inducible expression of mutants

[0056] Use a sterilized toothpick to pick up single clones from the above mutation library into a 96-well deep-well plate containing 600 μL of sterile LB medium (containing 50 μg / mL kanamycin) in each well (the last 4 wells of the 11th column and the last 4 wells of the 12th column of the deep-well plate are not picked), and a wild-type single colony is picked into the last 4 wells of the 11th column. The last 4 wells of the 12th column serve as blank controls and no colonies are picked. After culturing in a shaker at 37°C and 180 rpm for 15 h, 200 μL of seed solution was taken out from each well and transferred to a new sterile 96-well deep-well plate containing 600 μL of sterile LB medium (containing 50 μg / mL kanamycin) in each well, and cultured in a shaker at 37°C and 180 rpm until OD600 was 0.6-0.8. IPTG was added to each well at a final concentration of 0.1 mM, and after induction at 28°C and 180 rpm for 12 h, the plate was centrifuged at 4°C and 4000 rpm for 15 min, the supernatant was discarded, and the bacteria were stored at -20°C for later use.

[0057] (2) Preliminary screening of color reaction

[0058] Take out the 96-well plate containing bacteria stored at -20°C in step (1), add 400 μL of reaction solution to each well, the composition of which is 40 mM sodium pyruvate, 40 mM catechol, 50 g / L ammonium acetate, 1 mM PLP, 1 g / L Na2SO3 and 2 g / L EDTA-2Na, adjust the pH to 8.0 with ammonia water, and the solvent is 50 mM Tris-HCl buffer with pH 8.0. React at room temperature at 180 rpm for 30 min. After the reaction is completed, add 400 μL 1M HCl to terminate the reaction and centrifuge. Take the supernatant after centrifugation for color development reaction.

[0059] In a 1mL standard reaction system, 100μL 250g / L NaOH aqueous solution, 40μL supernatant, 560μL ultrapure water, and 20μL salicylaldehyde colorimetric solution (salicylaldehyde: anhydrous ethanol = 1:3, volume ratio) were added in sequence, and after being fully shaken, 200μL 250g / L NaOH aqueous solution and 80μL ultrapure water were added. After being placed at room temperature for 2h, 200μL of colorimetric reaction solution was taken to a 96-well standard plate, and the absorbance was measured at a wavelength of 465nm by an ELISA reader. The changes in the enzyme activity of the mutants were compared according to the changes in the absorbance. Using the enzyme before mutation as a reference, mutants with reduced absorbance were screened, and positive clones with improved activity were initially screened through colorimetric reaction, and further determined by liquid chromatography.

[0060] Table 1 Preliminary screening data of TPL site 18 mutation library

[0061]

[0062] Table 2 Preliminary screening data of TPL site 417 mutation library

[0063]

[0064] (3) Liquid chromatography rescreening

[0065] The supernatant with increased activity (decreased absorbance) in step (2) is then subjected to liquid chromatography detection.

[0066] The liquid chromatography detection conditions are as follows: the liquid chromatograph is Agilent 1260Ⅱ, the chromatographic column is: C18 column (Welch, 5μm×250×4.6mm); column temperature: 34℃; flow rate: 1mL / min; injection volume: 10μL; detection wavelength: UV 280nm or 270nm or 210nm; mobile phase: 20mM KH2PO4 (HCl adjusted to pH 2.6): methanol = 9:1. When detecting L-DOPA, catechol, 3,4,5-TOPA, and pyrogallol, a detection wavelength of 280nm is used; when detecting 3-fluoro-L-tyrosine, o-fluorophenol, 2-fluoro-L-tyrosine, and m-fluorophenol, a detection wavelength of 270nm is used; when detecting L-tyrosine and phenol, a detection wavelength of 210nm is used.

[0067] Under the above chromatographic conditions, the elution times of levodopa (L-DOPA) and catechol were 3.984 min and 17.258 min, respectively; the elution times of 3,4,5-trihydroxyphenylalanine (3,4,5-TOPA) and catechol were 3.542 min and 7.064 min, respectively; the elution times of 3-fluoro-L-tyrosine and o-fluorophenol were 5.919 min and 52.076 min, respectively; the elution times of 2-fluoro-L-tyrosine and m-fluorophenol were 6.488 min and 66.474 min, respectively; the elution times of L-tyrosine and phenol were 4.983 min and 37.348 min, respectively.

[0068] Through liquid chromatography detection, the mutants TPL-T18L and TPL-Y417N with the highest activity were obtained. The wet bacterial enzyme activity of T18L increased by 97.6%, and the wet bacterial enzyme activity of Y417N increased by 89.4%. Sequencing showed that the amino acid sequence of the mutant TPL-T18L was shown in SEQ ID No.4, and the nucleotide sequence was shown in SEQ ID No.3;

[0069] The amino acid sequence of the mutant TPL-Y417N is shown in SEQ ID No.6, and the nucleotide sequence is shown in SEQ ID No.5.

[0070] Example 4: Induced expression of wild-type and mutant TPL engineered bacteria

[0071] 1. Construction of engineered bacteria:

[0072] The wild-type TPL (SEQ ID No. 1) and mutant TPL-T18L and TPL-Y417N genes (SEQ ID No. 3 and SEQ ID No. 5) were connected to the vector pET-28b(+) to construct recombinant expression plasmids pET-28b(+)-Fn-TPL, pET-28b(+)-Fn-TPL-T18L and pET-28b(+)-Fn-TPL-Y417N.

[0073] The recombinant plasmids pET-28b(+)-Fn-TPL, pET-28b(+)-Fn-TPL-T18L and

[0074] pET-28b(+)-Fn-TPL-Y417N was transformed into E. coli BL21(DE3) to obtain engineered bacteria E. coli BL21(DE3) / pET-28b(+)-Fn-TPL, E. coli BL21(DE3) / pET28b(+)-Fn-TPL-T18L and E. coli BL21(DE3) / pET28b(+)-Fn-TPL-Y417N, respectively.

[0075] 2. Induced expression of engineered bacteria

[0076] The engineered bacteria E. coli BL21(DE3) / pET-28b(+)-Fn-TPL and E. coli

[0077] BL21(DE3) / pET-28b(+)-Fn-TPL-T18L and E. coli BL21(DE3) / pET-28b(+)-Fn-TPL-Y417N were inoculated into LB liquid medium containing 50 μg / mL kanamycin, cultured at 37°C overnight, and then inoculated into 50 mL LB medium containing 50 μg / mL kanamycin at a 2% (v / v) inoculum amount, and cultured at 37°C and 200 rpm until the cell concentration OD600 reached about 0.6. IPTG was added at a final concentration of 0.1 mM, and the cells were induced at 28°C for 6 to 8 h. The cells were centrifuged at 4°C and 8000 rpm for 10 min, the wet cells were collected, and stored at -80°C for later use.

[0078] Example 5. Preparation of TPL mutant catalyst

[0079] (1) Slant culture: The engineered bacteria E. coli BL21(DE3) / pET-28b(+)-Fn-TPL, E. coli BL21(DE3) / pET-28b(+)-Fn-TPL-T18L, and E. coli BL21(DE3) / pET-28b(+)-Fn-TPL-Y417N were inoculated into a slant culture medium containing 50 μg / mL kanamycin, and cultured at 37°C for 16 h to obtain slant bacteria; the final concentration of the slant culture medium was: 10 g / L peptone, 5 g / L yeast powder, 10 g / L sodium chloride, 20 g / L agar, the solvent was distilled water, pH 7.0, and 50 μg / mL kanamycin was added before use.

[0080] (2) Seed culture: The slant bacteria were inoculated into a seed culture medium containing 50 μg / mL kanamycin and cultured at 37° C. for 8 to 10 h to obtain a seed solution; the final concentration of the seed culture medium was as follows: peptone 10 g / L, yeast powder 5 g / L, sodium chloride 10 g / L, the solvent was distilled water, pH 7.0.

[0081] (3) Fermentation culture: The seed solution was inoculated at a volume concentration of 2% into a sterile 5 L mechanical stirring and ventilated general fermenter containing 3 L of fermentation medium. Sterilized lactose was directly added to the fermenter at a final concentration of 15 g / L. The fermentation was carried out at 28°C, a stirring speed of 300 rpm, and a ventilation volume of 5 m 3 / h (ventilation ratio is about 2vvm), pH is controlled at 5.5 (pH is adjusted with 30% ammonia water and 45% phosphoric acid), and after induction culture for 6-8h, the tank is released and the wet bacteria are collected. The final concentration of the fermentation medium is: peptone 25g / L, yeast powder 6.55g / L, NaCl 10g / L, sucrose 9.1g / L, pyridoxal phosphate (PLP) 0.05mM, MgSO4 5mM, KH2PO4 10mM, the solvent is distilled water, and the pH is natural.

[0082] Example 6: Synthesis of L-DOPA Catalyzed by Wild-Type and Mutant TPL

[0083] The engineered bacteria E. coli BL21 (DE3) / pET-28b (+) -Fn-TPL-T18L (referred to as T18L wet bacteria), E. coli BL21 (DE3) / pET-28b (+) -Fn-TPL-Y417N (referred to as Y417N wet bacteria) and the starting strain E. coli BL21 (DE3) / pET-28b (+) -Fn-TPL wet bacteria (referred to as TPL wet bacteria) cells obtained by the method of Example 5 were used as catalysts to catalyze the synthesis of levodopa from catechol.

[0084] 1. Enzyme activity

[0085] In a 10mL reaction system, add catechol 5g / L, sodium pyruvate 7g / L, ammonium chloride 34.7g / L, sodium sulfite 1g / L, EDTA·Na2 2g / L, pyridoxal phosphate (PLP) 1mM, wet bacteria 2g / L (wet weight), the solvent is Tris-HCl buffer (50mM), and the pH is adjusted to 8.0 with hydrochloric acid; react for 5min at a temperature of 15°C and a speed of 150rpm. After the reaction is completed, add 10mL1M HCl to terminate the reaction. After the reaction is terminated, the reaction solution is filtered through a 0.22μm filter membrane, and the filtrate is taken to detect the peak area of ​​levodopa by high performance liquid chromatography, and the levodopa concentration is calculated according to the standard curve, and then the enzyme activity is calculated.

[0086] Enzyme activity definition: Under the above standard conditions, the amount of enzyme required to generate 1 μmol of L-DOPA per minute is defined as one enzyme activity unit U.

[0087] 2. Fermentation process

[0088] In a 500mL reaction system, 5g / L of catechol, 7g / L of sodium pyruvate, 77g / L of ammonium acetate, 1g / L of sodium sulfite, 2g / L of EDTA·Na2, 1mM of pyridoxal phosphate (PLP), and 20g / L (wet weight) of wet bacteria were added. The solvent was Tris-HCl buffer (50mM), and the pH was adjusted to 8.0 with hydrochloric acid. The reaction was carried out at a temperature of 15°C and a speed of 150rpm. The reaction process was carried out by substrate feeding, and the feeding was performed once every 2h, wherein 5g / L of catechol, 5g / L of sodium pyruvate, and 3.5g / L of ammonium acetate were fed each time, and 18 batches were fed. After the reaction was completed, 1mL of 1M HCl was added to terminate the reaction. After the reaction solution was filtered through a 0.22μm filter membrane, the filtrate was taken and the peak area of ​​catechol and levodopa was detected by high performance liquid chromatography ( Figure 1 ), the respective concentrations were calculated according to the standard curve, the conversion rate was calculated according to the reduction of catechol in the reaction system, and the yield was calculated according to the accumulation of L-DOPA in the reaction system.

[0089] 3. High performance liquid chromatography and standard curve

[0090] Mobile phase: A:B = 9:1 (A: 0.02M KH2PO4-6M HCl, pH = 2.6; B: methanol); Chromatographic column:

[0091] C18 (Welchrom 4.6*250mm); detection wavelength 280nm; column temperature 34℃; injection volume 10μL; flow rate 1ml / min.

[0092] Catechol and levodopa standards were prepared into appropriate concentrations with ultrapure water, and the above-mentioned liquid phase detection method was used for detection to prepare a standard curve of concentration and peak area of ​​the substance. The equation of the standard curve of catechol is:

[0093] Y=1045.5X-14.519, and the standard curve of levodopa is Y=1528.8X+21.293.

[0094] 4. Results

[0095] Table 3 Detection results of TPL wet bacteria, T18L wet bacteria, and Y417N wet bacteria on substrate catechol

[0096]

[0097] The results showed that the enzyme activity of T18L wet bacteria increased by 97.6%, the concentration of the target product reached 160g / L, the conversion rate of catechol reached 99.8%, and the optical purity of L-DOPA was greater than 99.9%.

[0098] The wet bacterial enzyme activity of Y417N increased by 89.4%, the target product concentration reached 149 g / L, the conversion rate reached 97.6%, and the optical purity of L-DOPA was greater than 99.9%.

[0099] During the TPL wet cell reaction, the substrate was supplemented 14 times, the target product concentration reached 132 g / L, the conversion rate reached 92%, and the optical purity of L-DOPA was greater than 99.9%.

[0100] Example 7: Synthesis of L-tyrosine catalyzed by wild-type and mutant TPL

[0101] The engineered bacteria E. coli BL21 (DE3) / pET-28b (+) -Fn-TPL-T18L (referred to as T18L wet bacteria), E. coli BL21 (DE3) / pET-28b (+) -Fn-TPL-Y417N (referred to as Y417N wet bacteria) and the starting strain E. coli BL21 (DE3) / pET-28b (+) -Fn-TPL wet bacteria (referred to as TPL wet bacteria) cells obtained by the method of Example 5 were used as catalysts to catalyze the synthesis of L-tyrosine from phenol.

[0102] 1. Enzyme activity

[0103] In a 10mL reaction system, add phenol 4.2g / L, sodium pyruvate 7g / L, ammonium chloride 34.7g / L, sodium sulfite 1g / L, EDTA·Na2 2g / L, pyridoxal phosphate (PLP) 1mM, wet bacteria 2g / L (wet weight), the solvent is Tris-HCl buffer (50mM), and the pH is adjusted to 8.0 with hydrochloric acid; react for 5min at a temperature of 15°C and a speed of 150rpm. After the reaction is completed, add 10mL1M HCl to terminate the reaction. After the reaction is terminated, the reaction solution is filtered through a 0.22μm filter membrane, and the filtrate is taken to detect the L-tyrosine peak area by high performance liquid chromatography, and the enzyme activity is calculated according to the standard curve.

[0104] Enzyme activity definition: Under the above standard conditions, the amount of enzyme required to generate 1 μmol of L-tyrosine per minute is defined as one enzyme activity unit U.

[0105] 2. Fermentation process

[0106] In a 500mL reaction system, add 4.2g / L phenol, 7g / L sodium pyruvate, 77g / L ammonium acetate, 1g / L sodium sulfite, 2g / L EDTA·Na2, 1mM pyridoxal phosphate (PLP), 20g / L wet bacteria (wet weight), the solvent is Tris-HCl buffer (50mM), and the pH is adjusted to 8.0 with hydrochloric acid; the reaction is carried out at a temperature of 15°C and a speed of 150rpm. The reaction process is carried out by substrate feeding, and the feeding is performed once every 2h, wherein 4.2g / L phenol is fed each time, 5g / L sodium pyruvate is fed each time, and 3.5g / L ammonium acetate is fed each time, and 8 batches are fed. After the reaction is completed, 1mL 1M HCl is added to terminate the reaction. After the reaction solution is terminated, it is filtered through a 0.22μm filter membrane, and the filtrate is taken and the peak area of ​​phenol and L-tyrosine is detected by high performance liquid chromatography ( Figure 2 ), the conversion rate was calculated based on the reduction of phenol in the reaction system, and the yield was calculated based on the accumulation of L-tyrosine in the reaction system.

[0107] 3. High performance liquid chromatography and standard curve

[0108] Mobile phase: A:B = 9:1 (A: 0.02M KH2PO4-6M HCl, pH = 2.6; B: methanol); Chromatographic column:

[0109] C18 (Welchrom 4.6*250mm); detection wavelength 210nm; column temperature 34℃; injection volume 10μL; flow rate 1ml / min.

[0110] L-tyrosine and phenol standards were prepared with ultrapure water to appropriate concentrations, and the above-mentioned liquid phase detection method was used to prepare a standard curve of concentration and peak area of ​​the substance. The equation of the phenol standard curve is: Y = 2253.3X + 160.45, and the equation of the L-tyrosine standard curve is Y = 3027.9X + 160.38.

[0111] 4. Results

[0112] Table 4 Detection results of TPL wet bacteria, T18L wet bacteria, and Y417N wet bacteria on substrate phenol

[0113]

[0114] The results showed that the enzyme activity of T18L wet bacteria increased by 178.0%, the concentration of the target product reached 80g / L, the conversion rate reached 99.8%, and the optical purity of L-tyrosine was greater than 99.9%.

[0115] The wet bacterial enzyme activity of Y417N increased by 151.3%, the target product concentration reached 69 g / L, the conversion rate reached 99.9%, and the optical purity of L-tyrosine was greater than 99.9%.

[0116] TPL wet bacteria, the target product concentration reached 61.4g / L, the conversion rate reached 96.0%, and the optical purity of L-tyrosine was greater than 99.9%.

[0117] Example 8: Synthesis of 3,4,5-TOPA catalyzed by wild-type and mutant TPL

[0118] The engineered bacteria E. coli BL21 (DE3) / pET-28b (+) -Fn-TPL-T18L (referred to as T18L wet bacteria), E. coli BL21 (DE3) / pET-28b (+) -Fn-TPL-Y417N (referred to as Y417N wet bacteria) and the starting strain E. coli BL21 (DE3) / pET-28b (+) -Fn-TPL wet bacteria (referred to as TPL wet bacteria) cells obtained by the method of Example 5 were used as catalysts to catalyze the synthesis of 3,4,5-TOPA from pyrogallol.

[0119] 1. Enzyme activity

[0120] In a 10mL reaction system, add pyrogallol 5.7g / L, sodium pyruvate 7g / L, ammonium chloride 34.7g / L, sodium sulfite 1g / L, EDTA·Na2 2g / L, pyridoxal phosphate (PLP) 1mM, wet bacteria 2g / L (wet weight), the solvent is Tris-HCl buffer (50mM), and the pH is adjusted to 8.0 with ammonia water; react for 10min at a temperature of 15℃ and a speed of 150rpm. After the reaction is completed, add 10mL 1M HCl to terminate the reaction. After the reaction is terminated, the reaction solution is filtered through a 0.22μm filter membrane, and the filtrate is taken to detect the 3,4,5-TOPA peak area by high performance liquid chromatography. The amount of pyrogallol consumed per minute in the reaction system is obtained according to the standard curve, and the enzyme activity is calculated.

[0121] Definition of enzyme activity: Under the above standard conditions, the amount of enzyme required to consume 1 μmol of pyrogallol per minute is defined as one enzyme activity unit U.

[0122] 2. Fermentation process

[0123] In a 500mL reaction system, 5.7g / L of pyrogallol, 7g / L of sodium pyruvate, 77g / L of ammonium acetate, 1g / L of sodium sulfite, 2g / L of EDTA·Na2, 1mM of pyridoxal phosphate (PLP), and 20g / L (wet weight) of wet bacteria were added. The solvent was Tris-HCl buffer (50mM), and the pH was adjusted to 8.0 with hydrochloric acid. The reaction was carried out at a temperature of 15°C and a speed of 150rpm. The reaction process was carried out by substrate feeding, and the feeding was carried out every 2h. Among them, 5.7g / L of pyrogallol, 5g / L of sodium pyruvate, and 3.5g / L of ammonium acetate were fed each time, and two batches were fed. After the reaction was completed, 1mL of 1M HCl was added to terminate the reaction. After the reaction solution was filtered through a 0.22μm filter membrane, the filtrate was taken and the peak area of ​​pyrogallol and 3,4,5-TOPA was detected by high performance liquid chromatography ( Figure 3 ), the reduction of pyrogallol and the increase of 3,4,5-TOPA in the reaction system were obtained according to the standard curve, and the conversion rate and yield were calculated.

[0124] 3. High performance liquid chromatography and standard curve

[0125] Mobile phase: A:B = 9:1 (A: 0.02M KH2PO4-6M HCl, pH = 2.6; B: methanol); Chromatographic column:

[0126] C18 (Welchrom 4.6*250mm); detection wavelength 280nm; column temperature 34℃; injection volume 10μL; flow rate 1ml / min.

[0127] The pyrogallol and 3,4,5-TOPA standards were prepared with ultrapure water to appropriate concentrations, and the standard curves of concentration and peak area of ​​the substance were prepared using the above-mentioned liquid phase detection method. The pyrogallol standard curve was Y = 112.43X + 29.728, and the 3,4,5-TOPA standard curve was Y = 19.463X + 14.371.

[0128] 4. Results

[0129] Table 5 Detection results of TPL wet bacteria, T18L wet bacteria, and Y417N wet bacteria on substrate pyrogallol

[0130]

[0131] The results showed that the enzyme activity of T18L wet bacteria increased by 105.4%, the concentration of the target product reached 16.4 g / L, the conversion rate reached 99.8%, and the optical purity of 3,4,5-TOPA was greater than 99.9%.

[0132] The wet bacterial enzyme activity of Y417N increased by 16.3%, the target product concentration reached 15.2 g / L, the conversion rate reached 97.8%, and the 3,4,5-TOPA optical purity was greater than 99.9%.

[0133] TPL wet bacteria, the target product concentration reached 11.4g / L, the conversion rate reached 98.8%, and the 3,4,5-TOPA optical purity was greater than 99.9%.

[0134] Example 9: Synthesis of 3-fluoro-L-tyrosine catalyzed by wild-type and mutant TPL

[0135] The engineered bacteria E. coli BL21 (DE3) / pET-28b (+) -Fn-TPL-T18L (referred to as T18L wet bacteria), E. coli BL21 (DE3) / pET-28b (+) -Fn-TPL-Y417N (referred to as Y417N wet bacteria) and the starting strain E. coli BL21 (DE3) / pET-28b (+) -Fn-TPL wet bacteria (referred to as TPL wet bacteria) cells obtained by the method of Example 5 were used as catalysts to catalyze the synthesis of 3-fluoro-L-tyrosine from o-fluorophenol.

[0136] 1. Enzyme activity

[0137] In a 10mL reaction system, add 5g / L o-fluorophenol, 7g / L sodium pyruvate, 34.7g / L ammonium chloride, 1g / L sodium sulfite, 2g / L EDTA·Na2, 1mM pyridoxal phosphate (PLP), 2g / L wet bacteria (wet weight), the solvent is Tris-HCl buffer (50mM), and the pH is adjusted to 8.0 with hydrochloric acid; react for 10min at a temperature of 15°C and a speed of 150rpm. After the reaction is completed, add 10mL 1M HCl to terminate the reaction. After the reaction is terminated, the reaction solution is filtered through a 0.22μm filter membrane, and the filtrate is taken to detect the peak area of ​​3-fluoro-L-tyrosine by high performance liquid chromatography. The 3-fluoro-L-tyrosine content in the reaction system is obtained according to the standard curve, and the enzyme activity is calculated.

[0138] Enzyme activity definition: Under the above standard conditions, the amount of enzyme required to generate 1 μmol of 3-fluoro-L-tyrosine per minute is defined as one enzyme activity unit U.

[0139] 2. Fermentation process

[0140] In a 500mL reaction system, 5g / L of o-fluorophenol, 7g / L of sodium pyruvate, 77g / L of ammonium acetate, 1g / L of sodium sulfite, 2g / L of EDTA·Na2, 1mM of pyridoxal phosphate (PLP), and 20g / L (wet weight) of wet bacteria were added. The solvent was Tris-HCl buffer (50mM), and the pH was adjusted to 8.0 with hydrochloric acid. The reaction was carried out at a temperature of 15°C and a speed of 150rpm. The reaction process was carried out by substrate feeding, and the feeding was repeated every 2h, wherein 5g / L of o-fluorophenol, 5g / L of sodium pyruvate, and 3.5g / L of ammonium acetate were fed each time, and 3 batches of feeding were performed. After the reaction was completed, 1mL of 1M HCl was added to terminate the reaction. After the reaction solution was filtered through a 0.22μm filter membrane, the filtrate was taken and the peak area of ​​o-fluorophenol and 3-fluoro-L-tyrosine was detected by high performance liquid chromatography ( Figure 4 ), the contents of o-fluorophenol and 3-fluoro-L-tyrosine in the reaction system were obtained according to the standard curve, and the conversion rate and yield were calculated.

[0141] 3. High performance liquid chromatography and standard curve

[0142] Mobile phase: A:B = 9:1 (A: 0.02M KH2PO4-6M HCl, pH = 2.6; B: methanol); Chromatographic column:

[0143] C18 (Welchrom 4.6*250mm); detection wavelength 270nm; column temperature 34℃; injection volume 10μL; flow rate 1ml / min.

[0144] The o-fluorophenol and 3-fluoro-L-tyrosine standards were prepared with ultrapure water to appropriate concentrations, and the standard curve of concentration and peak area of ​​the substance was prepared using the above liquid phase detection method. The o-fluorophenol standard curve equation is: Y =

[0145] 831.59X-185.35, the standard curve of 3-fluoro-L-tyrosine is Y=700.72X-38.971.

[0146] 4. Results

[0147] Table 6 Detection results of TPL wet bacteria, T18L wet bacteria, and Y417N wet bacteria on substrate o-fluorophenol

[0148]

[0149] The results showed that the enzyme activity of T18L wet bacteria increased by 22.7%, the concentration of the target product reached 31.6 g / L, the conversion rate reached 93.5%, and the optical purity of 3-fluoro-L-tyrosine was greater than 99.9%.

[0150] The wet bacterial enzyme activity of Y417N increased by 185.0%, the target product concentration reached 33.1 g / L, the conversion rate reached 95.7%, and the optical purity of 3-fluoro-L-tyrosine was greater than 99.9%.

[0151] TPL wet bacteria, the target product concentration reached 29.8g / L, the conversion rate reached 89.2%, and the optical purity of 3-fluoro-L-tyrosine was greater than 99.9%.

[0152] Example 10: Synthesis of 2-fluoro-L-tyrosine catalyzed by wild-type and mutant TPL

[0153] The engineered bacteria E. coli BL21 (DE3) / pET-28b (+) -Fn-TPL-T18L (referred to as T18L wet bacteria), E. coli BL21 (DE3) / pET-28b (+) -Fn-TPL-Y417N (referred to as Y417N wet bacteria) and the starting strain E. coli BL21 (DE3) / pET-28b (+) -Fn-TPL wet bacteria (referred to as TPL wet bacteria) cells obtained by the method of Example 5 were used as catalysts to catalyze the synthesis of 2-fluoro-L-tyrosine from m-fluorophenol.

[0154] 1. Enzyme activity

[0155] In a 10mL reaction system, add 5g / L m-fluorophenol, 7g / L sodium pyruvate, 34.7g / L ammonium chloride, 1g / L sodium sulfite, 2g / L EDTA·Na2, 1mM pyridoxal phosphate (PLP), 2g / L wet bacteria (wet weight), the solvent is Tris-HCl buffer (50mM), and the pH is adjusted to 8.0 with ammonia water; react for 10min at a temperature of 15°C and a speed of 150rpm. After the reaction is completed, add 10mL 1M HCl to terminate the reaction. After the reaction solution is terminated, filter it with a 0.22μm filter membrane, take the filtrate and use high performance liquid chromatography to detect the peak area of ​​2-fluoro-L-tyrosine, obtain the 2-fluoro-L-tyrosine content in the reaction system according to the standard curve, and calculate the enzyme activity.

[0156] Enzyme activity definition: Under the above standard conditions, the amount of enzyme required to consume 1 μmol of m-fluorophenol per minute is defined as one enzyme activity unit U.

[0157] 2. Fermentation process

[0158] In a 500mL reaction system, 5g / L of m-fluorophenol, 7g / L of sodium pyruvate, 77g / L of ammonium acetate, 1g / L of sodium sulfite, 2g / L of EDTA·Na2, 1mM of pyridoxal phosphate (PLP), 20g / L of wet bacteria (wet weight) were added, the solvent was Tris-HCl buffer (50mM), and the pH was adjusted to 8.0 with hydrochloric acid; the reaction was carried out at a temperature of 15°C and a speed of 150rpm. The reaction process was carried out by substrate feeding, and the feeding was repeated every 2h, wherein m-fluorophenol was fed 5g / L each time, sodium pyruvate was fed 5g / L each time, and ammonium acetate was fed 3.5g / L each time, and 3 batches of feeding were performed. After the reaction was completed, 1mL of 1M HCl was added to terminate the reaction. After the reaction solution was filtered through a 0.22μm filter membrane, the filtrate was taken and the peak area of ​​m-fluorophenol and 2-fluoro-L-tyrosine was detected by high performance liquid chromatography ( Figure 5 ), the contents of fluorophenol and 2-fluoro-L-tyrosine in the reaction system were obtained according to the standard curve, and the conversion rate and yield were calculated.

[0159] 3. High performance liquid chromatography and standard curve

[0160] Mobile phase: A:B = 9:1 (A: 0.02M KH2PO4-6M HCl, pH = 2.6; B: methanol); Chromatographic column:

[0161] C18 (Welchrom 4.6*250mm); detection wavelength 270nm; column temperature 34℃; injection volume 10μL; flow rate 1ml / min.

[0162] The m-fluorophenol and 2-fluoro-L-tyrosine standards were prepared with ultrapure water to appropriate concentrations, and the standard curve of concentration and peak area of ​​the substance was prepared using the above-mentioned liquid phase detection method. The m-fluorophenol standard curve is Y =

[0163] 373.63X+965.33, the standard curve of 2-fluoro-L-tyrosine is Y=244.82X-1481.2.

[0164] 4. Results

[0165] Table 7 Detection results of TPL wet bacteria, T18L wet bacteria, and Y417N wet bacteria on substrate m-fluorophenol

[0166]

[0167]

[0168] The results showed that the enzyme activity of T18L wet bacteria increased by 118.0%, the concentration of the target product reached 14.3 g / L, the conversion rate reached 45.8%, and the optical purity of 2-fluoro-L-tyrosine was greater than 99.9%.

[0169] The wet bacterial cell enzyme activity of Y417N increased by 560.6%, the target product concentration reached 20.5 g / L, the conversion rate reached 61.9%, and the optical purity of the produced 2-fluoro-L-tyrosine was greater than 99.9%.

[0170] TPL wet bacteria, the target product concentration reached 8.2g / L, the conversion rate reached 27.8%, and the optical purity of 2-fluoro-L-tyrosine was greater than 99.9%.

[0171] The present invention is not limited by the above specific textual description. The present invention can be modified in various ways within the scope of the claims, and these modifications are within the scope of the present invention.

Claims

1. A tyrosine phenol lyase mutant, which is obtained by single or multiple mutations at position 18 or position 417 of the amino acid sequence shown in SEQ ID NO.

2.

2. The tyrosine phenol lyase mutant according to claim 1, It is characterized in that The tyrosine phenol lyase mutant is obtained by mutating the threonine at position 18 of the amino acid sequence shown in SEQ ID NO.2 to leucine or mutating the tyrosine at position 417 to asparagine.

3. A recombinant genetically engineered bacterium constructed with the gene encoding the tyrosine phenol lyase mutant according to claim 1.

4. Use of the tyrosine phenol lyase mutant according to claim 1 in synthesizing L-tyrosine derivatives.

5. The use according to claim 4, It is characterized in that The application method comprises: using wet bacteria obtained by fermentation culture of an engineered bacterium containing a gene encoding a tyrosine phenol lyase mutant as a catalyst, using a phenol derivative (I), sodium pyruvate and ammonium acetate as substrates, and using sodium sulfite and EDTA·Na 2 As an auxiliary agent, pyridoxal phosphate is used as a coenzyme, and a buffer solution with a pH of 6.0 to 10.5 is used as a reaction medium to form a conversion system, and the conversion reaction is carried out at a temperature of 5 to 30°C and a rotation speed of 100 to 200 rpm. After the reaction is completed, the reaction solution is separated and purified to obtain an L-tyrosine derivative (II); In formula (Ⅰ), R is monosubstituted or polysubstituted, and R is H, 2-hydroxy, 2,3-dihydroxy, 2-F, or 3-F; in formula (Ⅱ), R is the same as R in formula (Ⅰ).

6. The use according to claim 5, It is characterized in that The phenol derivative is one of phenol, catechol, pyrogallol, o-fluorophenol and m-fluorophenol.

7. The use according to claim 5, It is characterized in that In the transformation system, phenol derivatives are added to a final concentration of 4 to 50 g / L, sodium pyruvate is added to a final concentration of 5 to 50 g / L, ammonium acetate is added to a final concentration of 7.7 to 108 g / L, sodium sulfite is added to a final concentration of 0.5 to 10 g / L, and EDTA·Na 2 The final concentration is 0.5-10 g / L, the final concentration of pyridoxal phosphate is 0.05-5 mM, and the amount of wet bacteria is 2-50 g / L.

8. The use according to claim 5, It is characterized in that When the phenol derivative is catechol, the final concentration is 5-50 g / L; when the phenol derivative is phenol, the final concentration is 4-40 g / L; when the phenol derivative is pyrogallol, the final concentration is 5-50 g / L; when the phenol derivative is o-fluorobenzene, the final concentration is 5-50 g / L; when the phenol derivative is m-fluorophenol, the final concentration is 5-50 g / L.

9. The use according to claim 5, It is characterized in that During the conversion reaction, phenol derivatives, sodium pyruvate and ammonium acetate are supplemented every 0.5 to 4 hours, wherein 0.1 to 10 g / L of phenol derivatives, 0.1 to 10 g / L of sodium pyruvate and 1 to 20 g / L of ammonium acetate are supplemented each time.

10. The use according to claim 5, It is characterized in that The catalyst is prepared as follows: (1) Slant culture: The engineered bacteria containing the gene encoding the tyrosine phenol lyase mutant were inoculated into a slant culture medium containing 50 μg / mL kanamycin, and cultured at 37°C for 8 to 16 hours to obtain slant bacteria; the final concentration of the slant culture medium was: 10 g / L peptone, 5 g / L yeast powder, 10 g / L sodium chloride, 20 g / L agar, the solvent was distilled water, pH 7.0; (2) Seed culture: The slant bacteria were inoculated into a seed culture medium containing 50 μg / mL kanamycin and cultured at 37°C for 8 to 10 h to obtain a seed solution; the final concentration of the seed culture medium was: peptone 10 g / L, yeast powder 5 g / L, sodium chloride 10 g / L, the solvent was distilled water, pH 7.0; (3) Fermentation culture: The seed solution was inoculated at a volume concentration of 2% into a sterile 5 L mechanical stirring and ventilated general fermenter containing 3 L of fermentation medium. Sterilized lactose was directly added to the fermenter at a final concentration of 15 g / L. The fermentation was carried out at 28°C, a stirring speed of 300 rpm, and a ventilation volume of 5 m 3 / h, pH controlled at 5.5, after induction culture for 6-8h, the tank was released and the wet bacteria were collected; the final concentration of the fermentation medium was composed of: peptone 25g / L, yeast powder 6.55g / L, NaCl 10g / L, sucrose 9.1g / L, pyridoxal phosphate (PLP) 0.05mM, MgSO 4 5mM, KH 2 PO 4 10mM, solvent is distilled water, pH is natural.

Images