Method and kit for extracting RNA (Ribonucleic Acid) from formaldehyde-fixed biological tissue

Abstract

The invention discloses a method for extracting RNA (Ribonucleic Acid) from formaldehyde-fixed biological tissues, which is characterized by comprising the following steps: step 1, taking out 25mg of tissues from formaldehyde, and chopping; 2, adding an EP tube (2 ml contains 4 magnetic beads), and covering with a cover; 3, 150 microliters or 240 microliters of buffer solution PKD is added, and vortex mixing is carried out; step 4, centrifuging at the speed of 10000 rpm for 1 min; and 5, adding 10 microliters of protease K, and uniformly mixing. The invention provides a simple, reliable and rapid method, high-quality total RNA can be separated from a formalin-immobilized paraffin embedded (FFPE) tissue specimen, the method is used for retrospective basis and clinical biological research of gene expression, and a toxic organic solvent is not needed for dewaxing.

Description

Technical Field

[0001] The invention relates to the technical field of biomedicine, and in particular to a method for extracting RNA from formaldehyde-fixed biological tissue and a kit thereof. Background Art

[0002] Next-generation sequencing (NGS) can provide in-depth analysis of short sequences, making it a powerful tool for use with nucleic acids isolated from formalin-fixed paraffin-embedded (FFPE) tissues. Currently, formalin-fixed, paraffin-embedded tissues obtained from pathology departments are available for RNA expression analysis.

[0003] FFPE (Formalin-fixed paraffin-embedding) is a tissue or cell preservation technique that uses formalin to fix tissues or cells and then embeds them in paraffin. The formaldehyde in formalin can bind to the amino groups of proteins, causing the proteins to coagulate and denature, thus maintaining the integrity of the tissue cell structure. The samples processed by FFPE technology are called FFPE samples, which are also called paraffin sections because they are cut into thin slices when actually used.

[0004] This technology has long been widely used in clinical testing and medical scientific research, especially in cell morphology research and tumor pathology research, such as HE staining, immunohistochemistry and fluorescence in situ hybridization. With the development of molecular biology, there is an increasing demand for the application of FFPE samples in molecular diagnosis and research. At present, in NGS medical testing centers, except for blood samples, almost all tissue samples received are FFPE samples such as wax blocks, white films, and wax rolls. In order to ensure the accuracy and authenticity of NGS experimental data, it is very important to purify high-quality nucleic acids from FFPE samples.

[0005] When we go through the whole process of using a kit to extract RNA from formalin or paraffin-fixed tissues, we find that the yield is very low, usually around 10 to 30, and cannot be used for subsequent experiments. However, we have recently discovered that if we no longer use the reagents and contents of the kit after a certain step and completely replace them with other reagents, the yield can be increased by dozens of times. In other words, with this method, we only need to change some of the reagents in the kit and then combine them with other reagents, and the cost-effectiveness will be significantly improved. Summary of the invention

[0006] The object of the present invention is to provide a method for extracting RNA from formaldehyde-fixed biological tissue and a kit thereof.

[0007] To achieve the above object, the present invention adopts the following technical solutions:

[0008] A method for extracting RNA from formaldehyde-fixed biological tissue comprises the following steps:

[0009] Step 1: Remove the tissue from formaldehyde and mince;

[0010] Step 2: Add the EP tube and cover it with a lid;

[0011] Step 3: Add buffer PKD and mix by vortexing;

[0012] Step 4: Centrifuge at 10,000 rpm for 1 min;

[0013] Step 5: Add proteinase K and mix well;

[0014] Step 6: Incubate for 15 min, then incubate at 80°C for 15 min. If using a heating block without a shaking function, vortex briefly every 3-5 min to mix.

[0015] Step 7: Incubate on ice for 3 minutes;

[0016] Step 8: Add DNase Booster Buffer and 10 μl DNase I stock solution, invert to mix, centrifuge, and collect all the liquid at the bottom of the tube;

[0017] Step 9: Incubate at room temperature for 15 minutes;

[0018] Step 10: Extract total RNA from biological tissues.

[0019] Step 10 is to extract total RNA from biological tissues using the trizol method.

[0020] Alternatively, the step 10 comprises the following steps:

[0021] Add RNAex, homogenize in a homogenizer, and let stand for 5 minutes;

[0022] Centrifuge at 12000 rpm, 4°C, 5 min, transfer the supernatant to a new EP tube, add chloroform, mix thoroughly, and let stand at room temperature;

[0023] After centrifugation, carefully remove the EP tube.

[0024] The supernatant was transferred to a new EP tube.

[0025] Add isopropanol, mix thoroughly, and let stand at room temperature;

[0026] Centrifuge and discard the supernatant;

[0027] Add 80% ethanol to clean the RNA sediment and the wall of the centrifuge tube, and discard the supernatant.

[0028] Open the centrifuge tube and dry it at room temperature for 5 to 10 minutes.

[0029] Add RNase-free water to dissolve RNA and store at -80℃ for later use.

[0030] A kit for extracting RNA from formaldehyde-fixed biological tissues comprises RNAex solution, chloroform solution, isopropanol solution, ethanol and RNase-free water.

[0031] Used for RNA extraction.

[0032] Compared with the prior art, the present invention has the following beneficial effects:

[0033] The present invention provides a simple, reliable and rapid method for isolating high-quality total RNA from formalin-fixed paraffin-embedded (FFPE) tissue specimens for retrospective basic and clinical biological studies of gene expression without the need for dewaxing using toxic organic solvents.

[0034] The present invention can isolate RNA, maximize yield and minimize degradation, and the purified total RNA is suitable for use with a variety of downstream applications and products. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 Set up the diagram for startup.

[0036] Figure 2 This is a layout diagram for sample addition.

[0037] Figure 3 This is one of the on-machine inspection condition diagrams.

[0038] Figure 4 This is the second diagram of the on-machine testing conditions.

[0039] Figure 5 This is one of the test result graphs.

[0040] Figure 6 This is the second picture of the test results. DETAILED DESCRIPTION

[0041] The technical solution of the present invention will be clearly and completely described below in conjunction with the accompanying drawings of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0042] Example 1.

[0043] A method for extracting RNA from formaldehyde-fixed biological tissue comprises the following steps:

[0044] Step 1: Remove 25 mg of tissue from formaldehyde and mince;

[0045] Step 2: Add EP tube (2 ml containing 4 magnetic beads) and cover with lid;

[0046] Step 3: Add 150 μl or 240 μl of buffer PKD and mix by vortexing;

[0047] Step 4: Centrifuge at 10,000 rpm for 1 min;

[0048] Step 5: Add 10 μl of proteinase K and mix well;

[0049] Step 6: Incubate at 56°C for 15 min, then at 80°C for 15 min;

[0050] If using a heating block without shaking function, vortex briefly to mix every 3-5 minutes;

[0051] If only one heating block is used, leave the samples at room temperature after incubation at 56°C until the heating block reaches 80°C;

[0052] Step 7: Incubate on ice for 3 minutes;

[0053] Step 8: Add DNase Booster Buffer (1 / 10 volume of sample) (approximately 16 μl or 25 ul) and 10 μl DNase I stock solution, invert to mix, centrifuge, and collect all the liquid at the bottom of the tube;

[0054] Step 9: Incubate at room temperature for 15 minutes;

[0055] Step 10: Extract total RNA from biological tissues.

[0056] The step 10 is to extract total RNA from biological tissues using the trizol method.

[0057] Example 2.

[0058] The step 10 comprises the following steps:

[0059] Add 1 ml of RNAex, homogenize in a homogenizer (SERVICEBIO), and let stand for 5 min;

[0060] Centrifuge at 12000 rpm, 4°C, 5 min, transfer the supernatant to a new 1.5 ml EP tube, add 200 ul chloroform (1 / 5 RNAex volume), mix thoroughly, and let stand at room temperature for 5 min;

[0061] After centrifugation at 12000rpm and 4℃ for 15min, carefully remove the EP tube.

[0062] Pipette the supernatant and transfer it to a new 1.5 ml EP tube;

[0063] Add 500ul isopropanol (1 / 2 times the volume of RNAex), mix thoroughly, and let stand at room temperature for 10min; centrifuge at 12000rpm at 4℃ for 10min, and discard the supernatant;

[0064] Add 1 ml of 80% ethanol (precooled at -20°C, equal volume to RNAex) to clean the RNA deposit and the wall of the centrifuge tube, incubate at 7500 rpm at 4°C for 5 min, and discard the supernatant.

[0065] Open the centrifuge tube and dry it at room temperature for 5 to 10 minutes.

[0066] Add 30ul of RNase-free water to dissolve RNA and store at -80℃ for later use.

[0067] Example 3.

[0068] A kit for extracting RNA from formaldehyde-fixed biological tissues comprises RNAex solution, chloroform solution, isopropanol solution, ethanol and RNase-free water.

[0069] Used for RNA extraction.

[0070] RNA reverse transcription

[0071] 1. Start RNA reverse transcription. The sample mass for this experiment is set at 500ng

[0072] Total volume 10ul Reagents (5×EvoM-MLVRTMasterMix) 2ul RNA+DEPC water 8ul

[0073] 2. Calculate the required stock solution volume (ul) for 500ng RNA, as shown in the following table:

[0074]

[0075]

[0076]

[0077]

[0078] 3. On the machine: Set as follows:

[0079] step Temp Time Step 1 37℃ 15min(reaction time) Step 2 85℃ 5sec (reverse transcriptase inactivation) Step 3 4℃ Storage (equivalent to 4℃ refrigerator)

[0080] 4. Take out, add 40ul DEPC water to dilute, and store at -20℃ for later use

[0081] PCR verification of IL-6 expression in rat gastric tissue (with β-actin as internal reference)

[0082] 1. Take out the sample and thaw it in advance.

[0083] 2. Dilute the primers to 10× solution according to the instructions. The required amount of TE buffer can be found in the column (To make 100uM stock, add TE buffer (ul)) for easy storage in a -20℃ refrigerator. If there is no primer instruction, dilute it to 1× solution according to the instructions on the primer bottle. The required amount of TE buffer (ul) = OD×nm / OD×100

[0084] The primer sequences are:

[0085] TNF-αID:21926

[0086] mtnfaf:CCCTCCAGAAAAGACACCATG

[0087] mtnfar:CACCCCGAAGTTCAGTAGACAG

[0088] 183bp

[0089] IL6 ID:16193

[0090] mIL6F AAATGATGGATGCTACCAAACTG

[0091] mIL6R CTCTGGCTTTGTTCTTTCTTGTTATC

[0092] 137bp

[0093] IL-1βID:16176

[0094] mIL-1βF GCTTCAGGCAGGCAGTATCA

[0095] mIL-1βR TGCAGTTGTCTAATGGGAACG

[0096] 196bp

[0097] 3. Configure MIX as shown in the following table:

[0098]

[0099] After mixing, centrifuge briefly (1-2s).

[0100] 4. Add sample (MIX 18ul / well → Sample 2ul / well), layout as follows Figure 2 :

[0101] Apply film → mix → centrifuge for about 25 seconds.

[0102] 5. The conditions for testing on the machine are as follows: Figure 3-4 .

[0103] 6. The results are as follows Figure 5-6 .

[0104] The test results of the traditional kit method are shown in the following table.

[0105]

[0106]

[0107] The test results using the improved method of the present invention are shown in the following table.

[0108]

[0109]

[0110]

[0111]

[0112] The above shows and describes the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The above embodiments and descriptions are only preferred examples of the invention and are not intended to limit the present invention. Without departing from the novel spirit and scope of the present invention, the present invention may have various changes and improvements, which fall within the scope of the present invention to be protected. The scope of protection of the present invention is defined by the attached claims and their equivalents.

Claims

1. A method for extracting RNA from formaldehyde-fixed biological tissue, characterized in that The steps include: Step 1: Remove 25 mg of tissue from formaldehyde and mince; Step 2: Add EP tube (2 ml containing 4 magnetic beads) and cover with lid; Step 3: Add 150 μl or 240 μl of buffer PKD and mix by vortexing; Step 4: Centrifuge at 10,000 rpm for 1 min; Step 5: Add 10 μl of proteinase K and mix well; Step 6: Incubate at 56°C for 15 min, then at 80°C for 15 min. If using a heating block without shaking, vortex briefly every 3-5 min to mix. If only one heating block is used, leave the samples at room temperature after incubation at 56°C until the heating block reaches 80°C; Step 7: Incubate on ice for 3 minutes; Step 8: Add DNase Booster Buffer (1 / 10 volume of sample) (approximately 16 μl or 25 ul) and 10 μl DNase I stock solution, invert to mix, centrifuge, and collect all the liquid at the bottom of the tube; Step 9: Incubate at room temperature for 15 minutes; Step 10: Extract total RNA from biological tissues.

2. The use according to claim 1, characterized in that The step 10 is to extract total RNA from biological tissues using the trizol method.

3. The use according to claim 1, characterized in that The step 10 comprises the following steps: Add 1 ml of RNAex, homogenize in a homogenizer (SERVICEBIO), and let stand for 5 min; Centrifuge at 12000 rpm, 4°C, 5 min, transfer the supernatant to a new 1.5 ml EP tube, add 200 ul chloroform (1 / 5 RNAex volume), mix well, and let stand at room temperature for 5 min; After centrifugation at 12000 rpm and 4°C for 15 min, carefully remove the EP tube; Pipette the supernatant and transfer it to a new 1.5 ml EP tube; Add 500ul isopropanol (1 / 2 times the volume of RNAex), mix thoroughly, and let stand at room temperature for 10min; centrifuge at 12000rpm at 4℃ for 10min, and discard the supernatant; Add 1 ml of 80% ethanol (precooled at -20°C, equal volume to RNAex) to clean the RNA deposit and the wall of the centrifuge tube, incubate at 7500 rpm at 4°C for 5 min, and discard the supernatant. Open the centrifuge tube and dry it at room temperature for 5 to 10 minutes; Add 30ul of RNase-free water to dissolve RNA and store at -80℃ for later use.

4. A kit for extracting RNA from formaldehyde-fixed biological tissue, characterized in that Includes RNAex solution, chloroform solution, isopropanol solution, ethanol, and RNase-free water.

5. The kit according to claim 4, characterized in that Used for RNA extraction as described in claim 1.

Images