Method for constructing miR-504 gene knockout Chinese hamster model based on CRISPR / Cas9 and application of miR-504 gene knockout Chinese hamster model

Abstract

The invention belongs to the field of gene editing, particularly discloses a method for constructing a miR-504 gene knockout Chinese hamster model based on CRISPR / Cas9 and application of the method, provides a unique PMSG fractional injection and LHRH superovulation scheme suitable for Chinese hamsters, and can stably and efficiently obtain Chinese hamster fertilized eggs. A double sgRNA combination aiming at targeted knockout of the miR-504 gene of the Chinese hamster is provided, so that the gene editing efficiency is improved; a red light embryo operation and micro-injection operation system and a 37.5 DEG C cold light avoiding environment are provided to be suitable for in-vitro culture and micro-injection of the fertilized eggs of the Chinese hamster, and the activity of the fertilized eggs of the Chinese hamster and the survival rate of the fertilized eggs after injection can be improved. In a word, the invention provides a gene editing animal model platform suitable for the specific experimental animal resource of the Chinese hamster, the gene editing Chinese hamster animal model can be efficiently prepared, and a new thought and platform are provided for researching the pathogenesis and the disease progression mechanism of human diseases from the gene level.

Description

Technical Field

[0001] The present invention belongs to the field of gene editing, and specifically discloses a method for constructing a miR-504 gene knockout Chinese hamster model based on CRISPR / Cas9 and an application thereof. Background Art

[0002] As a unique mouse species in my country, the Chinese hamster is one of the important experimental animals in the field of biomedicine. Since the Chinese hamster was introduced into the laboratory for medical research, it has been gradually understood that it is highly sensitive to certain bacteria, viruses, protozoa, etc., and it has been increasingly valued by the medical community. The Chinese hamster has a pair of cheek pouches that are easy to turn out. The cheek pouches lack glands and complete lymphatic pathways and belong to the natural immune deficiency area. The cheek pouch is a good area for tissue culture, human tumor transplantation and observation of microcirculatory changes. The xenograft tumor model prepared using the hamster cheek pouch can show histological characteristics similar to human primary tumors, which is impossible for mice. The Chinese hamster has spontaneous hereditary diabetes through inbreeding, which is an ideal experimental animal model for studying diabetes. In recent years, the use of hamsters to prepare tumor models has been widely used in preclinical research, which can better simulate the occurrence and development of human cancer and reproduce the heterogeneity of the human cancer genome and the complexity of its microenvironment. Domestic and foreign scholars have used the special biological characteristics of Chinese hamsters to establish a variety of animal models of human diseases, including tumors, spontaneous type 2 diabetes, lipid metabolism, and viral, microbial, and parasitic infections. In particular, a Chinese hamster oral mucosal cancer model was prepared by DMBA chemical induction. Compared with the mouse oral cancer model, this model can continuously simulate human oral cancer from precancerous to malignant lesions, providing a good platform for in vivo studies of oral cancer. At present, transgenic or gene knockout / knock-in animal models have not been established for Chinese hamsters, which limits the further application of Chinese hamsters in biomedical research. Therefore, it is crucial to establish an effective Chinese hamster genome editing platform.

[0003] The establishment of the Chinese hamster gene editing animal model encountered the following difficulties:

[0004] 1. The body shape and weight of Chinese hamsters are similar to those of mice, but the existing superovulation procedures for mice are not suitable for Chinese hamsters. For Chinese hamsters, the effects of 5 / 7.5 / 10IU doses of PMSG on follicular development and corpus luteum formation induced by PMSG are not obvious. Therefore, when using this hormone for superovulation of Chinese hamsters, the choice of hormone dosage and injection time still needs to be explored. The effect of 5 / 7.5 / 10IU doses of HCG in promoting the discharge of mature oocytes from mature follicles in Chinese hamsters is not good, and there are many unruptured follicles in the ovaries. Therefore, the choice of hormone to promote the rupture and ovulation of mature follicles in Chinese hamsters still needs to be explored.

[0005] 2. In vitro embryo culture is a process that simulates embryo development in the mother's body under laboratory conditions. The fertilized eggs of Chinese hamsters are extremely sensitive to visible light, and the light they receive seriously affects their normal development. Suitable temperature is also a key factor affecting the normal development of fertilized eggs. Due to the unique physiological characteristics of Chinese hamster embryonic development, the mature in vitro embryo culture conditions of mice and rats are not suitable for Chinese hamsters. To explore the in vitro embryo culture conditions suitable for Chinese hamsters, it is necessary to strictly control light, temperature and other conditions.

[0006] 3. miRNA involves many target molecules and regulatory mechanisms in different cells and tissues and organs, but the exact mechanism of its regulation of cell development and tissue and organ function still needs to be clarified by a lot of research. The miRNA gene knockout animal model provides an important tool for understanding the function and mechanism of miRNA. Nowadays, the emergence of CRISPR / Cas9 technology has greatly improved the efficiency of miRNA gene knockout animal models. However, the efficiency of conventional single sgRNA targeted knockout of target miRNA gene editing is low, and the sgRNA design scheme needs to be improved in order to efficiently obtain miRNA gene knockout animal models.

[0007] 4. Chinese hamsters are highly similar to humans in anatomy, physiology, immunology and pathology, and play an important role in research fields such as medicine, genetics and biopharmaceuticals. With the deepening of research, the unique biological characteristics of Chinese hamsters have gradually been revealed, and many Chinese hamster disease animal models have been established. At present, Chinese hamsters have been widely used in molecular biology and are also indispensable experimental animals in the field of medical research, but their application level is far lower than that of commonly used experimental animals such as mice and rats. The gene editing platform developed based on Chinese hamsters has not yet been established, which has set up obstacles for using Chinese hamsters to study diseases at the genetic level, and has seriously restricted the diversified development of my country's characteristic experimental animals. At present, the basic research on Chinese hamsters is not deep and complete, and the development is incomplete, which has caused a waste of characteristic animal resources and cannot fully meet the needs of scientific researchers. It is not conducive to the overall experimental animal industry, the development of basic medicine and even clinical treatment research. Researchers should reasonably develop and utilize the precious experimental animal resources of Chinese hamsters so that this experimental animal resource with research value can be protected, developed and widely used. Summary of the invention

[0008] In order to solve the above technical problems, the present invention discloses a method for constructing a miR-504 gene knockout Chinese hamster model based on CRISPR / Cas9 and its application.

[0009] The technical solution of the present invention is as follows:

[0010] The present invention discloses four groups of dual sgRNA compositions, including sgRNAs with the following sequences:

[0011] sgRNA1=SEQ ID No.1=CTGACACAGAATGACTTCAAAGG;

[0012] sgRNA2=SEQ ID No.2=ATGCTGCTGTTGGGAGACCC TGG;

[0013] sgRNA3=SEQ ID No.3=GGCAGGGTTTCCCATACAGG AGG;

[0014] sgRNA4=SEQ ID No. 4=GTAGCCTGTGCCTCCTGTAT GGG.

[0015] In this protocol, sgRNA was designed for the pre-miR-504 sequence, and four sets of double sgRNA combinations (g1+g3, g1+g4, g2+g3, g2+g4) were designed based on the comprehensive score, off-target score and target position. For each set of sgRNA, an in vitro transcription template was designed and synthesized, and in vitro transcription was performed using the HiScribe T7 Quick High Yield RNA Synthesis Kit (NEB E2050). The sgRNA was purified and recovered, mixed with the Cas9 protein into an RNP form microfluid, and stored at -80°C for later use.

[0016] Furthermore, the present invention discloses the use of the above-mentioned dual sgRNA composition in knocking out the Chinese hamster miR-504 gene.

[0017] Furthermore, the present invention also discloses a gene knockout reagent, comprising the dual sgRNA composition as claimed in claim 1.

[0018] Furthermore, the present invention also discloses a method for constructing a miR-504 gene knockout Chinese hamster model based on CRISPR / Cas9, wherein the method comprises using the above-mentioned dual sgRNA composition.

[0019] Furthermore, the above-mentioned method for constructing a miR-504 gene knockout Chinese hamster model based on CRISPR / Cas9 comprises the following steps:

[0020] 1) Design and synthesis of dual sgRNA compositions;

[0021] 2) Superovulation and egg retrieval of Chinese hamsters;

[0022] 3) Microinjection of fertilized eggs;

[0023] 4) Embryo transfer;

[0024] 5) Identification of F0 generation gene knockout Chinese hamsters.

[0025] Furthermore, the above-mentioned method for constructing a miR-504 gene knockout Chinese hamster model based on CRISPR / Cas9,

[0026] The step 2) comprises the following specific steps:

[0027] Select 6-week-old female Chinese hamsters and inject 15 IU PMSG intraperitoneally at 16:00 on Day 1, 15 IU PMSG intraperitoneally at 9:00 on Day 4, and 0.6 μg LHRH intraperitoneally at 16:00 for superovulation. Immediately after hormone injection, they were caged with male mice. From 7:00 to 9:00 on Day 5, check the thrombus, remove the oviduct at 13:00, and remove the oviduct with enlarged ampulla in DPBS buffer containing calcium and magnesium ions. After the Chinese hamster oviduct was separated from the mother, turn off the ambient lighting and use a special red light stereo microscope for subsequent operations. The ampulla was torn open in 0.1% hyaluronidase, and after digestion, it was placed in embryo washing solution (DPBS buffer containing calcium and magnesium ions containing 5% fetal bovine serum) to wash until it becomes a single fertilized egg. The fertilized eggs were grouped and placed in M2 culture droplets in groups of 15 and then transferred to 5% CO 2 , and culture briefly in a 37°C incubator for 20 min in preparation for microinjection.

[0028] The concentration of the superovulation hormone PMSG solution is 0.1IU / μL, and the injection dose is 150μL / mouse; the concentration of the LHRH solution is 0.004μg / μL, and the injection dose is 150μL / mouse.

[0029] Furthermore, in the above-mentioned method for constructing a miR-504 gene knockout Chinese hamster model based on CRISPR / Cas9, the step 3) comprises the following specific steps:

[0030] Before injection, prepare the injection chamber, micromanipulation needle (injection needle, egg holding needle), and long glass sample needle. Use the long glass sample needle to mix sgRNA and Cas9 protein into the microinjection solution and fill the injection needle tip 1 cm; insert the egg holding needle and the injection needle with injection solution into the needle holder filled with paraffin oil respectively, tighten the knob and install it on the micromanipulator; adjust the egg holding needle and injection needle tips in the mineral oil outside the injection chamber until they are clear; adjust the injection solution flow rate in the injection needle by adjusting the coarse / fine sample knob in combination with knocking the needle until the microinjection solution at the injection needle tip can flow out stably, and control the injection solution flow rate to an injection dose of 3-10pL per fertilized egg; use a special red light microinjection system to select fertilized eggs with full cells, clear zona pellucida, and clearly visible double pronuclei under red light for injection. After the injection, remove the dead fertilized eggs, select fertilized eggs with full cells and clear zona pellucida, and transfer them to M2 droplets in groups of 15 for transplantation.

[0031] Furthermore, in the above-mentioned method for constructing a miR-504 gene knockout Chinese hamster model based on CRISPR / Cas9, the step 4) comprises the following specific steps:

[0032] From the surrogate mice with a weight of 25-35g, one litter and good maternal instinct, female mice in estrus were selected by vulvar observation and vaginal smear, mated with ligated male mice, and female mice with positive vaginal plug were selected for transplantation. During the microinjection of fertilized eggs, the surrogate female mice were anesthetized simultaneously. Under a stereomicroscope, an opening was made from the back parallel to the spine 1 cm above the thigh root, the fallopian tube was pulled out, and the fat pad was clamped with a hemostatic clamp to fix the fallopian tube. Prepare the transplant tube, inhale 1.5cm M2 culture medium, followed by 5 small bubbles to relieve the siphon effect, then inhale 10 to 15 fertilized eggs and control them within a 1cm liquid column, and finally inhale a small bubble and a small amount of culture medium. The total liquid level cannot exceed the constriction of the transplant tube. Avoid blood vessels and tear open the ovarian sac filled with liquid. Clamp the umbrella of the fallopian tube with microtweezers, insert the transplant needle, blow the fertilized egg and bubbles into it, and the transplantation is successful when bubbles are seen in the fallopian tube. The tissue was then returned to the body cavity and sutured, and each surrogate mother was housed in a single cage.

[0033] Furthermore, in the above-mentioned method for constructing a miR-504 gene knockout Chinese hamster model based on CRISPR / Cas9, the step 5) comprises the following steps:

[0034] The tails of the F0 generation mice were cut, genomic DNA was extracted, and genotypes were identified by PCR amplification. Agarose gel electrophoresis and Sanger sequencing were performed to clarify the changes in the gene sequence of the gene-edited F0 generation Chinese hamsters. After positive mice were identified, they were bred and the lines were established.

[0035] Furthermore, in the above-mentioned method for constructing a miR-504 gene knockout Chinese hamster model based on CRISPR / Cas9, the primers used for PCR amplification in step 5) include:

[0036] F:5′-CTGACCTCAGGCCAATATGTAG-3′=SEQ ID No.5

[0037] R: 5′-GGGTTGTAGGTAAGAGAGAAAG-3′=SEQ ID No. 6.

[0038] Furthermore, the present invention also discloses the use of the above method or the Chinese hamster model prepared thereby in the development of anti-tumor drugs.

[0039] The present invention has the following beneficial effects:

[0040] First, the present invention solves the following problems 1-5:

[0041] 1. The superovulation procedure of Chinese hamsters is immature and standardized. Mammalian embryo bioengineering, as a branch of animal cell engineering research, has developed very rapidly. This research requires a large number of eggs, one of the sources of which is obtained by superovulation technology. The commonly used PMSG+HCG superovulation program for mice is not suitable for Chinese hamsters, whether in terms of hormone type selection, injection dose or injection time. The present invention can improve the number and quality of ovulation and efficiently obtain the required number of high-quality fertilized eggs by formulating a unique superovulation program suitable for Chinese hamsters. The physiological characteristics and hormonal responses of different rodent models may differ, so technical adjustments and optimizations need to be made according to the characteristics of different models. The present invention standardizes the superovulation program of Chinese hamsters, which has good stability and repeatability, and improves the reliability and consistency of experimental results.

[0042] 2. The in vitro culture conditions for Chinese hamster embryos are not yet mature, and there is no culture medium and culture conditions specifically for Chinese hamster in vitro embryo culture. The mature in vitro embryo culture conditions for mice are not suitable for Chinese hamsters because Chinese hamster embryos are extremely sensitive to visible light and temperature fluctuations. The present invention, by formulating a set of unique in vitro embryo operation procedures suitable for Chinese hamsters, can make embryos survive and maintain high vitality under in vitro conditions, laying a foundation for the study of embryo engineering and reproductive biology of Chinese hamsters.

[0043] 3. The present invention solves the problem of low efficiency of the current miRNA gene knockout Chinese hamster model. According to the maturation mechanism of miRNA, dual sgRNAs are designed to target and knock out miRNA precursor sequences and seed sequences, and sgRNA+Cas 9 protein complex (RNP) injection is used to effectively improve gene editing efficiency.

[0044] 4. The present invention enriches the current miR-504 gene editing animal model. The role of miR-504 in the occurrence and development of tumors is very complex. It can act as both a carcinogenic factor and a tumor suppressor factor. The present invention provides a method and application for constructing a miR-504 gene knockout Chinese hamster model, which can supplement the current mouse model, has the potential to simulate a variety of human diseases related to miR-504, can deeply study the pathogenesis of the disease, and provides an important basis for drug development and clinical trials. The present invention provides an effective animal model for studying the mechanism of action of miR-504 in different diseases, and further promotes the application of Chinese hamsters in biomedical research.

[0045] 5. Chinese hamsters are characteristic experimental animal resources with research value in my country. They play an important role in research fields such as medicine, genetics and biopharmaceuticals. There are many disease animal models prepared based on Chinese hamsters, which are widely used in diabetes, lipid metabolism and tumor research. However, an efficient and feasible gene editing platform for Chinese hamster animal models has not yet been developed, which has greatly affected the deeper research, promotion and application of Chinese hamster characteristic experimental animal resources. The present invention provides an effective gene editing platform for Chinese hamster animal models, fills the gap in the current gene editing Chinese hamster animal models, and improves the procedures of superovulation and egg retrieval, in vitro embryo culture, tool mouse preparation, microinjection, embryo transplantation, etc. that are unique to Chinese hamsters. The new gene-edited Chinese hamster animal model prepared by the present invention is reliable and repeatable. At the same time, the model can prepare specific diseases or phenotypes by induction methods, which can simulate human diseases. Exploring the genetic, biochemical and other factors behind the species differences in cancer susceptibility and treatment response between various rodent models and humans can significantly supplement and improve the practicality of rodent models in cancer research. The present invention applies CRISPR / Cas9 technology to Chinese hamster animal models to achieve gene editing, thereby achieving the transformation of its phenotype and traits, and is widely used in the fields of preparing Chinese hamster models of human diseases, disease research, drug screening, etc. At the same time, it broadens the field of rodent genetic engineering animal models, can complement existing models and improve their overall value as human cancer models.

[0046] Secondly, it can be seen from the examples that the present invention provides a unique high-dose PMSG fractional injection + LHRH superovulation scheme suitable for Chinese hamsters, which can stably and efficiently obtain Chinese hamster fertilized eggs; provides a red light embryo operating system and a 37.5°C and cold light-avoiding environment suitable for in vitro culture of Chinese hamster fertilized eggs, which can improve the activity and survival rate of Chinese hamster fertilized eggs; provides a double sgRNA combination for targeted knockout of the miR-504 gene in Chinese hamsters, which improves the efficiency of gene editing; provides a ligation surgery scheme suitable for male Chinese hamsters and a screening method for Chinese The hamster surrogate mother mouse scheme improves the thrombus-seeing rate of surrogate mother mice and lays the foundation for subsequent embryo transplantation; it provides an angled 15° micromanipulator needle, a microinjection solution loading scheme, a unique red light microinjection operating system, and a specific time period injection scheme for selecting fertilized eggs with a high ratio of binuclear stage, which improves the survival rate of fertilized eggs after microinjection; it provides an M2-bubble-10-15 fertilized eggs-bubble embryo transplantation scheme, which reduces the number of transplanted fertilized eggs to comply with the reproductive characteristics of the Chinese hamster with a small number of normal conception and litters, and improves the possibility of normal implantation of fertilized eggs after transplantation. In summary, the present invention provides a gene-edited animal model platform suitable for the Chinese hamster, a unique experimental animal resource, which can efficiently prepare a gene-edited Chinese hamster animal model, and provides a new idea and platform for studying the pathogenesis of human diseases and the mechanism of disease progression from the genetic level. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] Figure 1 sgRNA targeting strategy for miR-504 gene in Chinese hamster;

[0048] Figure 2 Electrophoresis profile of sgRNA after in vitro transcription;

[0049] Figure 3 Superovulation strategy of Chinese hamster;

[0050] Figure 4 Obtain the dilated part of the fallopian tube;

[0051] Figure 5 Red light stereo microscope and microinjection operating system;

[0052] Figure 6 Obtaining fertilized eggs;

[0053] Figure 7 Light-blocking tin foil cover;

[0054] Figure 8 In the male rat ligation surgery, ○ indicates testicles, △ indicates fat pad, and □ indicates vas deferens;

[0055] Fig. 9 Surrogate mother mouse screening process;

[0056] Fig.10Embryo transfer ○ indicates fallopian tube, △ indicates ovary, □ indicates uterus, ▲ indicates fat pad;

[0057] Fig.11 Gene knockout Chinese hamster breeding strategy;

[0058] Fig.12 Identification results of miR-504 gene knockout Chinese hamsters in the F0 generation;

[0059] Fig.13 Genome sequencing results of miR-504 knockout Chinese hamsters in the F0 generation;

[0060] Fig.14 Overall experimental flow chart of the present invention. DETAILED DESCRIPTION

[0061] The method of the present invention is further described below in conjunction with examples. The experimental methods for which specific conditions are not indicated in the embodiments can usually be carried out under conventional conditions, such as the conditions described in the "Molecular Cloning Experiment Guide" compiled by J. Sambrook (Sambrook) and others, or under the conditions recommended by the manufacturer. Those skilled in the art can better understand and grasp the present invention with the help of the embodiments. However, the method for implementing the present invention should not be limited to the specific method steps recorded in the embodiments of the present invention.

[0062] The CRISPR / Cas9 reagents were purchased from commercial kits.

[0063] Example 1

[0064] 1. Dual sgRNA design and synthesis

[0065] 1. Dual sgRNA Design

[0066] In order to improve the efficiency of targeted knockout of target genes, a double sgRNA combination was selected, such as Figure 1 As shown. Each pair of combinations can cause indels mutations in the mature miR-504, especially the seed sequence. According to the maturation mechanism of miRNA, the sgRNA targeting site should be located in the mature sequence or stem-loop structure. By analyzing the pre-miR-504 sequence from Chinese hamsters (http: / / crispr.mit.edu), available sgRNAs 1-4 were screened. The sequences of each sgRNA are shown in Table 1.

[0067] Table 1 sgRNA sequences

[0068]

[0069] 2. Dual sgRNA Synthesis

[0070] Using NEB's HiScribe TMT7 Quick High Yield RNA Synthesis Kit was used for in vitro transcription. The gel electrophoresis of the sgRNA recovered by transcription and purification is shown in Figure 2 .

[0071] Each sgRNA transcribed in vitro was purified and recovered, and microinjection samples were prepared according to double sgRNA combination 1 (g1+g3), combination 2 (g1+g4), combination 3 (g2+g3), and combination 4 (g2+g4).

[0072] After mixing the injection solution according to Cas9:sgRNA (20ng / μL:10ng / μL), divide it into 5μL / tube and store it at -80℃. Thaw one tube for each microinjection. The RNP solution is easy to degrade, so avoid repeated freezing and thawing. Operate on ice.

[0073] Example 2

[0074] 2. Superovulation and egg retrieval in Chinese hamsters

[0075] 1. Superovulation in Chinese Hamsters

[0076] Six-week-old female Chinese hamsters were selected as donors of fertilized eggs, weighing 20±5g. They were intraperitoneally injected with 15IU PMSG at 16:00 on Day 1 and 15IU PMSG at 9:00 on Day 4. Superovulation was performed by intraperitoneal injection of 0.6μg LHRH at 16:00. After hormone injection, each female Chinese hamster was caged with a 10-14-week-old male Chinese hamster until 7:00-9:00 the next day and checked for vaginal plugs. The procedure for superovulation of Chinese hamsters can be found in Figure 3 .

[0077] When injecting ovulation-stimulating hormones into Chinese hamsters intraperitoneally, because they have more fat pads than mice, it is necessary to avoid injecting hormones into fat pads, which will not maximize the efficacy of ovulation-stimulating hormones. When grabbing, grab the Chinese hamster upside down, hold the skin on the back, hold up the abdomen, and insert the needle at a 45° angle downward in the middle of the connecting line of the thigh root. Inject when you feel a clear sense of emptiness. After the injection, pause for 2s, turn the needle direction and pull out the needle to prevent leakage. The concentration of superovulation hormone is as follows: PMSG solution 0.1IU / μL, each Chinese hamster injection dose is 150μL; LHRH solution 0.004μg / μL, each Chinese hamster injection dose is 150μL. After the superovulation hormone is prepared, it is divided into 1mL system to avoid repeated freezing and thawing that affects the hormone effect.

[0078] Compared with the superovulation program commonly used in mice, the Chinese hamster superovulation program provided by the present invention can enable Chinese hamsters to obtain a larger number of eggs with a higher fertilization rate, thus laying a good foundation for subsequent microinjection and other work.

[0079] 2. Egg retrieval

[0080] 2.1 Preparation before egg retrieval

[0081] 2.1.1 Preparation of microdroplet culture system

[0082] Prepare the micro-droplet culture system 1 day before egg retrieval: add M2 culture medium to the bottom of a 35 mm cell culture dish, about 20 μL per drop, and then add 2 mL of mineral oil to completely cover the M2 culture droplet. Place the culture system at 37°C and 5% CO 2 Before egg retrieval, add 2 mL of DPBS buffer containing calcium and magnesium ions, 40 μL of hyaluronidase and 20 μL of embryo washing solution to the bottom of the 35 mm cell culture dish, and place it on a 37.5°C heating table to preheat for use.

[0083] 2.1.2 Preparation of oviduct

[0084] Hold the two ends of the capillary glass tube with both hands, place the middle section under the outer flame of an alcohol lamp and burn it red, and quickly stretch the glass tube horizontally after it softens. Observe under a 100x microscope and use ultra-fine tweezers to break the end. The end is smooth and the inner diameter ranges from 15-200μm. Connect the thick end to the infusion hose, seal it with a sealing film (to prevent air leakage), and connect the other end of the hose to a 1000μL gun tip to make an oviduct of the oral control tube-hose-glass tube.

[0085] 2.2 Removal of fallopian tube

[0086] At 13:00 the next day after cage closure, the Chinese hamster was killed by cervical dislocation in a clean bench, with the abdomen facing upwards, and its abdomen was disinfected with 75% alcohol. The abdomen was opened with ophthalmic scissors and forceps to expose the abdominal cavity, and the fallopian tubes and ovaries were found along the uterus. The fallopian tubes were cut off and transferred to preheated DPBS. The ovaries and fallopian tubes (except the enlarged part) and excess fat tissue were removed with microtweezers in DPBS, and the enlarged part was transferred to preheated hyaluronidase (see Figure 4 ).

[0087] 2.3 Egg retrieval

[0088] Since Chinese hamster fertilized eggs are extremely sensitive to visible light, temperature fluctuations and light seriously affect the normal development of the embryo. Therefore, after the Chinese hamster fertilized eggs are separated from the oviduct, the ambient light and cold light should be turned off, and a special red light stereo microscope and microinjection operating system should be used for subsequent operations. Figure 5 Under a red light stereo microscope, tear open the enlarged ampulla of the fallopian tube, press the fallopian tube lightly to make the fertilized egg mass flow out, and digest it in 0.1% hyaluronidase solution for about 1 minute. During this period, use a 20μL pipette to blow to assist digestion, and collect the fertilized eggs. Figure 6 .

[0089] In order to minimize the adverse effects of light on the development of Chinese hamster fertilized eggs, when the fertilized eggs are exposed to the external environment, they must be protected from light and placed on a 37.5℃ heating plate on the microscope operation table. Therefore, we prepared a tin foil cover of a suitable caliber for this operation, see Figure 7 .

[0090] 2.4 Egg washing and culture

[0091] Transfer the fully digested Chinese hamster fertilized eggs to the preheated embryo washing solution and wash them 3-4 times until the cumulus cells are completely detached and a single fertilized egg with good morphology and clean appearance is obtained. Transfer the washed fertilized eggs to 20uL microdroplet M2 culture medium and place them at 37℃ and CO 2 Culture in an incubator.

[0092] The red light operation / cold light avoidance / 37.5° C. constant temperature Chinese hamster in vitro embryo culture scheme provided by the present invention can improve the activity and survival rate of Chinese hamster fertilized eggs, and lays a foundation for in-depth research on Chinese hamster in vitro embryo culture.

[0093] Example 3

[0094] 3. Fertilized egg microinjection protocol

[0095] 1. Preparation before injection

[0096] 1.1 Preparation of injection chamber

[0097] Place 20 μL of M2 culture medium in the center of a 35 mm cell culture dish lid, and then add 2 ml of mineral oil to completely cover the M2 culture medium drop to prepare an injection chamber. Place the culture system at 37°C and 5% CO 2 Equilibrate overnight in an incubator.

[0098] 1.2 Preparation of micromanipulator needle

[0099] 1.2.1 Egg-holding needle

[0100] Set the needle pulling instrument program to H=759, P=200, V=150, T=200 to preliminarily prepare the egg-holding needle; Breaking: Fix the egg-holding needle vertically to the needle forging instrument, heat the platinum wire (50°C) and bring the tip of the egg-holding needle close to the platinum wire, release the foot-controlled heater, and use gravity to break the egg-holding needle into a flat end; Closing: Heat the platinum wire (80-90°C) and bring the tip of the egg-holding needle close to the platinum wire vertically, and start heating to shrink it to 15-20μm (observe the microscopic ruler in the eyepiece); Forging angle: Fix the egg-holding needle horizontally to the needle forging instrument, observe the microscopic ruler and adjust the platinum wire to 500μm away from the needle end, the platinum wire is close to but not touching the egg-holding needle. Heat the platinum wire until the egg-holding needle bends to 15° under its own gravity, and stop heating immediately.

[0101] 1.2.2 Injection needle

[0102] Set the needle puller program to H=720, P=110, V=55, T=250 to prepare the injection needle; Forging angle: fix the injection needle horizontally on the needle forging instrument, observe the micro ruler and adjust the platinum wire to 50μm of the injection needle inner diameter. The platinum wire is close to but not touching the egg holding needle. Heat the platinum wire until the injection needle bends to 15° under its own gravity, and stop heating immediately.

[0103] 1.3 Microinjection solution loading

[0104] 1.3.1 Preparation of long glass sample needle

[0105] Hold the two ends of the capillary glass tube with both hands, place the middle of the tube in the outer flame of an alcohol burner and burn it red until it softens, then quickly stretch it away from the flame, apply force horizontally, stretch the tube to 20cm, and use a ceramic piece to cut it in the middle to divide it into two sample tubes. Connect the thick end of the capillary glass tube to the needle holder of an infusion hose of appropriate length, and connect the other end of the infusion hose to a 200μL gun head (with filter element) as the mouth control tube. Seal the two ends of the infusion set with sealing film to prevent air leakage, forming an injection liquid sample operation system of "mouth control tube-plastic hose-sample tube".

[0106] 1.3.2 Sample addition

[0107] Melt the microinjection solution on ice, and use the siphon effect of the injection needle to insert the needle tip into a 5 μL drop of injection solution (be careful not to break the needle). Then, insert the long injection needle tip loaded with the microinjection solution into the injection needle, and blow the microinjection solution into the injection needle tip. Use the siphon effect of the injection needle to fill the needle tip with liquid to 1 cm above the needle tip and it is ready for use.

[0108] 1.4 Microinjection needle installation

[0109] Use the IX71 micromanipulation system to check that there are no bubbles in the oil circuit of the microinjection system, then insert the egg-holding needle and the injection needle with injection solution into the needle holder filled with paraffin oil. Tighten the knob and install it on the micromanipulation arm. Adjust the egg-holding needle and the tip of the injection needle (400×) in the mineral oil outside the injection chamber to a clear state. Use the coarse adjustment knob to allow mineral oil to enter the injection needle until a 1cm air column is formed between the loaded microinjection solution. At this time, the adjustment knob has a clear sense of obstruction. Then fine-tune the knob and knock the injection needle on the egg-holding needle until the microinjection solution can flow out stably from the tip of the injection needle. Control the injection solution flow rate to an injection dose of 3-10pL per fertilized egg. During the injection process, the flow rate is generally not adjusted unless the needle tip is blocked.

[0110] The microinjection solution adding scheme, microneedle installation and injection solution flow rate adjustment scheme provided by the present invention can greatly shorten the preparation time before microinjection of Chinese hamster fertilized eggs, greatly reduce the in vitro culture time of fertilized eggs, and improve the survival rate of fertilized eggs.

[0111] 2. Cytoplasmic Microinjection

[0112] The proportion of fertilized eggs in the pronuclear stage of Chinese hamsters is the highest around 14:30 the next day after cage closure. During this period, select fertilized eggs with plump cells, round and non-turbid zona pellucida, and clearly visible pronuclei under a red light stereo microscope, wash them in 20μL M2 medium until there is no mineral oil residue, and transfer the fertilized eggs to the injection chamber with an oviduct. Using the red light microinjection operating system, the egg-holding needle repeatedly and gently blows and sucks the fertilized eggs, and adjusts the optimal injection position until the focal plane of the pronucleus is at the same level as the injection needle. Insert the injection needle into the cytoplasm of the fertilized egg, and inject 3-10pL of RNP microinjection solution into each fertilized egg. 15 fertilized eggs / group are injected in groups, and the in vitro operation time of each batch of fertilized eggs should not exceed 20min. In order to distinguish clearly, the injected fertilized eggs and the uninjected fertilized eggs should be placed separately, and the fertilized eggs that died after microinjection should be eliminated. After the injection, the surviving fertilized eggs were immediately transferred to new 20 μL M2 culture medium, washed three times, and then transplanted immediately.

[0113] The Chinese hamster microinjection time and the red light microinjection operating system provided by the invention can improve the microinjection survival rate of fertilized eggs.

[0114] Example 4

[0115] 4. Embryo Transfer

[0116] 1. Preparation of Tool Mice

[0117] 1.1 Preparation of ligated male mice

[0118] Prepare several 6-8 week old male Chinese hamsters, capture and restrain them, and inject 1.25% Avertin (2,2,2-tribromoethanol) anesthetic intraperitoneally at a dose of 0.2mL / 10g. After they are fully anesthetized, fix them on the hot operating table with the abdomen facing upwards, and wipe them with 75% alcohol cotton balls for disinfection. Prepare the skin at the lower part of the abdomen (above the testicles), and a 0.5cm black line is clearly visible, located 1.5cm above the foreskin. Make a 1cm long transverse incision here, wipe the blood with dust-free paper, and then bluntly separate the abdominal muscles along the abdominal incision to open the peritoneal cavity. Gently press the tail to squeeze out the testicles, clamp and pull out the left testicle and fat pad with elbow forceps, find the vas deferens (connected to a very easy to identify blood vessel), and then use pointed forceps to pick out the vas deferens and stretch it about 10mm. Place the elbow forceps on the outer flame of the alcohol lamp and burn for a few seconds, then slowly and gently clamp the vas deferens, which will be quickly burned to a flat and white state. Create another burn point 3-5mm away from the first burn point, and use surgical scissors to remove the vas deferens between the two burn points. Pay attention to observe and ensure that there is a small flat and white section left at the break of the vas deferens. Then use the elbow forceps to carefully return the testicles and fat pad to the abdominal cavity, and do the same operation on the right side. Suture the surgical site, usually one stitch for the muscle and three stitches for the skin. After cleaning the surgical incision and spraying alcohol, place the animal on the hot table and observe for about 10 to 15 minutes until it wakes up, then return it to the breeding room. The surgical operation process is shown in the figure. Figure 8 After the sterilization operation, it takes 14 days to recover and a one-week trial breeding experiment is conducted. Within one week, sterilized male mice are continuously bred with female mice to observe the pregnancy of all female mice with ligatures. Only when it is confirmed that all female mice with ligatures will not become pregnant can such sterilized male mice be used for formal experiments.

[0119] According to the scheme for neutering male Chinese hamsters provided by the present invention, the prepared neutered male mice can maintain a high thrombus-seeking rate for more than 1 year.

[0120] 1.2 Screening of surrogate mother mice

[0121] Select female mice weighing 25-35g, who have given birth to one litter and have good maternal instincts as the surrogate mice. Select estrus female mice from the surrogate mice, select the female mice with the initial estrus morphology at the vaginal opening, and make a vaginal smear to confirm that they are in estrus (the vaginal smear during estrus should be stained lighter, 90% of the cells are anucleate deciduous keratinized cells, which are flaky and evenly distributed, and the cells are nearly transparent). Chinese hamsters will secrete white solid substances at the vaginal opening during the proestrus period. If this secretion is observed, the female mouse can be used directly as a surrogate mouse without a vaginal smear. For female mice that have successfully mated, a white hard lump-like vaginal plug will form at the vaginal opening, and it is very easy to fall off. Therefore, the neutered male mice and surrogate female mice are caged together in a clean cage without bedding to facilitate the observation of fallen vaginal plugs. The surrogate mother mouse screening process is shown in the figure. Fig. 9The mice are usually caged together at 19:00 (male and female in a 1:1 cage ratio), and the vaginal plugs are checked at 7:00-9:00 the next morning. Female mice with vaginal plugs are pseudo-pregnant mice for 0.5 days and are used for fallopian tube transplantation of fertilized eggs; female mice without vaginal plugs are returned to the recipient group and can continue to be used for mating to prepare pseudo-pregnant female mice.

[0122] According to the Chinese hamster surrogate mother mouse scheme provided by the present invention, the prepared surrogate mother mouse has a high vaginal plug positive rate and greatly reduces the casualty rate of ligated male mice caused by inappropriate forced cage closure of female mice during the estrus stage.

[0123] 2. Embryo Transfer

[0124] 2.1 Preparation before embryo transfer

[0125] 2.1.1 Preparation of transplant tube

[0126] The inner diameter of each transplant tube used for embryo transplantation should be larger than the diameter of one single-cell embryo and smaller than the diameter of two single-cell embryos. The production steps are as follows:

[0127] Place the capillary glass tube in the outer flame of an alcohol lamp and calcine it for a few seconds, then remove it from the flame and stretch the capillary tube horizontally to 15 cm. Cut the glass needle with a ceramic sheet in the middle, making the cross section as flat as possible, with an inner diameter range of 15-200 μm, and burn the cross section until it is smooth.

[0128] 2.1.2 Absorbing embryos

[0129] A 1.5 cm section of M2 culture medium is inhaled into the transplant tube, followed by 5 small bubbles to relieve the siphon effect, and then 10 to 15 fertilized eggs are inhaled, controlled within a 1 cm liquid column, and finally a small bubble and a small amount of culture medium are inhaled. The total liquid level cannot exceed the constriction of the transplant tube to prevent the embryo from being lost due to a sudden rise in the liquid level. After transplanting 10 to 15 fertilized eggs on each side, there is a high probability that 5-7 offspring can be successfully born, which is equivalent to the number of offspring born after normal Chinese hamsters are conceived, and conforms to their normal pregnancy process to the greatest extent.

[0130] 2.2 Embryo transfer

[0131] At the same time as the microinjection of fertilized eggs, the surrogate mother was prepared to open her mouth. After weighing the surrogate mother, she was anesthetized by intraperitoneal injection of 1.25% Avertin, with an injection dose of 0.2mL / 10g. Wet the back skin and hair with 75% ethanol, and use microtweezers to separate the hair along the lower spine to both sides, leaving a 2mm wide hairless area. 1cm away from the thigh root, cut a 1cm incision along the spine. At this time, the Chinese hamster's head was placed horizontally to the left, and the scissors were inserted into the incision to bluntly separate the subcutaneous mucosa. Pull up the incision, find the right white fat or brown ovary, cut a small hole on it, and use tweezers to bluntly expand the incision to 0.5cm. Use blunt-tipped tweezers to clamp the fat pad and pull out the attached right ovary, fallopian tube and part of the uterus. Clamp the fat pad with a small hemostatic clip and let it droop along the middle of the back to expose the ovary and fallopian tube outside the body cavity. Place the Chinese hamster under a stereomicroscope and find the enlarged umbrella of the fallopian tube under the fallopian tube and ovarian sac. Use micro forceps to avoid blood vessels and tear open the ovarian sac. Carefully clamp the fimbria of the fallopian tube with micro forceps, insert the transplant tube into the fimbria of the fallopian tube, and blow the embryo and air bubbles into the ampulla of the fallopian tube. If 5 bubbles are seen in the fallopian tube, it means that the transplant has been successful. Fig.10 . Loosen the small hemostatic clip, pick up the fat pad with blunt forceps, and put the uterus, fallopian tube, ovary, etc. back into the body cavity. Repeat the steps to transplant the left fallopian tube, suture the surgical site, sew three stitches on the skin, clean up the surgical incision, spray alcohol, and place the animal on a hot table for observation for about 10 to 15 minutes until it wakes up. Each surrogate mother mouse is kept in a single cage.

[0132] The present invention provides a synchronous microinjection and surrogate mother anesthesia and an embryo transplantation scheme of M2-bubble-10-15 fertilized eggs-bubble, which greatly shortens the in vitro culture time of fertilized eggs, conforms to the number of offspring of Chinese hamsters under normal pregnancy conditions, and increases the possibility of normal implantation of fertilized eggs after transplantation.

[0133] Example 5

[0134] 5. Identification of F0 generation gene knockout Chinese hamsters

[0135] Classical breeding combined with PCR was used to screen homozygous miR-504 gene knockout Chinese hamsters. The specific process is shown in Fig.11 .

[0136] It is worth noting that since random repair of genomic DNA will cause different indels mutations, each first-generation gene knockout Chinese hamster needs to be bred as an independent lineage. Each generation needs to cut the tail tissue of the hamsters and extract genomic DNA for verification. TM(Code No#R004A) was used for PCR amplification. The target gene pre-miR-504 (i.e., sgRNA recognition sequence CRISPR+PAM) was used as the center, and 150-250bp of primers were added on both sides to design the genotype identification primers for the target amplification product. The primer sequences are as follows.

[0137] F:5′-CTGACCTCAGGCCAATATGTAG-3′

[0138] R:5′-GGGTTGTAGGTAAGAGAGAAAG-3′

[0139] The PCR amplification products were subjected to agarose gel electrophoresis. The bands #3 and #4 of the F0 generation were obviously different from those of the wild-type WT Chinese hamster. It was preliminarily determined that the miR-504 gene of the F0 generation #3 and #4 had mutated. Fig.12 The PCR amplification products were sent to the company for sequencing, and it was finally determined that 3 of the 4 F0 mice had successful gene editing, successfully achieving a 16bp base mismatch in the F0#2 miR-504 gene, a 4-base insertion and a 74-base deletion in the F0#3 miR-504 gene, and an 8-base insertion, a 175-base deletion, and a 13-base mismatch in the F0#4 miR-504 gene. The sequencing results are shown in Fig.13 Each gene-edited positive mouse was bred and established separately.

[0140] The Chinese hamster gene editing animal model scheme provided by the present invention can efficiently prepare gene knockout positive Chinese hamsters. The overall process can be seen in Fig.14 .

[0141] The above are only preferred embodiments of the present invention, and the protection scope of the present invention cannot be limited thereto. That is, any simple equivalent changes and modifications made according to the claims and the utility model content of the present invention still fall within the protection scope of the patent application of the present invention.

Claims

1. A dual sgRNA composition, characterized in that: The sgRNAs included the following sequences: sgRNA1=SEQ ID No.1=CTGACACAGAATGACTTCAA AGG; sgRNA2=SEQ ID No.2=ATGCTGCTGTTGGGAGACCC TGG; sgRNA3=SEQ ID No.3=GGCAGGGTTTCCCATACAGG AGG; sgRNA4=SEQ ID No.4=GTAGCCTGTGCCTCCTGTAT GGG.

2. Use of the dual sgRNA composition as claimed in claim 1 in knocking out the Chinese hamster miR-504 gene.

3. A CRISPR / Cas9 gene knockout reagent, characterized in that: Contains the dual sgRNA composition as claimed in claim 1.

4. A method for constructing a miR-504 gene knockout Chinese hamster model based on CRISPR / Cas9, characterized in that: The method comprises using the dual sgRNA composition as claimed in claim 1.

5. The method for constructing a miR-504 gene knockout Chinese hamster model based on CRISPR / Cas9 according to claim 4, characterized in that: The following steps are involved: 1) Design and synthesis of dual sgRNA combinations; 2) Superovulation and egg retrieval of Chinese hamsters; 3) Microinjection of fertilized eggs; 4) Embryo transfer; 5) Identification of F0 generation gene knockout Chinese hamsters.

6. The method for constructing a miR-504 gene knockout Chinese hamster model based on CRISPR / Cas9 according to claim 5, characterized in that: The superovulation in step 2) comprises the following specific steps: Six-week-old female Chinese hamsters were selected and injected with 15 IU PMSG at 16:00 on Day 1 and 15 IU PMSG at 9:00 on Day 4. They were also injected with 0.6 μg LHRH at 16:00 for superovulation. After hormone injection, they were immediately caged with male hamsters. Thrombus examination was performed at 7:00-9:00 on Day 5. The concentration of the superovulatory hormone PMSG solution was 0.1 IU / μL, and the injection dose was 150 μL / mouse; the concentration of the LHRH solution was 0.004 μg / μL, and the injection dose was 150 μL / mouse.

7. The method for constructing a miR-504 gene knockout Chinese hamster model based on CRISPR / Cas9 according to claim 5, characterized in that: The step 3) includes the following specific steps: Before injection, prepare the injection chamber, micromanipulator (injection needle, egg holding needle), and long glass sample needle. Use the long glass sample needle to mix sgRNA and Cas9 protein into the microinjection solution and fill the injection needle tip 1 cm; insert the egg holding needle and the injection needle with injection solution into the needle holder filled with paraffin oil, tighten the knob and install it on the micromanipulator; adjust the egg holding needle and injection needle tips in the mineral oil outside the injection chamber until they are clear; Adjust the injection fluid flow rate in the injection needle by adjusting the coarse / fine adjustment knob combined with needle knocking, until the microinjection fluid can flow out steadily from the tip of the injection needle, and control the injection fluid flow rate to an injection dose of 3-10 pL per fertilized egg; use a special red light microinjection system to select fertilized eggs with plump cells, clear zona pellucida, and clearly visible double pronuclei under red light for injection. After the injection, remove the dead fertilized eggs, select the fertilized eggs with plump cells and clear zona pellucida, and transfer them into M2 droplets in groups of 15 for transplantation.

8. The method for constructing a miR-504 gene knockout Chinese hamster model based on CRISPR / Cas9 according to claim 5, characterized in that: The step 5) comprises the following steps: The tails of the F0 generation mice were cut, genomic DNA was extracted, and genotypes were identified by PCR amplification. Agarose gel electrophoresis and Sanger sequencing were performed to clarify the changes in the gene sequence of the gene-edited F0 generation Chinese hamsters. After positive mice were identified, they were bred and the lines were established.

9. The method for constructing a miR-504 gene knockout Chinese hamster model based on CRISPR / Cas9 according to claim 5, characterized in that: The primers used for PCR amplification in step 5) include: F: 5′-CTGACCTCAGGCCAATATGTAG-3′= SEQ ID No.5 R: 5′-GGGTGTGTAGGTAAGAGAGAAAG-3′= SEQ ID No.6。 10. Use of the method according to any one of claims 4 to 9 or the Chinese hamster gene-edited animal model prepared thereby in the development of anti-tumor drugs.

Images