Bitter gourd U6 promoter McU6P5 and application thereof

Abstract

The invention discloses a balsam pear U6 promoter McU6P5 and an application of the balsam pear U6 promoter McU6P5. The method comprises the following steps: designing a specific primer: McU6P5F: 5 '-TTGGTAATCAGTATATGTCT AATTAC-3' by taking a bitter gourd genome DNA (Deoxyribose Nucleic Acid) as a template; mcU6P5R: 5 '-ATGCTAATCTTCTCTGTATCGTTCCA-3', and McU6P5R: 5 '- The bitter gourd U6 promoter McU6P5 with a DNA nucleotide sequence as shown in SE Q ID NO: 1 is obtained by carrying out PCR (Polymerase Chain Reaction) amplification on bitter gourd genome DNA (Deoxyribose Nucleic Acid) through the specific primer. The bitter gourd U6 promoter (McU6P5) has the advantages that the callus of bitter gourd is infected by agrobacterium, the McU6P5 has promoter activity after GUS (glucuronidase) staining, the activity of the McU6P5 is higher than that of AtU6P, and the bitter gourd U6 promoter (McU6P5) provides a new tool for gene editing and genetic improvement of bitter gourd and related crops.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a bitter melon U6 promoter McU6P5 and an application thereof. Background Art

[0002] Genetic transformation technology has played an important role in improving crop traits, and the improved excellent traits include yield, quality, and resistance to biotic and abiotic stresses. Among them, gene editing technology based on CRISPR / Cas9 has become an emerging technology for crop genetic improvement due to its advantages such as simple operation, high editing efficiency, support for multi-target editing, and diverse editing forms. It has played an important role in improving many crop traits. The U6 promoter is a type of RNA polymerase III promoter in the cell nucleus, which is often used to drive the expression of sgRNA (single-stranded guide RNA) in the cell nucleus. In the CRISPR / Cas9 gene editing system, the U6 promoter plays a vital role because it determines the transcription efficiency and specificity of sgRNA. Generally, the Arabidopsis U6 promoter (AtU6P) is used to construct gene editing vectors for crops. However, the U6 promoters of different species are species-specific, and the use of the plant's own endogenous U6 promoter can significantly improve the editing efficiency. Up to now, there has been no report on the U6 promoter of bitter melon, which may be one of the reasons why the bitter melon gene editing system cannot be broken through. Therefore, cloning the endogenous U6 promoter of bitter melon with high transcriptional activity is conducive to the construction of CRISPR / Cas9 gene editing vectors and the improvement of the system, which has important research significance and application value for the functional gene research and genetic breeding of bitter melon. Summary of the invention

[0003] In order to overcome the shortcomings and deficiencies of the prior art, the object of the present invention is to provide a bitter melon U6 promoter McU6P5 and applications thereof.

[0004] The present invention is achieved by providing a bitter melon U6 promoter McU6P5, wherein the DNA nucleotide sequence of the promoter McU6P5 is shown in SEQ ID NO:1.

[0005] The present invention further discloses a method for cloning the above-mentioned bitter melon U6 promoter McU6P5, which comprises the following steps:

[0006] (1) Design specific primers using bitter melon genomic DNA as template:

[0007] McU6P5 F:5'-TTGGTAATCAGTATATGTCTAATTAC-3';

[0008] McU6P5 R:5'-ATGCTAATCTTCTCTGTATCGTTCCA-3';

[0009] (2) The bitter melon genomic DNA was amplified by PCR using the above-mentioned specific primers to obtain the bitter melon U6 promoter McU6P5.

[0010] The present invention further discloses the application of the bitter melon U6 promoter McU6P5 in bitter melon molecular breeding.

[0011] Compared with the shortcomings and deficiencies of the prior art, the present invention has the following beneficial effects: the present invention constructs a fusion of McU6P5 and GUS genes onto a pBI121 vector, infects the callus tissue of bitter melon with Agrobacterium, and after GUS staining, it is confirmed that McU6P5 has promoter activity and its activity is stronger than that of the commonly used Arabidopsis thaliana U6 promoter (AtU6P). The bitter melon U6 promoter (McU6P5) provides a new tool for gene editing and genetic improvement of bitter melon and related crops. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 This is the electrophoresis diagram of PCR amplification of the U6 promoter McU6P5 of bitter melon;

[0013] Figure 2 The figure shows the GUS staining of bitter melon callus. The control group is transiently infected with Agrobacterium GV3101 containing Arabidopsis U6 promoter and GV3101 containing empty vector. DETAILED DESCRIPTION

[0014] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0015] 1. McU6P5 promoter sequence amplification

[0016] PCR amplification was performed using genomic DNA from leaves of bitter melon (K24) as template and specific primers.

[0017] The primer sequences are:

[0018] McU6P5-F: 5'-TTGGTAATCAGTATATGTCTAATTAC-3';

[0019] McU6P5-R: 5'-ATGCTAATCTTCTCTGTATCGTTCCA-3'.

[0020] Prime STAR high-fidelity enzyme was used for PCR reaction, and the reaction system was as follows: 98°C denaturation for 10 s, 55°C annealing for 5 s, 72°C extension for 5 s, 34 cycles, and final extension for 10 min.

[0021] The amplified products were subjected to electrophoresis, and the results were as follows. Figure 1 shown.

[0022] The amplified product was purified and cloned into the pMD18-T vector to obtain the McU6P5-T plasmid, which was transformed into Escherichia coli for sequencing analysis. The complete length of the DNA nucleotides of the U6 promoter McU6P5 is 653 bp, and its sequence is shown in SEQ ID NO:1.

[0023] 2. The promoter McU6P5 was constructed into the pBI121 vector containing GUS by seamless cloning, and the 35S promoter at the front end of GUS on the original vector was replaced with McU6P5. The primers used are as follows. The underlined sequences are homologous to the pBI121 vector:

[0024] pBI-McU6P5-F:5'- TCAGAAGACCAAAGGGCAAT TTGGTAATCAGTATA TGTCT-3′;

[0025] pBI-McU6P5-R:5'- GGATCCTCTAGAGTCCCCCG TGCTAATCTTCTCTGT ATCG-3'.

[0026] The McU6P5-T plasmid was used as a template to amplify the pBI-McU6P5 sequence with homology arms at both ends. The recombination reaction system (purchased from Yisheng Biotechnology (Shanghai) Co., Ltd.) was used to construct McU6P5 into a vector named McU6P5-GUS.

[0027] 3. The plasmid containing McU6P5-GUS was transferred into Agrobacterium GV3101. The preparation process was as follows: the positive colonies were inoculated into 5 mL LB liquid medium (containing 50 μg / mL Kan, 20 μg / mL Rif antibiotics), 28 ° C, 200 rpm, and after overnight culture, the bacterial solution was transferred to 50 mL LB liquid medium (containing 50 μg / mL Kan, 20 μg / mL Rif antibiotics, 20 μM acetosyringone) at a ratio of 1%, and the Agrobacterium concentration was continued to reach OD 600 = 0.4-0.6, 5000 rpm, room temperature, centrifuge for 10 min to collect the bacteria, resuspend the bacteria in MS liquid medium (containing 10 mM MgCl2, 150 μM acetosyringone), and adjust the Agrobacterium concentration to OD 600=0.8, and then allowed to stand at 28°C for 2h, the prepared suspension was used to infect the bitter melon callus. After co-cultivation for 2d, the callus was stained with GUS, and stained overnight in a 37°C shaker in the dark. The staining solution was discarded, and the callus was decolorized with 95% alcohol to observe the GUS staining. The bitter melon callus infected with GV3101 containing Arabidopsis U6 promoter (AtU6p) and GV3101 without any load was used as a control. The staining was as follows Figure 2 As shown, the promoter activity of McU6P5 in bitter melon callus was higher than that of Arabidopsis thaliana U6 promoter.

[0028] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A bitter melon U6 promoter McU6P5, characterized in that The DNA nucleotide sequence of the promoter McU6P5 is shown in SEQ ID NO:

1.

2. The cloning method of the momordica charantia U6 promoter McU6P5 according to claim 1, characterized in that: The method comprises the following steps: (1) Design specific primers using bitter melon genomic DNA as template: McU6P5-F:5'-TTGGTAATCAGTATATGTCTAATTAC-3'; McU6P5-R:5'-ATGCTAATCTTCTCTGTATCGTTCCA-3'; (2) The bitter melon genomic DNA was amplified by PCR using the above-mentioned specific primers to obtain the bitter melon U6 promoter McU6P5.

3. Application of the bitter melon U6 promoter McU6P5 described in claim 1 in bitter melon molecular breeding.

Images