Application of chrysanthemum transcription factor CmRAX2 in promoting axillary bud growth or increasing bud number

Abstract

The invention belongs to the field of genetic engineering technology and transgenic breeding. The sequence of the chrysanthemum CmRAX2 gene is as shown in SEQ ID No.1, and the sequence of the encoded protein of the chrysanthemum CmRAX2 gene is as shown in SEQ ID No.2. Chrysanthemum leaf discs are infected through an agrobacterium-mediated method, the gene is transferred into chrysanthemum, a CmRAX2 gene trans-CmRAX2 gene chrysanthemum strain is obtained, and the result shows that the number of lateral buds, the plant height and the node number of the CmRAX2 gene trans-CmRAX2 gene chrysanthemum plant are increased, the appearance time and the rooting time of the lateral buds are advanced, the rooting ability of leaves is improved, and the number of buds is increased. Therefore, the chrysanthemum CmRAX2 gene disclosed by the invention has the functions of promoting the growth of lateral branches of the chrysanthemum and increasing the flower quantity, and has a good application prospect when being applied to plant character improvement.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering technology and transgenic breeding, and relates to the chrysanthemum CmRAX2 gene, its encoded protein and its application in promoting the plant height, lateral branch and root growth and increasing the number of flowers of chrysanthemum. Background Art

[0002] Chrysanthemum belongs to the genus Chrysanthemum of the family Compositae. Chrysanthemum L.) plant, is one of the four major cut flowers in the world, one of the ten traditional famous flowers in my country, and an important type of fresh cut flower export in my country, occupying an important position in the flower market. Chrysanthemum has a wide variety of varieties, diverse plant shapes, and rich flower colors. It is widely used in cut flowers, potted plants, courtyard greening and garden landscapes. According to its cultivation method and application method, it can be mainly divided into three types: potted chrysanthemum, ground cover chrysanthemum and cut chrysanthemum, and cut chrysanthemum can be divided into single-headed chrysanthemum and multi-headed chrysanthemum. In the actual production process, potted chrysanthemum and ground cover chrysanthemum have the disadvantage of weak branching, while cut chrysanthemum needs to manually remove the top buds or wipe out the side buds during the production process to meet the market requirements for chrysanthemum plant type. This process wastes a lot of time and a large amount of labor costs, resulting in a significant increase in production costs, which restricts the large-scale production of chrysanthemums. Therefore, it is of great practical significance to cultivate ideal chrysanthemum plant types through hybrid breeding and molecular breeding.

[0003] RAXs (REGULATOR OF AXILLARY MER-ISTEMS) belongs to R2R3-MYB transcription factors. The MYB gene family is also widely involved in plant root development, leaf development, flower development, reproductive organ development, glandular hair development and seed germination. RAXs Genes control the production of AM by acting on STM. RAX1 It is expressed in the central region of the stem apical meristem and the primary junction of leaves and is considered to be a marker gene for AM initiation. Overexpressed in tobacco NtRAX2 , transgenic plants showed lateral buds earlier than wild-type plants. PhRAX2 In response to the regulation of cytokinin, it may indirectly participate in the branching development of plants as a downstream regulatory factor.

[0004] Among the genetic transformation pathways of plants, Agrobacterium-mediated method is one of the most widely used methods, in which effective plant expression vectors are crucial. The gene CmRAX2 is constructed into a plant expression vector for use in Agrobacterium-mediated plant genetic transformation, which can obtain new germplasm with multiple lateral branches. This is of great significance for the cultivation of new varieties of excellent crops and their wide application in production. Summary of the invention

[0005] The purpose of the present invention is to provide application of chrysanthemum transcription factor CmRAX2 in promoting axillary bud growth or increasing the number of flower buds.

[0006] The present invention first provides a chrysanthemum CmRAX2 protein, which has: an amino acid sequence as shown in SEQ ID No.2; the present invention provides a gene encoding the chrysanthemum CmRAX2 protein, which has: a nucleotide sequence as shown in SEQ ID No.1;

[0007] The present invention provides the use of the chrysanthemum CmRAX2 protein or the gene encoding the chrysanthemum CmRAX2 protein or the biological material containing the gene in promoting the growth of plant lateral branches.

[0008] The present invention provides the use of the chrysanthemum CmRAX2 protein or the gene encoding the chrysanthemum CmRAX2 protein or the biological material containing the gene in promoting the occurrence of plant axillary buds.

[0009] The present invention provides the use of the chrysanthemum CmRAX2 protein or the gene encoding the chrysanthemum CmRAX2 protein or the biological material containing the gene in preparing transgenic plants.

[0010] The transgenic plant has vigorous axillary bud growth and a large number of side branches and flower buds.

[0011] The present invention provides the use of the chrysanthemum CmRAX2 protein or the gene encoding the chrysanthemum CmRAX2 protein or the biological material containing the gene in improving plant germplasm resources.

[0012] Chrysanthemum provided by the present invention CmRAX2 The gene sequence is shown in SEQ ID No. 1, and the protein sequence is shown in SEQ ID No. 2. The gene was transferred into chrysanthemum by infecting chrysanthemum leaf discs through Agrobacterium-mediated method to obtain the transgenic CmRAX2 Genetic chrysanthemum strains, the results showed that CmRAX2 The number of lateral branches and flower buds of the gene chrysanthemum strain increased. CmRAX2 The gene has the function of promoting the growth of plant lateral branches and increasing the number of flower buds. The gene can be used as a candidate gene for improving chrysanthemum traits and applied to plant trait improvement, and has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 for CmRAX2 Gene expression vector construction map.

[0014] Figure 2 for CmRAX2 PCR detection diagram of gene-transformed chrysanthemum resistant seedlings, M is DL2000 Marker

[0015] Figure 3 For each strain CmRAX2 Expression amount.

[0016] Figure 4 For transfer CmRAX2 Comparison of axillary bud growth between genetically modified chrysanthemum and wild-type chrysanthemum.

[0017] Figure 5 This is a comparison chart of the number of flower buds. DETAILED DESCRIPTION

[0018] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Without departing from the spirit and essence of the present invention, modifications or substitutions made to the methods, steps or conditions of the present invention are within the scope of the present invention. The reagents, kits and instruments used in the following examples can all be obtained commercially, and the methods used in the examples are consistent with the conventional methods unless otherwise specified.

[0019] Plant material: The chrysanthemum plant material used in the experiment was the wild cut chrysanthemum main cultivar 'Shenma'. Chrysanthemum tissue culture seedlings were inoculated in MS (Murashige and Skoog) medium and placed in an indoor environment with a temperature of 22℃-25℃, a photoperiod of 16h light / 8h dark, a relative humidity of 65%, and a light intensity of 100-120μmol / (m 2 ·s) culture room.

[0020] Main instruments for the experiment: clean bench, ultra-low temperature refrigerator, high pressure sterilizer, FA2104B electronic balance, THZ-82A gas bath constant temperature oscillator, electric constant temperature water bath, HH-4 digital constant temperature shaker, spectrophotometer, microplate reader, PCR instrument, TGL-table centrifuge, XW-80A micro vortex mixer, ice maker, microwave oven, agarose gel electrophoresis device, gel imaging system, etc.

[0021] The main reagents and consumables of the experiment: MS medium, LB medium, YEB solid (liquid) medium, DNA Marker (DL2000), anhydrous ethanol, TAE solution, kanamycin solution, rifampicin solution, NAA solution, 6-BA solution, IAA solution, 2,4D solution, CTAB solution, chloroform, Escherichia coli competent DH5α, Agrobacterium GV3101, pEASY®-T1 CloningVector vector (Beijing Quanshijin Biological Company), NO41 plasmid mini-extraction kit (Nanjing Jiancheng Company), exogenous RNase scavenger, Tiangen RNA extraction kit (RNAprep Pure Plant Kit, Tiangen), cDNA reverse transcription kit, Bioengineering ordinary agarose gel DNA recovery kit, etc.

[0022] 1. Chrysanthemum CmRAX2 Construction of gene expression vector

[0023] pbi121-ZS and the sequenced DNA were double digested with restriction endonucleases BsaⅠ and Eco31Ⅰ. CmRAX2 Gene plasmid, respectively recover pbi121 vector fragment and CmRAX2 The two fragments were connected with T4 DNA ligase, and the constructed plant expression vector was named p121 -CmRAX2 -OE.

[0024] 2. Preparation of competent Agrobacterium (1) Pick up a single colony of Agrobacterium tumefaciens GV3101 grown on solid YEB medium with a white pipette tip, and culture it in 3 mL YEB liquid medium containing 25 mg / mL Rif by repeated pipetting. Cultivate at 28°C and 180 rpm for 22-26 h until the OD value is about 0.6-0.8.

[0025] (2) Take 200-500 μL of the bacterial solution with an OD value of about 0.6-0.8 obtained in the previous step and inoculate it into 50 mL of YEB liquid culture medium (containing 25 mg / mL Rif), and culture it in a shaking incubator at 28°C for about 8-10 h until the OD600 reaches 0.5.

[0026] (3) Centrifuge the bacterial solution at 5000 r / min at room temperature for 5 min, discard the supernatant, and keep the white bacterial precipitate in the centrifuge tube for later use.

[0027] (4) Add 10 mL of pre-cooled sterile 0.15 M NaCl solution to the centrifuge tube with white precipitate obtained in the previous step to dilute the Agrobacterium cells, and centrifuge at room temperature and 5000 r / min for 5 min to collect the cells again.

[0028] (5) Inject 1 mL of 20 mM CaCl2 (pre-cooled) containing 15% glycerol into a centrifuge tube to suspend the cells. The prepared competent cells are best used on the same day. If long-term storage is required, they need to be quickly frozen in liquid nitrogen for about 1 minute and then placed in a -80°C ultra-low temperature refrigerator. When the bacterial solution is used again, it should be stored in an ice box.

[0029] 3. Recombinant plasmid p121- CmRAX2- OE transformation of Agrobacterium

[0030] (1) Transfer the recombinant plasmid into Agrobacterium competent cells: Take out a centrifuge tube containing 200 μL of Agrobacterium competent cells from the refrigerator, then use a pipette to draw 1 μg of recombinant plasmid DNA, mix the two evenly, freeze them on ice for 34 minutes, then put them in liquid nitrogen for quick freezing for 1 minute, then place them in a 37℃ water bath for 5 minutes, finally take them out, add 800 μL of the pre-prepared YEB culture medium, and culture them at 120r / 28℃ for 4 hours; centrifuge at 1000r for 30 seconds at room temperature, collect the bacterial precipitate, pour off the supernatant, add 100 μL of YEB culture medium to the centrifuge tube to resuspend the precipitate, finally, use a spreader to evenly spread the entire bacterial solution on a YEB plate containing 100 mg / mL Kan and 25 mg / mL Rif, and culture them upside down at 28℃ for 48-60 hours.

[0031] (2) Identification of positive clones: Pick a single colony and place it in liquid culture medium containing 100 mg / mL Kan and Rif25 mg / mL YEB, and culture it at 180-200r / 28℃ overnight. Then extract the plasmid DNA and use it as a template for PCR amplification and identification or directly use colony PCR for identification.

[0032] 4. Agrobacterium-mediated transformation of chrysanthemum

[0033] (1) Cut off the 3rd to 5th larger healthy functional leaves of the chrysanthemum tissue culture seedlings on the clean bench, cut off the edges of the leaves, and cut them into 1 cm 2 When cutting leaves, you should frequently change the scissors and tweezers, clean the residues in the plate in time, and spray alcohol to sterilize the environment.

[0034] (2) Pre-culture the cut leaf pieces on MS medium A containing 6-BA and 2,4-D for 2 days. To ensure that the leaf wound is in full contact with the culture medium, gently press the edge of the leaf into the culture medium with tweezers.

[0035] (3) Use a small pipette tip to pick up the pre-streaked 28°C cultured cells containing p2301- CmRAX2 A single colony of GV3101 Agrobacterium tumefaciens of -OE was repeatedly pipetted into 50 mL of YEB liquid culture medium (containing 100 mg / mL Kan and 25 mg / mL Rif) and cultured in a shaking incubator at 28°C for about 13-16 h until its OD600 value was about 1.0.

[0036] (4) Pipette 0.4 mL, 0.6 mL, and 0.8 mL of the bacterial solution obtained in the previous step into new YEB liquid culture medium according to the actual value of the gradient, and continue to culture in a shaking incubator at 28°C for about 24 hours until the OD value is 0.4-0.5.

[0037] (5) Centrifuge the bacterial solution of appropriate concentration at 4000 r / min at room temperature for 10 min and discard the supernatant.

[0038] (6) Resuspend the bacteria in 100 mL of 1 / 2MS saline solution with a pH of about 7.0 and use the diluted bacterial solution for infection.

[0039] (7) The infection process is completed on a clean bench. Carefully screen the leaves pre-cultured for 2 days in step 2 to avoid contact with and mixing with leaves with bacteria. Use tweezers to pick out healthy and clean leaves and place them in the bacterial solution. The time is set for 10 minutes. Shake the leaves from time to time during the infection process to ensure that the bacterial solution fully soaks the wound. After 10 minutes, take out the leaves and place them on sterile filter paper. Use the pre-cut filter paper to absorb the excess bacterial solution on the leaves.

[0040] (8) After the infected explants are dried, inoculate them on 1 / 2MS + 0.25 mg / L 2,4-D + 200 mg / L Cef medium B, wrap them with newspaper and culture them in the dark at room temperature for 2 days.

[0041] (9) After being cultured in the dark for 48 h, the explants were transferred to medium C consisting of MS + 1 mg / L 6-BA + 0.25 mg / L 2,4D + 200 mg / L Cef on a clean bench and cultured for 10 days.

[0042] (10) After 10 days, transfer the leaves on medium C to medium D containing MS + 1 mg / L 6-BA + 0.25 mg / L NAA + 200 mg / L Cef, ensuring that the edge of the leaves is in full contact with the medium. Keep an eye on the leaves and clean any leaves infected with bacteria in a timely manner, and transfer other clean leaves to new plates D.

[0043] (11) When the buds growing on the callus tissue of the leaves reach a height of 2-3 cm, they can be cut off and inserted into ordinary MS culture medium to wait for them to take root and grow into seedlings.

[0044] 5. Identification of positive plants

[0045] (1) Add an appropriate amount of liquid nitrogen to a mortar that has been sterilized by burning anhydrous ethanol to pre-cool it. Then weigh about 0.1 g of chrysanthemum leaves in the mortar and add liquid nitrogen to fully grind them into fine powder.

[0046] (2) Transfer the ground sample to the corresponding labeled 1.5 mL centrifuge tube and add 800 μL of CTAB extraction solution preheated at 65°C. To ensure thorough mixing, vortex vigorously for 1 min.

[0047] (3) Place the centrifuge tube on a floating plate and incubate in a 65°C water bath for 0.5 h. During this process, mix by inverting the tube for 30 seconds every 10 min.

[0048] (4) Centrifuge at 13,000 r / min for 10 min, take the supernatant (avoid sucking up tissue fragments), put it in a new centrifuge tube, add chloroform in an equal volume to the supernatant, vortex and mix. Centrifuge again at 13,000 r / min for 10 min.

[0049] (5) Take the supernatant and place it in a new centrifuge tube. Add an equal volume of 4°C precooled isopropanol. Gently invert to mix well and let stand at room temperature for 0.5 h.

[0050] (6) Centrifuge at 8000 r / min for 5 min. To prevent the white precipitate obtained in this step from being poured out, use a pipette to aspirate and discard the supernatant.

[0051] (7) Wash the precipitate with freshly prepared 70% ethanol. Use a pipette to draw 800 μL of 70% ethanol to rinse the precipitate, leaving it at the bottom of the centrifuge tube to ensure washing efficiency. Repeat this step three times.

[0052] (8) After the third wash, remove the excess 70% ethanol in the centrifuge tube and place the remaining droplets in a clean bench for ventilation until they are as dry as possible.

[0053] (9) Add 30-50 μL of RO water to the centrifuge tube and pipette thoroughly to dissolve the precipitate.

[0054] (10) 1 μL of DNA extract was used as a template for positive identification to obtain the target band, and primers 35S-F (GACGCACAATCCCACTATCC) and CmRAX2-R (ATTACTCCCATCAATCATAG) were used to detect whether chrysanthemum plants contained CmRAX2 Gene expression vector.

[0055] 6. Phenotypic analysis of transgenic chrysanthemum

[0056] The transgenic chrysanthemum seedlings obtained by screening were transferred to MS culture medium. After the chrysanthemum seedlings grew to 5-6 cm, the top buds of the transgenic seedlings and wild-type plants were removed in a clean bench, and the lateral buds that grew later were transplanted to new MS culture medium to observe the rooting time and the appearance time of lateral buds (the observation of lateral buds and rooting conditions was based on the naked eye). Three biological replicates were one treatment (one treatment was one strain), and there were three treatments in total. After the chrysanthemum seedlings grew in the culture medium for 30 days, the chrysanthemum seedlings were pulled out of the culture medium, and the chrysanthemum leaves were removed to count the plant height, number of nodes, and number of lateral buds of the transgenic plants and wild-type chrysanthemums.

[0057] The positive transgenic seedlings and the untransformed ones were used as controls and propagated. After rooting, they were transferred to a cultivation medium with V (vermiculite): V (nutrient soil) = 3:1. Ten plants were planted in each line, and the formation and growth of lateral buds, side branches and flower buds were observed.

[0058] 7. Results and Analysis

[0059] (1) Construction of overexpression vector

[0060] The present invention combines PBI121 and sequenced CmRAX2 The fragments of the gene plasmid after being digested by Sa1Ⅰ and XbaⅠ were connected and transformed into competent E. coli cells, and the transformants were screened by PCR. The plasmid DNA of the cloned strains identified positive by PCR was extracted and double-digested with Sa1Ⅰ and XbaⅠ. The extracted plasmid was double-digested with the Sa1Ⅰ and XbaⅠ restriction sites added at both ends of the target gene to obtain two fragments, one of which was a vector fragment of about 12.3kb and the other was CmRAX2 The gene fragment is 1.6kb, indicating that the gene fragment has been integrated into the expression vector. Sequencing confirmed that it is positive. CmRAX2 The gene was inserted in the correct direction. CmRAX2 Expression vector p121- CmRAX2 -OE. (Attached Figure 1 )

[0061] (2) Identification of transgenic plants

[0062] Agrobacterium carrying the positive CmRAX2 gene was used to infect the leaf explants of the cut chrysanthemum 'Shenma', and a total of 175 leaf explants were transformed. When identifying transgenic seedlings, since the CmRAX2 gene is an endogenous gene of the cut chrysanthemum 'Shenma', the 35S promoter carried in the vector was used as a marker during the PCR procedure, and 35S-F and CmRAX2-R were used as specific primers to perform PCR verification of transgenic seedlings. After DNA extraction and PCR procedures, a total of 6 transgenic seedlings (see attached) were obtained. Figure 2 ). The cut chrysanthemum 'Shenma' tissue culture seedlings with a plant height of 3-5 cm were used as experimental materials, and three biological replicates were performed. The total RNA of the leaves of the cut chrysanthemum 'Shenma' was extracted using the trizol method, and the expression level of the CmRAX2 gene in the transgenic plants was analyzed using qPCR technology. Using the wild-type cut chrysanthemum 'Shenma' as the control, the six strains of transgenic cut chrysanthemum 'Shenma', Cm16, Cm26, Cm54, Cm56, Cm381 and Cm382, overexpressed 79.20 times, 10.00 times, 42.99 times, 8.51 times, 5.25 times and 6.83 times T, respectively (see Appendix Figure 3 ).

[0063] (3) Phenotypic observation of the cut chrysanthemum 'Shenma' overexpressing CmRAX2

[0064] The three transgenic lines with higher expression levels, Cm16, Cm54, and Cm26, and the wild-type plants were topped at the same time, and when the lateral buds grew to about 2 cm, they were transferred to MS medium to observe the appearance time of axillary buds and root growth. In terms of the appearance time of lateral buds, the transgenic plants were first observed to appear on the fifth day after transplantation, while the wild-type chrysanthemum plants were first observed on the ninth day, four days later than the transgenic plants. This indicates that CmRAX2 The gene transfer promoted the initiation of axillary meristems in the cut chrysanthemum 'Shenma', which was beneficial to the formation of axillary buds and played a role in promoting the development of lateral buds. In terms of lateral bud development, the average number of lateral buds in transgenic plants was 15.67, while that in wild seedlings was only 10.3. In addition to the difference in the number of lateral buds, the growth of lateral buds in transgenic plants was also better than that in wild-type plants (see attached). Figure 4 ). The two strains differed significantly in plant height and lateral bud number. Cm382, Cm381 and wild-type tissue culture seedlings were transplanted into pots and the number of flower buds was observed. The number of flower buds in Cm382 and Cm381 strains was significantly higher than that in wild-type strains. CmRAX2 has the function of increasing the number of flower buds in chrysanthemum (see Appendix Figure 5 ).

Claims

1. Application of chrysanthemum transcription factor CmRAX2 protein or its encoding gene in promoting axillary bud growth or increasing the number of flower buds.

2. Chrysanthemum CmRAX2 protein, characterized in that It has: the amino acid sequence shown in SEQ ID No. 2; A gene encoding the protein according to claim 1, having a nucleotide sequence as shown in SEQ ID No.

1.

3. A biological material containing the gene according to claim 2, wherein the biological material is the cut chrysanthemum 'Shenma'.

4. A method for promoting the growth of axillary buds of chrysanthemum and increasing the number of flower buds, characterized in that: The method comprises the steps of increasing the protein expression level or mRNA transcription level of chrysanthemum transcription factor CmRAX2 in target plants.

5. The method according to claim 4, characterized in that: The method comprises the step of introducing the chrysanthemum transcription factor CmRAX2 into chrysanthemum.

6. The method according to claim 5, characterized in that: The introduction of the chrysanthemum transcription factor CmRAX2 is achieved by introducing the coding gene of the chrysanthemum transcription factor CmRAX2 protein.

7. The method according to claim 6, characterized in that: The introduction is carried out through Agrobacterium containing a recombinant vector, and the recombinant vector contains the coding gene of the chrysanthemum transcription factor CmRAX2 protein.

8. A method for promoting the growth of axillary buds of chrysanthemum and increasing the number of flower buds, characterized in that: The recombinant vector containing the CmRAX2 gene of claim 7 is introduced into the cut chrysanthemum 'Shenma', and positive transformation plants are obtained through resistance screening. The positive transformation plants are subjected to PCR identification and qRT-PCR detection to obtain the CmRAX2 gene-transfected cut chrysanthemum.

9. The method for cultivating chrysanthemums with increased lateral branches or flower buds according to claim 8, characterized in that: The process of PCR identification and semi-quantitative RT-PCR detection of positive transformed plants specifically includes the following steps: (1) PCR detection: Genomic DNA of wild-type plants and CmRAX2 gene-transfected resistant rooting plants were extracted to detect whether the plant expression vector was integrated into the plant genome. The primer sequences were as follows: Upstream primer 35S-F: GACGCACAATCCCACTATCC, downstream primer CmRAX-R: ATTACTCCCATCAATCATAG; PCR reaction was carried out with the extracted DNA as template and 35S-F and CmRAX-R as primers, and the amplified products were analyzed by agarose gel electrophoresis; (2) Real-time fluorescence quantitative qRT-PCR molecular detection: extract total RNA from leaves of plants selected in (1), digest genomic DNA, reverse transcribe to synthesize first-strand cDNA, and establish a real-time fluorescence quantitative qRT-PCR amplification system. The specific primer sequences are as follows: qCmRAX2-F: ACAACTGCTGAACGGGAAAT, qCmRAX2-R: AATCATAGACGGCTGGAAAAG; the internal reference gene used was EF1α, and the primer sequences were: CmEF1α-F: GACTGATGCGTTGATGAAGA, CmEF1α-R: TCATGAATACCAGCAGCT.

10. The method for cultivating chrysanthemums with increased lateral branches or flower buds according to claim 1, characterized in that: The phenotype of CmRAX2-overexpressing chrysanthemum was observed, and the specific steps were as follows: (1) After the chrysanthemum seedlings were grown in the culture medium for 30 days, they were pulled out from the culture medium and the chrysanthemum leaves were removed to count the plant height, number of nodes and number of lateral buds of the transgenic plants and wild-type chrysanthemums. 11.(2) The CmRAX2 overexpressing transgenic lines and WT with the same growth potential were propagated in large quantities, and the tissue culture seedlings were transplanted into a substrate with a ratio of vermiculite to nutrient soil of 3:1 for two weeks. After hardening, the seedlings were transplanted, and the number of flower buds was observed and recorded before flowering.

Images