Isothermal amplification detection method for hand-foot-and-mouth disease virus

Abstract

The invention discloses a hand-foot-and-mouth disease virus isothermal amplification detection method, and relates to the technical field of virus detection. The hand-foot-and-mouth disease virus isothermal amplification detection method comprises three steps, by adopting the LAMP technology, the specificity is high, the sensitivity is higher than that of a PCR detection method, the method is an improvement and supplement of an existing nucleic acid molecule detection technical means, the method has the advantages of being simple, rapid, high in sensitivity and high in specificity, primers are designed according to the specific sequence of the hand-foot-and-mouth virus, and the detection efficiency is improved. Compared with a traditional culture method, the method has the advantages that the specificity is higher, the sensitivity is high, the operation is simple and convenient, the price is low, the end point detection of an NASBA amplification result is realized by combining a handheld fluorescence detector while the real-time fluorescence detection is met, and the detection sensitivity reaches the fluorescent quantitative PCR level.

Description

Technical Field

[0001] The invention relates to the technical field of computer data processing, in particular to an isothermal amplification detection method for hand, foot and mouth disease virus. Background Art

[0002] Hand, foot and mouth disease (HFMD) is a common childhood infectious disease caused by enterovirus infection, which is common in children under 5 years old. HFMD is a global disease that occurs throughout the year in various parts of my country, with an incidence rate of 37.01 / 100,000 to 205.06 / 100,000. In recent years, the case fatality rate has been reported to be between 6.46 / 100,000 and 51.00 / 100,000. Enterovirus belongs to the genus Enterovirus of the family Picornaviridae. HFMD is caused by enterovirus, and the main pathogenic serotypes include Coxsackievirus (CV) A group 4-7, 9, 10, 16 and B group 1-3, 5, some serotypes of echovirus, and enterovirus 71 (Enterovirus A71, EV-A71, or EV 71), among which CV-A16 and EV-A71 are the most common, and severe and fatal cases are mostly caused by EV-A71.

[0003] The invention with publication number CN114058735A discloses a method for detecting hand, foot and mouth disease based on CRISPR technology, including the steps of detecting using gRNA, Cas protein and single-stranded nucleic acid detector, and the single-stranded nucleic acid detector can be single-stranded DNA, single-stranded RNA or single-stranded DNA-RNA hybrid.

[0004] As shown in the above invention, the existing hand, foot and mouth disease isothermal amplification result detection needs to be carried out on an expensive fluorescent quantitative PCR instrument. Currently, there are limited laboratories and hospitals in my country equipped with large-scale fluorescent quantitative PCR instruments, which cannot meet the needs of ports, grassroots and remote areas for EV71 virus detection. Summary of the invention

[0005] In view of the deficiencies in the prior art, the present invention provides an isothermal amplification detection method for hand, foot and mouth disease virus, which solves the existing problems.

[0006] To achieve the above objectives, the present invention is implemented through the following technical solutions: a hand, foot and mouth disease virus isothermal amplification detection method, comprising the following steps:

[0007] Step 1: Obtain saliva from the person to be tested and extract biomarkers from the saliva sample;

[0008] Step 2: prepare a reaction solution storage container, place isothermal amplification buffer, extracted biomarkers, primers, and reaction enzyme into the container, and prepare isothermal amplification reaction solution at a constant temperature;

[0009] Step 3: Synchronously detect the amplified products.

[0010] Preferably, the collection and processing refer to the methods of the "Hand, Foot and Mouth Disease Laboratory Testing Program" of the Ministry of Health.

[0011] Preferably, the RNA virus in the sample is extracted using the conventional Trizol method.

[0012] Preferably, the primers include a forward primer and a reverse primer;

[0013] The base sequence of the forward primer is SEQ ID No.1:

[0014] ACACAGGTGAGCAGTCATCG;

[0015] The base sequence of the reverse primer is SEQ ID No.2:

[0016] AATTCTAATACGACTCACTATAGGGAAGTCTCAATCATGCTCTCATCACT.

[0017] Preferably, the isothermal amplification buffer comprises Tris HCl 40 mM, KCl 70 mM, MgCl 2 12 mM, DTT 10 mM, dNTP 1 mM, rNTP 2 mM, and sorbitol 375 mM.

[0018] Preferably, the reaction enzyme consists of T7 RNA polymerase, AMV reverse transcriptase and RNase H.

[0019] Preferably, the constant temperature condition is a constant temperature water bath or heat block amplification or any heat preservation material at 60°C to 65°C for 15min to 20min.

[0020] Preferably, the method for detecting the amplification product comprises:

[0021] Method 1: Take out the reaction container, centrifuge at 8000r / min for 15 seconds, and observe whether there is white precipitation at the bottom of the tube;

[0022] Method 2: Take out the reaction container, centrifuge briefly, add 1.5% agarose gel electrophoresis, and observe whether ladder-shaped bands appear through gel imaging system;

[0023] Method 3: Take out the reaction container, cool it to room temperature, centrifuge it at 2000r / min for 15 seconds, add fluorescent dye, mix gently and then observe.

[0024] Preferably, the detectable signal is achieved by: vision-based detection, sensor-based detection, color detection, gold nanoparticle-based detection, fluorescence polarization, colloidal phase transition / dispersion, electrochemical detection and semiconductor-based detection.

[0025] Preferably, the method of the present invention also includes a step of measuring a detectable signal generated by a CRISPR / CAS effector protein (Cas protein), wherein the Cas protein can stimulate the cleavage activity of a single-stranded nucleic acid after recognizing the target nucleic acid or hybridizing with the target nucleic acid, thereby cleaving the single-stranded nucleic acid detector and generating a detectable signal.

[0026] Preferably, the detectable signal can be any signal generated when the single-stranded nucleic acid detector is cut, for example, gold nanoparticle-based detection, fluorescence polarization, colloidal phase change / dispersion, electrochemical detection, semiconductor-based sensing, and the detectable signal can be read out by any suitable means, including but not limited to: measurement of detectable fluorescence signals, gel electrophoresis detection (by detecting changes in bands on the gel), detection of the presence or absence of color based on vision or sensors, or differences in the presence of color (for example, based on gold nanoparticles) and differences in electrical signals.

[0027] Preferably, the detectable signal is achieved in the following manner: different reporter groups are respectively set at the 5' end and the 3' end of the single-stranded nucleic acid detector, and when the single-stranded nucleic acid detector is cut, a detectable reporter signal can be exhibited; for example, a fluorescent group and a quenching group are respectively set at the two ends of the single-stranded nucleic acid detector, and when the single-stranded nucleic acid detector is cut, a detectable fluorescent signal can be exhibited.

[0028] Preferably, the fluorescent group is selected from one or any several of FAM, FITC, VIC, JOE, TET, CY3, CY5, ROX, Texas Red or LCRED460; the quenching group is selected from one or any several of BHQ1, BHQ2, BHQ3, Dabcy1 or Tamra.

[0029] Preferably, the detectable signal can also be realized in the following manner: different labeling molecules are respectively arranged at the 5' end and the 3' end of the single-stranded nucleic acid detector, and the reaction signal is detected by colloidal gold detection.

[0030] Preferably, the measurement of the detectable signal may be quantitative, in other embodiments, the measurement of the detectable signal may be qualitative.

[0031] Preferably, loop-mediated isothermal amplification (LAMP) is a new nucleic acid isothermal amplification technology. The principle is to design 4 or 6 primers at multiple sites on the target gene fragment. Usually, only 4 primers are needed to complete the amplification of the target gene. If two additional loop primers are added, the entire reaction process can be effectively accelerated, but the increase in primers in the reaction system will also increase the formation of primer dimers. There are various methods for distinguishing the results of the LAMP reaction. Currently, electrophoresis, fluorescence, turbidimetry and calcein methods are commonly used. Turbidimetry and calcein methods are methods for detecting a large amount of pyrophosphate byproducts produced by the LAMP reaction. Therefore, both methods have a certain degree of background interference, and the interference intensity increases with the extension of the reaction time; electrophoresis and fluorescence methods use double-stranded chimeric dyes to directly detect the amplified product, so the background is lower, and the positive and negative of the fluorescence method can be distinguished by the naked eye, which has low technical requirements for operators and is more suitable for on-site rapid detection.

[0032] Beneficial Effects

[0033] The present invention provides a method for isothermal amplification detection of hand, foot and mouth disease virus. Compared with the prior art, it has the following beneficial effects:

[0034] 1. The hand, foot and mouth disease virus isothermal amplification detection method adopts LAMP technology, which has strong specificity and higher sensitivity than the PCR detection method. It is an improvement and supplement to the current nucleic acid molecule detection technology, and has the advantages of simplicity, rapidity, high sensitivity and high specificity.

[0035] 2. This isothermal amplification detection method for hand, foot and mouth disease virus, by designing primers for the hand, foot and mouth disease virus-specific sequence, has higher specificity, high sensitivity, simple operation and low price compared with the traditional culture method. While meeting the requirements of real-time fluorescence detection, it realizes endpoint detection of NASBA amplification results by combining with a handheld fluorescence detector, and the detection sensitivity reaches the level of fluorescence quantitative PCR. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 It is a schematic diagram of the structure of the method flow of the present invention;

[0037] Figure 2 A schematic diagram of the confirmatory diagnosis process of HFMD cases of the present invention;

[0038] Figure 3 It is a schematic diagram of the stability of the fluorescence detection results of the present invention. DETAILED DESCRIPTION

[0039] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0040] See Figure 1-3 , the present invention provides the following two technical solutions:

[0041] The first embodiment: a method for isothermal amplification detection of hand, foot and mouth disease virus, comprising the following steps:

[0042] Step 1: Obtain saliva from the person to be tested and extract biomarkers from the saliva sample. The collection and processing refer to the methods of the "Hand, Foot and Mouth Disease Laboratory Testing Program" of the Ministry of Health. The conventional Trizol method is used to extract biomarkers from the sample;

[0043] Step 2: Prepare a reaction solution storage container, place isothermal amplification buffer, extracted RNA virus, primers, and reaction enzyme into the container, and prepare isothermal amplification reaction solution at a constant temperature. The constant temperature condition is a constant temperature water bath or heat block amplification or any insulation material at 60°C to 65°C for 15min to 20min.

[0044] Step 3: Synchronously detect the amplification product. The detection method of the amplification product includes:

[0045] Method 1: Take out the reaction container, centrifuge at 8000r / min for 15 seconds, and observe whether there is white precipitation at the bottom of the tube;

[0046] Method 2: Take out the reaction container, centrifuge briefly, add 1.5% agarose gel electrophoresis, and observe whether ladder-shaped bands appear through gel imaging system;

[0047] Method 3: Take out the reaction container, cool it to room temperature, centrifuge it at 2000r / min for 15 seconds, add fluorescent dye, mix gently and then observe.

[0048] The above primers include a forward primer and a reverse primer;

[0049] The base sequence of the forward primer is SEQ ID No.1:

[0050] ACACAGGTGAGCAGTCATCG;

[0051] The base sequence of the reverse primer is SEQ ID No.2:

[0052] AATTCTAATACGACTCACTATAGGGAAGTCTCAATCATGCTCTCATCACT.

[0053] The above-mentioned isothermal amplification buffer includes Tris HCl 40mM, KCl 70mM, MgCl2 12mM, DTT 10mM, dNTP 1mM, rNTP 2mM, and sorbitol 375mM.

[0054] The above reaction enzyme is composed of T7 RNA polymerase, AMV reverse transcriptase and RNase H.

[0055] The second implementation method:

[0056] The present invention is useful for detecting the presence and / or amount of the protein biomarkers in saliva, as obtaining saliva samples involves non-invasive techniques, which will facilitate easier collection of samples from patients such as infants, toddlers and young children, who constitute the majority of those affected and afflicted by HFMD. Given the rapid spread of the disease in schools and daycare centers, it is important to easily and quickly screen these infants, toddlers and children on a daily basis so that any infection can be quickly detected before the disease spreads to others in the school or daycare center. Rapid diagnosis can keep infected children away from the school population, thereby minimizing or preventing the spread of the disease. This means that it would be advantageous to have a non-invasive method for detecting the disease. The present invention provides this advantage by allowing the detection of the disease using saliva samples obtained from children. The saliva samples do not require any processing prior to the present detection method. In addition, the present method does not have to be performed by a medical professional, but can be easily and easily performed and carried out by parents and school teachers, i.e., point-of-care testing. In contrast, blood collection from children for HFMD diagnosis is challenging and needs to be performed under clinical conditions.

[0057] "Biomarker" is meant to include any molecular indicator having a specific biological property, biochemical feature or aspect that can be used to measure disease progression or treatment efficacy. Proteins and nucleic acids are exemplary biomarkers. In particular, it is generally accepted that genomic messengers detected outside cells can be used as biomarkers of disease. In particular, nucleic acids have been identified in most body fluids, including blood, urine, and cerebrospinal fluid, and have been successfully used as diagnostic biomarkers of disease. However, saliva is not a passive "ultrafiltrate" of serum, but a unique composition containing enzymes, hormones, antibodies and other molecules. Specific and informative biomarkers in saliva are expected to be used to diagnose disease and monitor human health. For example, biomarkers for monitoring dental caries, periodontitis, oral cancer and salivary gland diseases have been identified in saliva.

[0058] Design the corresponding detection primer sequence according to the sequence characteristics of the target to be detected.

[0059] The sequence characteristics of the target to be tested specifically include: GC content, sequence conservation, sequence secondary structure and other characteristics of the sequence to be tested.

[0060] The primer sequence features are specifically: two nucleic acid sequences designed for the target sequence, with species specificity and high amplification efficiency, one of which contains a T7 RNA polymerase initiation sequence.

[0061] In an embodiment, at least one biomarker in the test sample is labeled with a detectable moiety. The detectable moiety can be selected from the group consisting of: a fluorescent moiety, a luminescent moiety, a chemiluminescent moiety, a radioactive moiety, and an enzymatic moiety.

[0062] A "detectable moiety" is meant to include any moiety that can be detected and the relative amount and / or location of the moiety can be determined. A detectable moiety can be a fluorescent and / or luminescent and / or chemiluminescent moiety that can be detected when exposed to specific conditions. For example, a fluorescent moiety may need to be exposed to radiation (i.e., light) of a specific wavelength and intensity to cause excitation of the fluorescent moiety, thereby enabling it to emit detectable fluorescence at a specific wavelength that can be detected.

[0063] In various embodiments, the detectable moiety is a gold colloid.Alternatively, or additionally, the antibodies used in the present invention may be coupled to colloidal gold or gold nanoparticles.

[0064] Alternatively, the detectable moiety may be an enzyme capable of converting a (preferably non-detectable) substrate into a detectable product that can be observed and / or detected. Examples of suitable enzymes used may be those known for use in assays such as ELISA.

[0065] Alternatively, the detectable moiety can be a radioactive atom that can be used for imaging. Suitable radioactive atoms include Tc and I for scintigraphic studies. Other easily detectable moieties include, for example, spin labels for magnetic resonance imaging (MRI), such as I, I, In, F, C, N, O, gadolinium, manganese or iron, which are again included. Obviously, the reagent to be detected (such as, for example, one or more proteins in the test sample and / or control sample described herein and / or the antibody molecule for detecting the selected protein) must have enough appropriate atomic isotopes to make the detectable moiety easy to detect.

[0066] Radioactive or other labels can be incorporated into the reagents of the invention (i.e., proteins present in the sample of the method of the invention and / or the binding agent of the invention) in a known manner. For example, if the binding moiety is a polypeptide, it can be biosynthesized, or can be synthesized by chemical amino acid synthesis methods using suitable amino acid precursors, the precursors including, for example, fluorine-19 instead of hydrogen, such as Tc, I, Rh, Rh and In labels can be attached, for example, through cysteine ​​residues in the binding moiety. Yttrium-90 can be attached through lysine residues. The iodogen method (Fraker et al (1978) Biochem. Biophys. Res. Comm. 80, 49-57) can be used to incorporate I. Reference ("Monoclonal Antibodies in Immunoscintigraphy", J-FChatal, CRC Press, 1989) describes other methods in detail. Methods for conjugating other detectable moieties (eg, enzymatic, fluorescent, luminescent, chemiluminescent, or radioactive moieties) to proteins are well known in the art.

[0067] In various embodiments, a step of detecting the presence and / or amount of at least one protein biomarker is performed using lateral flow chromatography. Such detection is a simple cellulose-based device intended to detect the presence (or absence) of a target analyte in a liquid sample (matrix) (in the current example, saliva) without the need for dedicated and expensive equipment. Representatively, these tests are used for medical diagnosis for home testing, point-of-care testing, or laboratory use. The technology is based on a series of capillary beds, such as porous paper, microstructured polymers, or sintered polymers. Each of these elements has the ability to spontaneously transmit saliva.

[0068] The single-stranded nucleic acid detector generates a first detectable signal before being cleaved by the Cas protein, and generates a second detectable signal different from the first detectable signal after being cleaved.

[0069] In other embodiments, the single-stranded nucleic acid detector includes one or more modifications, such as base modifications, backbone modifications, sugar modifications, etc., to provide new or enhanced features (such as improved stability) to the nucleic acid. Examples of suitable modifications include modified nucleic acid backbones and non-natural internucleoside linkages, and nucleic acids with modified backbones include those that retain phosphorus atoms in the backbone and those that do not have phosphorus atoms in the backbone. Suitable modified oligonucleotide backbones containing phosphorus atoms include phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkylphosphonates. In some embodiments, the single-stranded nucleic acid detector contains one or more phosphorothioates and / or heteroatom nucleoside bonds. In other embodiments, the single-stranded nucleic acid detector can be a nucleic acid mimetic; in certain embodiments, the nucleic acid mimetic is a peptide nucleic acid (PNA), another type of nucleic acid mimetic is based on a linked morpholinyl unit (morpholinyl nucleic acid) having a heterocyclic base attached to a morpholine ring, and other nucleic acid mimics also include cyclohexenyl nucleic acids (CENA), and also include ribose or deoxyribose chains.

[0070] General Definition:

[0071] Unless defined otherwise, technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art.

[0072] The term "amino acid" refers to a carboxylic acid containing an amino group. Various proteins in living organisms are composed of 20 basic amino acids.

[0073] The terms "polynucleotide", "nucleotide sequence", "nucleic acid sequence", "nucleic acid molecule" and "nucleic acid" are used interchangeably and include DNA, RNA or hybrids thereof, which may be double-stranded or single-stranded.

[0074] The term "oligonucleotide" refers to a sequence containing 3-100 nucleotides, preferably, 3-30 nucleotides, preferably, 4-20 nucleotides, more preferably, 5-15 nucleotides.

[0075] The terms "homology" or "identity" are used to refer to the match between two polypeptides or between two nucleic acids when a certain position in the two sequences being compared contains the same base or amino acid monomer.

[0076] When the subunits are occupied (for example, a position in each of the two DNA molecules is occupied by adenine, or a position in each of the two polypeptides is occupied by lysine), then the molecules are identical at that position. Between two sequences. Usually, the comparison is made when the two sequences are aligned to produce maximum identity. Such an alignment can be made by using, for example, the identity of the amino acid sequence can be determined by conventional methods, with reference to, for example, Smith and Waterman, 1981, Adv. Appl. Math. 2: 482 Pearson & Lipman, 1988, Proc. Natl Acad. Sci. USA 85: 2444, Thompson et al., 1994, Nucleic Acids Res 22: 467380, etc., by computerized operation of algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group). It can also be determined using the BLAST algorithm available from the National Center for Biotechnology Information (NCBI www.ncbi.nlm.nih.gov / ) using default parameters.

[0077] As used herein, the "CRISPR" refers to Clustered regularly interspaced short palindromic repeats, which are derived from the immune system of microorganisms.

[0078] LAMP is also known as the loop-mediated isothermal amplification (LAMP) method (WO00 / 28082). The LAMP method was developed by Notomi et al. and can be performed at a constant temperature. In this method, the 3' end of the template nucleotide is annealed, and the complementary chain is synthesized from there, and a primer that anneals to the loop formed by the above synthesis is used in combination. This allows nucleic acid amplification to be performed under isothermal conditions. In the LAMP method, the 3' end of the primer is always annealed to a region derived from the sample, and thus, a mechanism for verifying complementary bonding of nucleotide sequences is repeatedly activated. As a result, highly sensitive and specific nucleic acid amplification is achieved.

[0079] Hand, foot and mouth disease is caused by enterovirus, mainly including Coxsackievirus (CV) A group 4-7, 9, 10, 16 and B group 1-3, 5, some serotypes of Echovirus and enterovirus 71 (Enterovirus A71, EV-A71, or EV 71), among which CV-A16 and EV-A71 are the most common, and severe and fatal cases are mostly caused by EV-A71. Preferably, in the present invention, detecting hand, foot and mouth disease refers to detecting enterovirus 71 (Enterovirus A71, EV-A71, or EV 71).

[0080] The "Cas protein" described herein refers to a CRISPR-associated protein, preferably a CRISPR / CAS protein from type V or type VI, which, once bound to a characteristic sequence (target sequence) to be detected (i.e., forming a ternary complex of Cas protein-gRNA-target sequence), can induce its trans activity, i.e., randomly cutting non-targeted single-stranded nucleotides (i.e., the single-stranded nucleic acid detector described herein, preferably single-stranded DNA (ssDNA), single-stranded DNA-RNA hybrid, single-stranded RNA). When the Cas protein binds to a characteristic sequence, it can induce its trans activity by cutting or not cutting the characteristic sequence; preferably, it induces its trans activity by cutting the characteristic sequence; more preferably, it induces its trans activity by cutting the single-stranded characteristic sequence.

[0081] It should be noted that, in this article, relational terms such as first and second, etc. are only used to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Moreover, the terms "include", "comprise" or any other variants thereof are intended to cover non-exclusive inclusion, so that a process, method, article or device including a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements inherent to such process, method, article or device.

[0082] Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to the embodiments without departing from the principles and spirit of the present invention, and that the scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A method for isothermal amplification detection of hand, foot and mouth disease virus, It is characterized in that The following steps are involved: Step 1: Obtain saliva from the person to be tested and extract biomarkers from the saliva sample; Step 2: prepare a reaction solution storage container, place isothermal amplification buffer, extracted biomarkers, primers, and reaction enzyme into the container, and prepare isothermal amplification reaction solution at a constant temperature; Step 3: Synchronously detect the amplified products.

2. The isothermal amplification detection method for hand, foot and mouth disease virus according to claim 1, Features: The collection and processing are based on the methods of the Ministry of Health's "Laboratory Testing Program for Hand, Foot and Mouth Disease".

3. The isothermal amplification detection method for hand, foot and mouth disease virus according to claim 1, Features: The biomarkers in the samples were extracted using the conventional Trizol method.

4. The isothermal amplification detection method for hand, foot and mouth disease virus according to claim 1, Features: The primers include a forward primer and a reverse primer; The base sequence of the forward primer is SEQ ID No.1: ACACAGGTGAGCAGTCATCG; The base sequence of the reverse primer is SEQ ID No.2: AATTCTAATACGACTCACTATAGGGAAGTCTCAATCATGCTCTCATCACT.

5. The isothermal amplification detection method for hand, foot and mouth disease virus according to claim 1, Features: The isothermal amplification buffer comprises Tris HCl 40 mM, KCl 70 mM, MgCl 2 12 mM, DTT 10 mM, dNTP 1 mM, rNTP 2 mM, and sorbitol 375 mM.

6. The isothermal amplification detection method for hand, foot and mouth disease virus according to claim 1, Features: The reaction enzyme consists of T7 RNA polymerase, AMV reverse transcriptase and RNase H.

7. The isothermal amplification detection method for hand, foot and mouth disease virus according to claim 1, Features: The constant temperature condition is a constant temperature water bath or heat block amplification or any heat preservation material at 60° C. to 65° C. for 15 min to 20 min.

8. The isothermal amplification detection method for hand, foot and mouth disease virus according to claim 1, Features: The detection method of the amplification product comprises: Method 1: Take out the reaction container, centrifuge at 8000r / min for 15 seconds, and observe whether there is white precipitation at the bottom of the tube; Method 2: Take out the reaction container, centrifuge briefly, add 1.5% agarose gel electrophoresis, and observe whether ladder-shaped bands appear through gel imaging system; Method 3: Take out the reaction container, cool it to room temperature, centrifuge it at 2000r / min for 15 seconds, add fluorescent dye, mix gently and then observe.

Images