Marker and reagent for diagnosing cervical cancer, application and medicine for inhibiting tumor cells

Abstract

In order to solve the problem that in the prior art, the action mechanism of a DSG2 gene in DHA treatment of cervical cancer is unclear, the invention provides a marker for diagnosing cervical cancer, a reagent, application and a medicine for inhibiting tumor cells. The marker for diagnosing cervical cancer is a DSG2 gene, the DSG2 gene comprises a positive-sense strand and an antisense strand corresponding to the positive-sense strand, the positive-sense strand is selected from a sequence 1, and the antisense strand is selected from a sequence 2. According to the cervical cancer marker provided by the invention, the DSG2 gene is used as the cervical cancer diagnosis marker for prognosis evaluation and drug preparation of cervical cancer; through a series of experimental verification, the inventor finds that the DSG2 gene is closely related to occurrence and development of cervical cancer and has diagnosis and treatment values, so that the important significance of the DSG2 gene in tumor cell injury caused by DHA (docosahexaenoic acid) is defined, the DSG2 gene becomes an auxiliary target spot for cervical cancer drug treatment, and the application prospect is broad. A new thought is provided for treating cervical cancer by prolonging the curative effect of the medicine.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to a marker, reagent, application and drug for diagnosing cervical cancer and inhibiting tumor cells. Background Art

[0002] Tumor biomarkers are a series of substances that reflect the occurrence, development and prognosis of a disease. They are widely used in the clinic for early diagnosis, treatment monitoring and prognosis assessment of the disease. The development of biomarkers for diagnosing tumors and monitoring the treatment effects of tumor patients is crucial to improving the survival rate of patients. In addition, studying key tumor gene targets is a common means to improve the effectiveness of tumor treatment.

[0003] The DSG2 gene is a transmembrane desmosomal cadherin. As the main protein with cell adhesion in the desmosomal structure, its functional loss can lead to weakened cell adhesion ability, which is closely related to the epithelial-mesenchymal transition, invasion and migration of tumor cells. At the same time, as a transmembrane glycoprotein on the cell surface, the DSG2 gene can receive signals inside and outside the cell and produce different effects on tumor cells through different signal pathways. It has different functions in different cancers and can be used as both an oncogene and a tumor suppressor. As the main protein with cell adhesion in the desmosomal structure, the DSG2 gene functional loss can lead to weakened cell adhesion ability, which is closely related to the epithelial-mesenchymal transition, invasion and migration of tumor cells. Dihydroartemisinin (DHA), a derivative of artemisinin, has strong pharmacological activity in the human body, and its application in tumor treatment is a current research hotspot. DHA can cause cell cycle arrest in the G0 / G1 phase or the G2 / M phase and activate apoptosis factors to promote cell apoptosis when acting on tumor cells. Compared with traditional anti-tumor drugs, DHA has a significant effect on tumors and less toxicity to normal cells. However, the mechanism of action of DSG2 gene in DHA treatment of cervical cancer remains unclear. Summary of the invention

[0004] In view of the problem that the mechanism of action of DSG2 gene in DHA treatment of cervical cancer is unclear in the prior art, a marker, reagent, application and drug for diagnosing cervical cancer and inhibiting tumor cells are provided.

[0005] The technical solution adopted by the present invention to solve the above technical problems is as follows: On the one hand, the present invention provides a marker for diagnosing cervical cancer, wherein the marker is the DSG2 gene, wherein the DSG2 gene comprises a sense chain and an antisense chain corresponding to the sense chain, wherein the sense chain is selected from "Sequence 1" and the antisense chain is selected from "Sequence 2".

[0006] Optionally, cloning primers and specific primers of the DSG2 gene are also included, the cloning primers include "sequence 3", "sequence 4", "sequence 5" and "sequence 6", and the specific primers include "sequence 7" and "sequence 8".

[0007] In another aspect, the present invention provides a reagent comprising the reagent for diagnosing the marker level of cervical cancer.

[0008] Optionally, the reagents include cloning primers and specific primers of the DSG2 gene, the cloning primers include "Sequence 3", "Sequence 4", "Sequence 5" and "Sequence 6", and the specific primers include "Sequence 7" and "Sequence 8".

[0009] Optionally, the reagent further comprises one or more of a buffer, a protective agent, a preservative, a cosolvent, an osmotic pressure regulator and a pH regulator.

[0010] Optionally, the kit comprises one or more of an antibody and a probe.

[0011] On the other hand, the reagent provided by the present invention is used in the preparation of a product for diagnosing or assisting in the diagnosis of cervical cancer.

[0012] On the other hand, the present invention provides a drug for inhibiting tumor cells, including a CRISPR gene editing therapeutic drug or an antisense nucleic acid drug that blocks the normal transcription or post-transcriptional translation of the DSG2 gene.

[0013] Optionally, dihydroartemisinin is also included.

[0014] Optionally, the method of blocking the normal transcription or post-transcriptional translation of the DSG2 gene includes one or more of CRISPR / Cas9 gene editing and RNA interference.

[0015] Optionally, the tumor cells include cervical cancer cells.

[0016] The beneficial effects of the present invention are: The present invention provides a marker for cervical cancer, and uses the DSG2 gene as a marker for diagnosing cervical cancer to perform prognosis evaluation and drug preparation for cervical cancer. The inventors have verified through a series of experiments that when DHA is used as an inducer of cervical cancer cell damage, the ectopic expression of the DSG2 gene changes the expression of many genes involved in cell cycle regulation and cancer development, and participates in regulating tumor cell proliferation and tumorigenesis, and it is found that the overexpressed DSG2 gene can resist the damaging effect of DHA on cervical cancer cells, that is, the DSG2 gene is closely related to the occurrence and development of cervical cancer and has diagnostic and therapeutic value, thereby clarifying the important significance of the DSG2 gene in tumor cell damage caused by DHA, making the DSG2 gene an auxiliary target for cervical cancer drug treatment, and providing a new idea for the treatment of cervical cancer by prolonging the drug efficacy. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 It is the detection result of the DSG2 gene PCR product of Hela cells provided in the embodiment of the present invention; Figure 2 This is the pLentiCRISPRv2-DSG2-sgRNA plasmid extraction test result provided in the embodiment of the present invention; Figure 3 This is the result of restriction enzyme digestion verification of the pLentiCRISPRv2-DSG2-sgRNA plasmid provided in the embodiment of the present invention; Figure 4 This is the verification result of the DSG2 gene knockout polyclonal cell line T7EI provided in the embodiment of the present invention; Figure 5 It is the DSG2 target gene amplification result provided by the embodiment of the present invention; Figure 6 It is the verification result of the second round PCR product of the DSG2 gene and the pLentiCRISPRv2 linearization product provided in the embodiment of the present invention; Figure 7 is the pLentiCRISPRv2-DSG2 screening result provided by the embodiment of the present invention; Figure 8 The DSG2 gene expression level in three groups of cell lines, namely, empty cell line, overexpression cell line and knockout cell line, is determined according to the embodiment of the present invention; Fig. 9 The CCK-8 experiment detected the effect of different concentrations of DHA on the proliferation inhibition rate of three groups of HeLa cells; (A: 24 h; B: 48 h; C: 72 h) Fig.10 The detection of the activity of DHA in inhibiting the proliferation of HeLa cells provided by the embodiment of the present invention; (A: HeLa-EV; B: HeLa-DSG2; C: HeLa-KO) Effects on cell proliferation activity in three groups; D: Crystal violet absorbance curves of three groups of cells; * P <0.05,** P <0.01,*** P <0.001, x40) Fig.11 The test results of the effects of DHA on HeLa cell migration rate at different time periods provided by the embodiments of the present invention; (* P <0.05,** P <0.01,*** P <0.001, ns is not significant; x40) Fig.12 The number of cells invaded by the Transwell assay for 48 h provided in the embodiment of the present invention; (** P <0.01, x100) Fig.13 The HeLa cell cycle distribution detection of DSG2 differential expression provided by the embodiment of the present invention; (* P <0.05,** P <0.01) Fig.14 It is the KEGG functional enrichment analysis provided by the embodiment of the present invention; (A: HeLa-EV vs. HeLa-EV-DHA; B: HeLa-EV-DHA vs. HeLa-DSG2-DHA; C: HeLa-EV-DHA vs. HeLa-KO-DHA) Fig.15 The detection of the expression of PI3K, AKT, p53, ATM and H2AX mRNA in three groups of HeLa cells by DHA provided in the embodiment of the present invention; (#, *P<0.05; ##, **P<0.01; ###, ***P<0.001; *: intra-group comparison, #: inter-group comparison) Fig.16 The detection of the relative expression of PI3K, AKT, p53, ATM and H2AX mRNA in three groups of HeLa cells by DHA provided in the embodiment of the present invention; (*P<0.05; **P<0.01; ***P<0.001) Fig.17 The expression detection of DSG2 protein in cervical cancer and adjacent tissue chips provided by the embodiment of the present invention; (IHC, X10, X200) DETAILED DESCRIPTION In order to make the technical problems, technical solutions and beneficial effects solved by the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0018] An embodiment of the present invention provides a marker for diagnosing cervical cancer, wherein the marker is the DSG2 gene, and the DSG2 gene includes a sense chain and an antisense chain corresponding to the sense chain, the sense chain is selected from "sequence 1", and the antisense chain is selected from "sequence 2".

[0019] Specifically, the present invention provides a marker for cervical cancer, and uses the DSG2 gene as a marker for diagnosing cervical cancer to perform prognosis assessment and drug preparation for cervical cancer. The inventors have verified through a series of experiments that when DHA is used as an inducer of cervical cancer cell damage, the ectopic expression of the DSG2 gene changes the expression of many genes involved in cell cycle regulation and cancer development, and participates in regulating tumor cell proliferation and tumorigenesis. It is found that the overexpressed DSG2 gene can resist the damaging effect of DHA on cervical cancer cells, that is, the DSG2 gene is closely related to the occurrence and development of cervical cancer, and has diagnostic and therapeutic value. This further clarifies the important significance of the DSG2 gene in tumor cell damage caused by DHA, making the DSG2 gene an auxiliary target for drug treatment of cervical cancer, and providing a new idea for the treatment of cervical cancer by prolonging the efficacy of drugs.

[0020] Specifically, the positive strand of the DSG2 gene (sequence 1) is: CGCCTGGATCACCGCCCCCG; The antisense strand of the DSG2 gene (sequence 2) is: CTCCCTCCCGAAGAGCCACG; Specifically, the DSG2 gene sequence information NM_001943.5 was searched in the National Center for Biotechnology Information (NCBI), and the gene name and sequence information were input into the GPP Web Portal 1 website to design the sense strand and antisense strand of the DSG2 gene.

[0021] Another embodiment of the present invention provides a reagent, including a reagent for diagnosing the marker level of cervical cancer.

[0022] Specifically, a series of experiments in the present invention have demonstrated that DSG2 is involved in regulating tumor cell proliferation and tumorigenesis, and overexpressed DSG2 can resist the damage of DHA to cells. Based on the research results, when the reagent provided by the present invention includes the markers for diagnosing cervical cancer, the expression level of the DSG2 gene in the corresponding sample can be efficiently detected and quantified through relevant molecular identification technology, that is, the use of the reagent is not only conducive to improving the sensitivity and specificity of cervical cancer detection, but also can provide important clinical application value for the early diagnosis and prognosis evaluation of cervical cancer by regularly detecting the expression changes of the DSG2 gene.

[0023] In some embodiments, the reagents include cloning primers and specific primers of the DSG2 gene, the cloning primers include "sequence 3", "sequence 4", "sequence 5" and "sequence 6", and the specific primers include "sequence 7" and "sequence 8".

[0024] The cloning primers of the DSG2 gene are specifically "SEQ ID NO: 3" - "SEQ ID NO: 6": Sequence 3 is: CACCGCGCCTGGATCACCGCCCCCG; Sequence 4 is: AAACCGGGGGCGGTGATCCAGGCGC; Sequence 5 is: CACCGCTCCCTCCCGAAGAGCCACG; Sequence 6 is: AAACCGTGGCTCTTCGGGAGGGAGC; The specific primers of the DSG2 gene are specifically "sequence 7" to "sequence 8"; Sequence 7 is: GAACACAGGACCGGTTCTAGAGCGCTGCCACCATGGCCGGGAGCCCGGGA; Sequence 8 is: GAACACAGGACCGGTTCTAGAGCGCTGCCACCATGGCCGGGAGCCCGGGA; The design of the above primers can specifically amplify the positive and antisense strands of the DSG2 gene in the PCR reaction, thereby helping to accurately quantify the expression level of the DSG2 gene, so as to more effectively monitor the expression changes of the DSG2 gene in cervical cancer cells and further evaluate its role in the development of the disease.

[0025] In some embodiments, the reagent further comprises one or more of a buffer, a protective agent, a preservative, a co-solvent, an osmotic pressure regulator, and a pH regulator.

[0026] The reagent not only includes DSG2 gene-related reagents for diagnosing cervical cancer, but also further includes a series of auxiliary additives to ensure the stability and reliability of the detection process of the kit; Specifically, the buffer is used to maintain the pH stability of the reaction system to ensure that PCR amplification and other chemical reactions are carried out under optimal conditions; the protective agent is used to protect the active ingredients in the reagents to prevent them from degradation during storage or transportation; the preservative prevents microbial contamination and extends the shelf life of the kit; the cosolvent helps dissolve difficult-to-dissolve reagent components and improves reaction efficiency; the osmotic pressure adjuster adjusts the osmotic pressure of the reaction system to adapt to the processing requirements of cell or tissue samples; the pH adjuster accurately adjusts the pH value of the reaction system to meet the pH requirements of specific experimental steps.

[0027] In some embodiments, the reagents include one or more of antibodies and probes.

[0028] The reagent contains a probe that hybridizes with the nucleotide sequence of the DSG2 gene, or an antibody or antibody fragment that specifically binds to DSG2, or contains a specific primer for amplifying the DSG2 gene.

[0029] In some embodiments, the reagent is used in the preparation of a product for diagnosing or assisting in the diagnosis of cervical cancer.

[0030] Specifically, the reagent can detect the messenger RNA transcribed from the DSG2 gene or the protein encoded by the DSG2 gene through RT-PCR, real-time quantitative PCR, digital PCR, fluorescent dye method, resonance light scattering method, sequencing or biomass spectrometry, in situ hybridization, Northern blotting, chip, high-throughput sequencing platform, immunohistochemistry or enzyme-linked immunosorbent assay; by providing the above reagents, not only the popularization and application of cervical cancer diagnosis technology is promoted, but also it helps to improve the accuracy and repeatability of diagnosis.

[0031] Specifically, the detection sample of the reagent can be serum, plasma, cells, cell culture supernatant, cervical exfoliated cells, epithelial cells, urine, tissue or tissue lysate; further, when the detection sample of the reagent is selected from cells, the cells can be cultured in a culture medium and then the DSG2 gene in the cells is knocked out to obtain the cells, and the cells can also be obtained by knocking out the DSG2 gene in the cells using CRISPR / Cas9 technology.

[0032] In other embodiments, the present invention provides a drug for inhibiting tumor cells, including a CRISPR gene editing therapeutic drug or an antisense nucleic acid drug that blocks the normal transcription or post-transcriptional translation of the DSG2 gene.

[0033] Specifically, the drug for inhibiting the growth of cervical cancer cells provided by the present invention targets the diagnostic marker of the DSG2 gene and blocks the normal transcription or post-transcriptional translation process of the DSG2 gene through a specific molecular mechanism, thereby achieving the effect of treating cervical cancer.

[0034] In some embodiments, the method of blocking the normal transcription or post-transcriptional translation of the DSG2 gene comprises one or more of CRISPR / Cas9 gene editing and RNA interference.

[0035] Specifically, the CRISPR / Cas9 is used to knock out / overexpress the DSG2 gene to construct a stable cell line, including the following operations: S1: Screening of resistant cell concentration; S2: Design the sense and antisense strands of the DSG2 gene; S3: Amplification and verification of DSG2 gene; S4: synthetic sgRNA cloning primers; S5: construct vector and extract plasmid; S6: Transfected cells and positive cell screening; S7: Western blotting to detect DSG2 overexpression and knockout.

[0036] Specifically, by performing Western blot verification on Hela cell lines with knockout and overexpression of the DSG2 gene, it was found that compared with the empty group, the expression of DSG2 gene in Hela cells overexpressing the DSG2 gene was significantly increased, while the expression of DSG2 gene in Hela cells with knockout of the DSG2 gene was significantly decreased, indicating that the stable cell lines with knockout and overexpression of the DSG2 gene were successfully constructed using the CRISPR / Cas9.

[0037] The CRISPR gene editing therapeutic drug uses the CRISPR-Cas9 system or other gene editing technologies to precisely target and cut the DSG2 gene, thereby destroying its coding sequence and preventing the normal expression of the gene. This method can be operated directly at the genome level with high specificity and efficiency; antisense nucleic acid drugs, by designing specific antisense oligonucleotides, complementarily bind to the mRNA of the DSG2 gene, induce RNase H to degrade mRNA or hinder ribosome binding, thereby blocking the translation process of mRNA and reducing the production of DSG2 protein.

[0038] Although the mechanisms of action of the two drugs mentioned above are different, they both aim to inhibit the growth and spread of cervical cancer cells by downregulating the expression of the DSG2 gene. Since the DSG2 gene plays a key role in the occurrence and development of cervical cancer, this DSG2 gene-based drug development not only provides a new approach for the treatment of cervical cancer, but may also have potential therapeutic value for other cancer types associated with the DSG2 gene.

[0039] In some embodiments, the tumor cells comprise cervical cancer cells.

[0040] Specifically, the study found that the ectopic expression of the DSG2 gene will change the expression of genes related to cell cycle regulation and cancer development, and participate in the regulation of tumor cell proliferation and tumor occurrence. When the expression of the DSG2 gene is downregulated, the proliferation and survival of cervical cancer cells can be indirectly inhibited. Therefore, the tumor cell inhibition drug provided by the present invention for the treatment of the DSG2 gene may also have potential application and therapeutic value for other types of cancer.

[0041] The present invention is further described below by way of examples.

[0042] 1. Construction of stable cell lines by knocking out DSG2 gene using CRISPR / Cas9 technology 1) Puromycin resistance cell screening concentration experiment: Screening of eukaryotic or prokaryotic polyclonal or monoclonal cells that can express the pac gene (puror) through plasmid transfection / transformation, viral infection, etc.; 2) Design of sgRNA: sgRNA1 (5´→3´): CGCCTGGATCACCGCCCCCG (sequence 1); sgRNA2 (5´→3´): CTCCCTCCCGAAGAGCCACG (sequence 2); 3) Amplification of DSG2 gene verification: agarose gel electrophoresis 4) Synthesis of sgRNA cloning primers: Design lentiCRISPRv2-sgRNA cloning primers based on sgRNA: Table 1 5) Vector and primer connection: This experiment was carried out according to the T4 polynucleotide kinase kit (T4 PNK) of NEB Company, USA. The subsequent experiments were carried out according to the instructions of the reagent. 6) Plasmid extraction and virus packaging: follow the instructions of the endotoxin-free plasmid medium extraction kit. 7) Transfected cells and positive cell screening: Take complete medium containing 10µg / ml Polybrene (polybrene, which improves the infection efficiency of lentivirus and adenovirus to cells) and culture cells in the logarithmic growth phase (70-80%). After adding 500µl of virus solution, immediately add Hela cell suspension to mix thoroughly. After 2 days of transfection, add complete medium containing 1.5μg / ml puromycin and continue culturing. After 3 days of screening, the control cells died, and the positive cells in the screening experimental group were expanded and cultured.

[0043] 1.2 Construction of stable cell lines overexpressing DSG2 gene using CRISPR / Cas9 technology 1) Target design is the same as step 1.1 above 2) Amplification of DSG2 gene: sequence (5`→3`) Upstream primer (SEQ ID NO: 7): GAACACAGGACCGGTTCTAGAGCGCTGCCACCATGGCCGGGAGCCCGGGA Downstream primer (SEQ ID NO: 8): TCTTTATAATCACCGTCATGGTCTTTGTAGTCGCCGGATCCGGAGTAAGAATGCTGTACAGTGC 3) Add tags and homologous sequences: Use the first-round PCR product of DSG2 as a template and add a FLAG tag to the gene sequence at the C-terminus of the DSG2 protein.

[0044] C-terminal primer (5`→3`): gaagtttgttgcgccggagcccttgtcatcgtcatccttgtaatcgatgtcatgatctttataatcaccgtcatgg.

[0045] 4) Double-cut plasmid recombination: Use XbaI and BamHI enzymes to verify whether the DSG2 target gene is present: follow the instructions of NEB's XbaI and BamHI enzyme cutting kit.

[0046] 5) Gel excision and purification of positive fragments 6) Ligation of DSG2 gene and linearized vector: Perform subsequent experiments according to the reagent instructions of ClonExpress II one step cloning Kit.

[0047] 7) Endotoxin-free plasmid extraction and virus packaging of LentiCRISPRv2-sgRNA and LentiCRISPRv2-DSG2: follow the instructions of the Endotoxin-free Plasmid Midi Extraction Kit.

[0048] 8) Transfected cells and positive cell screening: Take complete medium containing 10µg / ml Polybrene and culture cells in the logarithmic growth phase (70~80%), add 500µl of virus solution and immediately add Hela cell suspension to mix thoroughly. Add complete medium containing 1.5μg / ml puromycin to continue culturing 2 days after transfection. After 3 days of screening, the control cells die, and the positive cells in the screening experimental group are expanded and cultured.

[0049] The results showed that: 1. After Taq enzyme amplification of DSG2 gene, agarose gel electrophoresis showed no non-specific products, and good amplification effect was observed at around 50°C, and the electrophoresis bands were clear ( Figure 1 ); 2. The plasmid extraction gel results of the cell colonies transformed with SgRNA1 and SgRNA2 indicated that the target product was about 13kb ( Figure 2 ); 3. Take three cloning sites from each pLentiCRISPRv2-DSG2-sgRNA plasmid and perform BsmBI enzyme digestion test: the original plasmid pLentiCRISPRv2 (EDV0005) was not cut, but the remaining six vector bands showed obvious differences. Select two samples from pLentiCRISPRv2-DSG2-sgRNA1 and pLentiCRISPRv2-DSG2-sgRNA2 respectively ( Figure 3 ); 4. Gene knockout positive clone cell line verification - T7E1 experiment: Comparing the Hela T7E1 enzyme group with the Hela non-digested group, it was found that the control group (WT wild type) in the Hela digested group did not cut, and the gene knockout positive clones all showed two obvious bands, indicating that the SgRNA position was mutated and mutants existed. The SgRNA1 digestion product was 220+326bp, and the SgRNA2 digestion product was 226+320bp ( Figure 4 ); 5. DSG2 target gene amplification ( Figure 5 ); 6. Double enzyme excision of the second round of PCR products of the DSG2 gene and the pLentiCRISPRv2 vector: The linearized product of pLentiCRISPRv2 can be digested by XbaI and BamHI. The size of the PCR product is about 3482bp, and the size of the digested product is about 8819bp ( Figure 6 ); 7. Screening of colony strains after amplification by agar gel electrophoresis: Select colonies 1, 2, 7, 9, 14, 15 and pLentiCRISPRv2 (EDV00114). The gel electrophoresis results showed that the target fragments of colonies 7, 9, 14 and 15 were roughly the same as those of pLentiCRISPRv2 (EDV00114). Therefore, colonies 7, 9, 14 and 15 were screened for enzyme digestion verification ( Figure 7 ).

[0050] 2. RT-PCR and Western blotting to detect DSG2 expression in DSG2 overexpressing cells, DSG2 knockdown cells, and DSG2 empty cells Table 2 shows the primer sequences of DSG2 and internal reference genes Table 2 In order to detect the effect of DSG2 gene on cell function, two parallel experimental groups were set up: DSG2 empty HeLa cells: HeLA-EV; DSG2 knockdown cells: HeLa-KO; DSG2 overexpression cells: HeLa-DSG2; Different concentrations of dihydroartemisinin were prepared: 0 μg / ml was the control group, and 10, 25, 50, 100, 150, 200, and 300 μg / ml were the experimental groups.

[0051] The results showed that: Western blot verification of Hela cell lines with DSG2 gene overexpression (Over Expression, OE) and knockout (Knock Out, KO) showed that compared with the empty vector group (Vector, CV), the expression of DSG2 gene in the DSG2-OE group was significantly increased, and the expression in the DSG2-KO group was significantly decreased ( Figure 8 ); 3. Confirmation of the role of DSG2 gene in Hela cells at the cellular level 3.1 CCK-8 assay for cell proliferation (1) Add 100 μL PBS to each well around the edges of the 96-well plate to prevent the liquid in the wells to be tested from evaporating.

[0052] (2) Set up blank well Ab on each plate (add only 100 μL culture medium / well) to prepare cell suspension; take cells in logarithmic growth phase and plate the following number of cells: KO: 5000 / well, OE and CV: 2000 / well, 100 μL per well, repeat each sample 3 times, observe the cell status, appropriately extend or shorten the cell culture time until the cells adhere to the wall and grow to about 70%, and wash with PBS 3 times.

[0053] (3) Add drugs at different concentrations. Set control well Ac (drug concentration is 0 μg / mL) and experimental well As for each cell line experiment. Set the drug concentrations to 10 μg / mL, 15 μg / mL, 25 μg / mL, 30 μg / mL, 50 μg / mL, 75 μg / mL, 100 μg / mL, 150 μg / mL, and 200 μg / mL.

[0054] (4) After adding the drug, continue culturing for 4 h, 48 h, and 72 h. Add 10 μl of CCK-8 working solution to each well and continue incubating at 37°C for 2 h. Measure the OD value at 450 nm in the dark.

[0055] (5) Calculation formula: Cell inhibition rate = [(Ac-As) / (Ac-Ab)] x 100% The results showed that as the concentration of DHA increased and the duration of action prolonged, the proliferation inhibition rate gradually increased. At 24 h, there was no significant difference in the inhibition rate of DHA on the three groups of HeLa cells; after 48 h, the inhibition rate was significantly different, and after 72 h, the differences in the proliferation inhibition rate among all groups were more significant. At the same time, compared with HeLA-EV, the proliferation inhibition rate of HeLA-DSG2 at 48 h and 72 h was significantly reduced, and the proliferation inhibition rate of HeLa-KO was significantly increased ( Fig. 9 ).

[0056] 3.2 Crystal violet staining assay to detect cell proliferation activity (1) Plate cells in 6-well plates at a cell count of 1 x 10 5 pcs / well, 2 mL per well was plated.

[0057] (2) After culturing cells in 6-well plates for 24 h, different concentrations of DHA (0 μg / mL, 25 μg / mL, 50 μg / mL, 75 μg / mL, 150 μg / mL, 200 μg / mL) were added.

[0058] (3) After 48 h of routine culture, wash the dead cells with PBS and remove the waste liquid.

[0059] (4) Add 0.5 mL of 4% paraformaldehyde along the well wall to fix the cells for 30 min, and then wash three times with PBS.

[0060] (5) Slowly add 0.5% crystal violet solution along the wall of the well to cover the bottom of the well and leave it at room temperature for 10 min.

[0061] (6) Wash with PBS until no purple residue remains and take pictures under an inverted microscope.

[0062] (7) Place the 6-well plate away from light until it is completely dry (it can also be dried at 37°C), add 2 mL / well of 35% acetic acid solution, and dissolve crystal violet at room temperature for 1 h.

[0063] (8) Transfer the crystal violet solution to a 96-well plate and measure the absorbance at 550 nm using a microplate reader.

[0064] The results showed that DHA could inhibit the proliferation activity of HeLa cells. As the drug concentration increased, the cell density decreased significantly. After crystal violet staining and dissolution with acetic acid, the absorbance of each well was measured. It was found that differential expression of DSG2 affected the cell proliferation activity. The cell density of HeLa-DSG2 was significantly higher than that of HeLa-EV and HeLa-KO ( Fig.10 ).

[0065] 3.3 Scratch assay to detect cell migration (1) Take cells with good morphology in the logarithmic growth phase from each group and plate them in a 6-well plate.

[0066] (2) When the cell confluence reaches 90% after attachment, use a sterilized 200 μl pipette tip to scratch the cells in each well. Make sure the tip is perpendicular to the bottom of the well and make three even scratches in each well to ensure that the scratch width is consistent.

[0067] (3) Floating cells and dead cells were washed with PBS, and different concentrations of drugs (0 μg / mL, 50 μg / mL) were added.

[0068] (4) After 0 h, 24 h, 48 h, and 72 h of incubation, observe and take photos to record the scratch width.

[0069] (5) Record 5 times for each hole and record the width value 3 times for each hole to obtain the average width of the scratch.

[0070] The results showed that DHA significantly inhibited the migration ability of the three groups of HeLa cells, and the inhibitory effect became more significant as time went on. At 24 h, the migration rate of HeLa-KO-DHA was significantly reduced compared with HeLa-EV-DHA, and there was no significant difference in the migration rate of HeLa-DSG2-DHA. However, at 48 h, the difference between HeLa-EV-DHA and HeLa-DSG2-DHA increased significantly ( Fig.11 ).

[0071] 3.4 Transwell assay to detect cell invasion ability (1) Place the Matrigel stored at -20°C in a 4°C refrigerator overnight one day in advance to slowly melt into a liquid state.

[0072] (2) Coating with basement membrane: Prepare a pre-cooled 200 μL pipette tip in advance. Rinse the inner side of the chamber with culture medium, then thoroughly mix Matrigel gel and serum-free culture medium in a volume ratio of 1:4. Coat 50 μL per well evenly on the upper chamber surface of the bottom membrane of the Transwell chamber. Be careful to keep it level to avoid uneven gel surface.

[0073] (3) During the experiment, first add the lower chamber fluid containing serum, which can serve as a chemotactic factor, and then gently place it into the transwell chamber, ensuring that the bottom of the chamber is covered and avoiding the formation of bubbles between the liquid and the chamber.

[0074] (4) Place in a 37°C incubator overnight to allow Matrigel to polymerize into a gel.

[0075] (5) Conduct the experiment according to the following requirements: Upper room: Culture medium: serum-free DMEM Cell number 1x103 / well Volume: 50 μl Lower room: Culture medium: DMEM medium with 20% fetal bovine serum Volume: 500 μl (6) Before the experiment, cells were starved for 12 h to remove the effects of serum.

[0076] (7) Slowly add 50 μl of resuspended cells to each upper chamber and incubate in the incubator for 48 h.

[0077] (8) Remove the chamber, aspirate the excess liquid in the upper and lower chambers, and wash the upper chamber twice with PBS.

[0078] (9) Place the chamber in a new well that has been pre-filled with 4% paraformaldehyde and fix for 30 minutes.

[0079] (10) Completely immerse the lower chamber surface in 0.5% crystal violet solution and stain for 15 minutes.

[0080] (11) Finally, the chamber was washed three times with PBS, dried in the dark, and observed and photographed under an inverted microscope. Five fields of view were randomly selected in each well, and the cells were counted and the mean was calculated.

[0081] The results showed that DHA could significantly inhibit the invasion ability of the three groups of HeLa cell lines, overexpression of DSG2 enhanced the invasion ability of HeLa cells, and knockdown of DSG2 weakened the invasion ability of HeLa cells ( Fig.12 ).

[0082] 4. Molecular confirmation of the role of DSG2 gene in synergizing dihydroartemisinin in Hela cells 4.1 Flow cytometry: detecting cell cycle (1) Take cells in the logarithmic growth phase and plate them in a 6-well plate at 2 x 105 cells / well. Culture them until the cells adhere to the wall and the cell confluence reaches 80%.

[0083] (2) DHA was added to each well at the following concentrations: 0 μg / mL as the control group and 50 μg / mL as the experimental group, and cultured for 48 h.

[0084] (3) After 48 h of culture, wash three times with PBS, digest with trypsin, collect into a 15 mL centrifuge tube, centrifuge at 1000 rpm / 5 min, discard the supernatant, gently resuspend the cells in 4°C pre-cooled PBS, and centrifuge at 500 rpm / 5 min.

[0085] (4) Discard the supernatant, leaving about 200 μL PBS, blow off the cell pellet and resuspend it thoroughly.

[0086] (5) Prepare a 3 mL EP tube in advance, add 1 mL of 70% ice-cold ethanol to each tube, and clearly mark them.

[0087] (6) Transfer the fully dispersed cell suspension to an EP tube and gently blow it repeatedly to allow it to fully contact with 70% ethanol. Fix it at -20°C overnight.

[0088] (7) The next day, collect the cell pellet by centrifugation, wash the cells twice with PBS, add 400 μL of PI working solution to each tube, and stain for 30 min in the dark. The preparation ratio of PI working solution is: 0.5 mL of buffer solution + 25 μL of PI stain solution + 10 μL of RNasA.

[0089] (8) Before loading, the cells were filtered through a cell screen and cell cycle analysis was performed using flow cytometry. Subsequent data were analyzed using ModFit LT (version 5.0.9).

[0090] The results showed that after treatment with 50 μg / mL DHA for 48 h, the proportion of G0 / G1 phase cells in HeLa-EV-DHA was lower than that in HeLa-EV; compared with the group without drug addition, the cell cycles of Hela-EV-DHA, Hela-KO-DHA and Hela-DSG2-DHA were all arrested at the G2 / M phase; compared with HeLa-EV-DHA, the proportion of HeLa-DSG2-DHA blocked at the G2 / M phase was not significant, but the proportion of HeLa-KO-DHA blocked at the G2 / M phase increased ( Fig.13 ).

[0091] 4.2 RNA sequencing experiment: Analyze the effect of DSG2 gene on gene expression in human cervical cancer and conduct KEGG and GO enrichment analysis (1) The cells were divided into control group (DHA: 0 μg / mL): HeLa-KO, HeLa-EV, HeLa-DSG2, Experimental group (DHA: 50μg / mL): HeLa-KO-DHA, HeLa-EV-DHA, HeLa-DSG2-DHA; When the cells became larger and their edges were blurred, the cells were collected and RNA was extracted.

[0092] (2) The integrity of RNA samples was analyzed by electrophoresis, and the purity of RNA was detected by nanospectrometer.

[0093] (3) After the concentration and purity of the RNA sample are tested, the library is constructed and the effective concentration of the library is accurately quantified to ensure the quality of the library.

[0094] (4) Transcriptome sequencing was performed using the Illumina high-throughput sequencing platform (HiSeq 4000).

[0095] (5) Filter the data from the Illumina HiSeq 4000 to remove reads with incomplete base information and low-quality reads. Then, detect the sequencing error rate to perform quality control on the data to provide guarantee for subsequent data analysis. At the same time, save the sequencing quality value of each base in the sequence information in the fastq file.

[0096] (6) The ClusterProfiler package in R language was used to perform GO functional annotation analysis and KEGG signaling pathway analysis on DEGs, and the Enrichplot package was used to draw bubble charts to visualize the enrichment results. The GO functional enrichment analysis included biological process (BP), molecular function (MF), and cellular component (CC).

[0097] The results showed that GO enrichment was more obvious in the positive regulation of cell migration, DNA packaging, transmembrane receptor activity, and cell adhesion molecule binding; Further KEGG pathway enrichment analysis of DEGs showed that DEGs obtained by RNA sequencing in the HeLa-EV vs. HeLa-EV-DHA group were enriched in ribosome, p53 signaling pathway, and other signaling pathways. The obtained differential genes were matched with the KEGG database, and it was found that PI3K / AKT signaling pathway, cytokine interaction, axon guidance, Rap1 signaling pathway, protein digestion and absorption pathway, and other KEGG pathways were significantly enriched ( Fig.14: (A) HeLa-EV vs. HeLa-EV-DHA (B) HeLa-EV-DHA vs. HeLa-DSG2-DHA (C) HeLa-EV-DHA vs. HeLa-KO-DHA).

[0098] 4.3 RT-PCR experiment: detecting the expression of related genes (1) Test group cells (50 μg / mL): basal medium + 50 μg / mL drug concentration, 4 mL (including DMSO: 5 μL) (2) Control group cells (0 μg / mL): 4 mL of basal medium + DMSO: 5 μL (3) Pretreatment: After the adherent cells are cultured to 70%, different concentrations of drugs (0 μg / mL, 50 μg / mL) are added, and then cultured until the edges of the drug-treated cells are blurred; (4) Collect cells: add 1 mL of Trizol lysis buffer, repeatedly pipette until it becomes viscous, so that the Trizol lysis buffer completely contacts the surface of all culture bottles and is fully digested. Transfer the digested cells to an RNase-free 3 mL centrifuge tube, and repeatedly pipette the cells with a 1000 mL pipette gun until no cell clumps are visible and the entire solution is clear and non-viscous. Vortex to fully lyse the cells, and let them stand at room temperature for 5 min or at 4°C for 2 h. (5) Add 0.2 mL of chloroform, shake vigorously for 30 s, mix thoroughly and let stand at room temperature for 10 min; (6) Centrifuge at 12,000 rpm / min, 4°C for 15 min; (7) Transfer the supernatant to another RNase-free 3 mL centrifuge tube; (8) Add an equal volume of isopropanol to the supernatant, mix gently up and down, and let stand at room temperature for 10 min; (9) 12000 rpm / min, 4°C, centrifugation for 30 min; (10) Keep the precipitate, discard the supernatant, add 1 mL of 75% anhydrous ethanol, flick to wash the RNA, and wash the precipitate; (11) Centrifuge at 12,000 rpm / min, 4°C for 15 min; (12) Discard the supernatant and dry at room temperature for 3 min; (13) Add 50 μL of DEPC water and gently pipette to mix. After testing the concentration, mark the cells (time, name) and store them in a -80°C refrigerator. (14) Calculate the reaction system for each cell type: Calculate the amount of each RNA sample and reagent based on the measured RNA concentration; (15) Take out the reverse transcription kit from -20°C, thaw it, and place it in an ice box for later use; (16) Prepare the reaction system. The total RNA reverse transcription reaction system is as follows (taking 20 μL RT-PCR reaction system as an example); Table 3 (17) The reaction system was divided into eight tubes, centrifuged briefly, and placed in a PCR instrument for reaction. The reaction conditions were: 25°C, 10 min; 42°C, 30 min; 85°C, 5 min; 12°C, forever; (18) Calculate the reaction dosage of each cell type, the reaction system, and the distribution of the required detection wells; (19) Place the cDNA obtained in the previous step in an ice box and prepare the Realtime PCR kit, required primers, and RNase-free water; (20) Prepare the mixed solution for real-time PCR reaction. The reaction system is 20 μL. The reaction system is as shown in the following table. Table 4 (21) The reaction conditions are: Pre-denaturation: 95°C, 5 min; amplification: 95°C, 30 s; 60°C, 30 s, repeated 40 cycles; 72°C, 30 s; Melting curves were analyzed using the program recommended by the fluorescence quantitative PCR instrument. Expression level calculation method: 2−ΔΔCt; The results showed that DHA had an inhibitory effect on the relative expression of PI3K and AKT mRNA in HeLa-KO, but in the other two groups, although there was an inhibitory trend, it was not significant. At the same time, DHA promoted the relative expression of p53 and H2AX (mRNA. Overexpression of DSG2 inhibited the relative expression of the above-mentioned genes mRNA by DHA, while knocking down DSG2 promoted the effect of DHA on the mRNA expression of the above-mentioned genes. DHA promoted the relative expression of ATM mRNA in HeLa-KO cells ( Fig.15 ).

[0099] 4.4 Western blot experiments of three Hela cell lines: detection of protein expression levels of related pathways and protein expression of differentially expressed genes by RNA sequencing Total protein extraction: (1) After DHA has acted on the cells for 48 h, take the logarithmic phase cells, collect 4 ml of cell waste liquid + 2 ml PBS + 1 ml trypsin + 2 ml termination medium, a total of 9 ml, mix and blow off and count.

[0100] (2) Centrifuge for 5 min at 1000 rpm / min, discard the supernatant, resuspend in PBS and transfer to 1 ml EP tube.

[0101] (3) Centrifuge at 13,000 rpm for 10 min at 4°C. (4) Discard the supernatant, flick off the cell pellet, and add RIPA: 97 μL, PMSF: 1 μL, and phosphatase inhibitor: 2 μL.

[0102] (5) After adding the lysis solution, vortex to fully lyse the tube: vortex for 3 min and let it rest for 10 min, vortex for 30 s and let it rest for 10 min, vortex for 30 s and let it rest for 10 min, and place it in an ice box.

[0103] (6) Centrifuge at 4°C, 15,000 rpm / min for 15 min. Collect the supernatant and detect the protein concentration by BCA assay. Transfer the rest to a new RNase-free 1.5 mL EP tube and store at -80°C.

[0104] (7) Use relevant antibodies to perform Western-blot to detect the expression level of related proteins.

[0105] The results showed that when DSG2 was overexpressed, the phosphorylation ratio of PI3K and AKT increased, the PI3K / AKT pathway was activated, and the expression of ATM and H2AX related to DNA damage decreased, and the cell proliferation ability was improved. When DSG2 was underexpressed, the activity of the PI3K / AKT pathway was inhibited, the expression of ATM and H2AX increased, the cells were blocked in the G2 / M phase, and the proliferation ability decreased. This shows that DSG2 not only affects the activity of the PI3K / AKT pathway, but also weakens the DNA damage response caused by DHA. After DSG2 overexpression activated PI3K / AKT, it inhibited the activity of the p53 pathway and reduced the expression of downstream Cleaved Caspase-3, resulting in improved cell proliferation ability and resistance to cell damage caused by DHA. DHA treatment led to DNA damage response and increased the expression of H2AX and ATM in HeLa cells. After low expression of DSG2, the p53 signaling pathway in HeLa cells was activated and the expression of H2AX was significantly increased, further enhancing the inhibitory effect of DHA on HeLa cells. When DSG2 was overexpressed, the activity of the p53 pathway was weakened, the positive feedback loop was inhibited, and the DNA damage was partially resisted, making the cell proliferation ability significantly higher than that of the empty group and the DSG2 low expression group ( Fig.16 ).

[0106] 4.5 Expression of DSG2 gene in cervical cancer tissue (1) Case collection: We planned to collect 31 cases of cervical tissues that underwent tissue biopsy and surgical resection in our hospital, all of which were squamous cell carcinoma by pathological type. The median age of patients in the cervical cancer tissue chip was 47 years old (28-72 years old), with 12 cases aged <47 years and 19 cases aged ≥47 years. Among them, there were 29 cases of cervical cancer according to the clinical staging of cervical cancer (FIGO, 2018): 16 cases of stage IB2, 6 cases of stage IB3, 4 cases of stage IIA1, 1 case of stage IIB, and 2 cases of stage IIIC1p.

[0107] (2) Preparation of paraffin sections: Fix the paraffin-embedded cervical lesion specimens on a microtome and slice each specimen into two consecutive slices. Immerse the tissue sections in xylene I and xylene II solutions in turn for dewaxing, and then place the sections in gradient alcohol for hydration.

[0108] (3) Antigen retrieval: Place the sections in an antigen retrieval box containing citric acid buffer (pH 6.0) and heat at 98°C for 10 min. Rinse three times with PBS (pH 7.4). Dilute 30% hydrogen peroxide solution with deionized water and add one drop of diluted hydrogen peroxide solution on each section to block endogenous catalase activity.

[0109] (4) Antibody incubation: Add 50ul of TBS solution containing 10% normal rabbit serum and 1% BSA to each section, remove the liquid on the tissue, wipe the area around the slide with a paper towel, add diluted primary antibody to each section, apply enzyme-conjugated secondary antibody (diluted with TBS solution containing 1% BSA) to the slide, incubate at room temperature for 1 hour, and develop color at room temperature for 10 minutes.

[0110] (5) Dehydration, fixation and sealing: Rinse the slices in water and then dehydrate them in 70% alcohol, 80% alcohol, 90% alcohol, 95% alcohol, anhydrous ethanol I, anhydrous ethanol II, xylene I and xylene II, respectively. Place the slices in each reagent for 2 minutes and finally air-dry the slices in a fume hood. Seal the slices with neutral gum and let them dry in the fume hood.

[0111] (6) Immunohistochemical results: DSG2 protein is located in the cell membrane of cervical lesions. Cells with brown-yellow granules on the cell membrane are positively expressed cells, and cells without brown or with the same color as the background are negative cells. Randomly observe 10 high-power fields, count the number of positive tumor cells and the total number of tumor cells, and score according to the proportion of positive cells and the depth of coloration in each section. Positive cell coloration judgment: <5% is 0 points, 5%-25% is 1 point, 26%-50% is 2 points, and >50% is 3 points. Positive intensity: No brown-yellow positive granules in the cell or a uniform yellow color is 0 points, a small amount of light yellow granules can be seen in the cytoplasm, which is significantly higher than the background, 1 point, more dark brown granules can be seen in the cytoplasm, 2 points, and a large number of dark brown granules can be seen in the cytoplasm, 3 points. Multiply the two results of the same section. If the score is >3, it is a positive immunohistochemical reaction, indicating high expression of DSG2 protein, otherwise it is low expression.

[0112] The results showed that DSG2 gene was mainly stained in the cytoplasm of cervical cancer cells, with the staining intensity of 3 cases (3 points), 16 cases (2 points), 11 cases (1 point) and 1 case (0 points), and the positive staining rate was 1 case (0 points), 1 case (1 point), 1 case (2 points), 6 cases (3 points) and 22 cases (4 points). There were 19 cases in the antibody high expression group and 12 cases in the antibody low expression group. In addition, 9 cases were not only stained in the middle but also stained in the cell membrane. In paracancerous cells, DSG2 was mainly stained in the cytoplasm, with the staining intensity of 7 cases (2 points), 9 cases (1 point) and 15 cases (0 points), and the positive staining rate was 14 cases (0 points), 11 cases (1 point), 5 cases (2 points), 1 case (3 points) and 0 cases (4 points). Except for 1 case in the antibody high expression group, all other cases were in the low expression group. The IHC results showed that DSG2 staining intensity was stronger in cervical cancer tissues by comparing the high expression group with the low expression group of cervical cancer tissue chips ( Fig.17 ).

[0113] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A marker for diagnosing cervical cancer, characterized in that: The marker is the DSG2 gene, which includes a sense strand and an antisense strand corresponding to the sense strand, the sense strand is selected from "sequence 1", and the antisense strand is selected from "sequence 2".

2. A reagent, characterized in that Comprising a reagent for detecting the level of the marker for diagnosing cervical cancer according to claim 1.

3. A reagent according to claim 2, characterized in that It includes cloning primers and specific primers of the DSG2 gene, wherein the cloning primers include "sequence 3", "sequence 4", "sequence 5" and "sequence 6", and the specific primers include "sequence 7" and "sequence 8".

4. A reagent according to claim 2, characterized in that The reagents also include one or more of a buffer, a protective agent, a preservative, a cosolvent, an osmotic pressure regulator, and a pH regulator.

5. A reagent according to claim 2, characterized in that, The reagents further include one or more of antibodies and probes.

6. Use of the reagent according to any one of claims 2 to 5 in the preparation of a product for diagnosing or assisting in the diagnosis of cervical cancer.

7. A drug for inhibiting tumor cells, characterized in that: These include CRISPR gene editing therapeutic drugs or antisense nucleic acid drugs that block the normal transcription or post-transcriptional translation of the DSG2 gene.

8. The drug for inhibiting tumor cells according to claim 7, characterized in that: Also included is dihydroartemisinin.

9. The drug for inhibiting tumor cells according to claim 8, characterized in that: Methods for blocking normal transcription or post-transcriptional translation of the DSG2 gene include one or more of CRISPR / Cas9 gene editing and RNA interference.

10. The drug for inhibiting tumor cells according to any one of claim 9, characterized in that: The tumor cells include cervical cancer cells.

Images