Kit for detecting hepatitis E virus RNA (Ribonucleic Acid) based on RAA / PCR-CRISPR-Cas13a

Abstract

The invention discloses a kit for detecting RNA (Ribonucleic Acid) of a hepatitis E virus based on RAA (Reverse Amplification Amplification) / PCR (Polymerase Chain Reaction)-CRISPR-Cas13a. The kit comprises a primer pair used for amplifying or detecting an HEV conserved gene segment (SEQ ID No.1) and crRN A, and the sequence of crRNA is composed of an anchoring sequence and a guide sequence (39-66th sites of SEQ ID No.13). Based on a CRISPR-Cas13a nucleic acid detection technology, through design, construction and screening, a set of RAA amplification primer pair or PCR primer pair for hepatitis E virus RNA detection, crRNA and a detection method thereof are finally provided, the crRNA can realize high-sensitivity and high-specificity detection of hepatitis E virus RNA by activating Cas13a, and the sensitivity reaches 1 copy / mu L. The method is simple, convenient and rapid, and has important application value.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and relates to a kit for detecting hepatitis E virus RNA based on RAA / PCR-CRISPR-Cas13a, and specifically relates to a CRISPR-Cas13a system detection kit, a composition and an application thereof for detecting hepatitis E virus (HEV) RNA. Background Art

[0002] Hepatitis E virus (HEV) belongs to the Hepatitis Eviridae family and is a single-stranded positive-strand RNA virus with a diameter of 30 to 40 nm. HEV can be divided into 8 genotypes, and humans are mainly infected with types 1 to 4; among them, types 1 and 2 only infect humans; types 3 and 4 can infect humans and a variety of animals. Therefore, HEV is considered a zoonotic virus. Studies have shown that there are about 20 million new cases of HEV infection worldwide each year, of which 3.3 million have hepatitis symptoms. Serological epidemiological studies have shown that more than 1 / 3 of the world's population has been infected with HEV. In recent years, the reported incidence of hepatitis E has been on the rise, from 1.27 / 100,000 in 2004 to 2.02 / 100,000 in 2019. Therefore, it is of great clinical significance to achieve rapid and accurate detection of HEV. At present, the detection method for HEV is mainly the detection of serological antibodies, such as enzyme-linked immunosorbent assay. These methods have low sensitivity and specificity for HEV clinical samples, poor consistency, and a single antibody result cannot fully diagnose HEV infection. Therefore, a more accurate HEV detection method is urgently needed.

[0003] Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) / CRISPR-associated system (Cas) is a new nucleic acid detection technology. Due to its high sensitivity and high specificity, it is considered by Nature to be one of the seven "disruptive" technologies in 2022. Currently, CRISPR / Cas technology is widely used in the detection of various pathogens, such as SARS-CoV-2, Zika virus and dengue virus. The system can achieve high sensitivity and high specificity detection of pathogen nucleic acids, and has the advantages of convenience, speed and low cost. Therefore, CRISPR / Cas technology may provide a new platform for HEV detection. Summary of the invention

[0004] The technical problem to be solved by the present invention is how to accurately, sensitively and specifically detect hepatitis E virus (HEV) RNA. The technical problem to be solved is not limited to the technical subject as described, and those skilled in the art can clearly understand other technical subjects not mentioned in this article through the following description.

[0005] To solve the above technical problems, the present invention first provides a kit for detecting hepatitis E virus RNA, wherein the kit may include a primer pair and crRNA, the sequence of the crRNA may consist of an anchor sequence and a guide sequence, and the guide sequence may be positions 39-66 of SEQ ID No.13.

[0006] The primer pair can be used to amplify or detect a HEV conserved gene fragment, and the nucleotide sequence of the HEV conserved gene fragment can be SEQ ID No.1.

[0007] The anchor sequence can be used to bind to the Cas13a protein, and the guide sequence can target the hepatitis E virus gene target sequence. The guide sequence can be complementary to the target sequence.

[0008] In the above kit, the nucleotide sequence of the crRNA may be SEQ ID No.13.

[0009] Among them, positions 1-38 of SEQ ID No.13 are anchor sequences for binding to Cas13a protein, and positions 39-66 are guide sequences for binding to hepatitis E virus gene target sites.

[0010] In the above kit, the primer pair may be any of the following:

[0011] A1) a RAA primer pair, the RAA primer pair consisting of a primer HEV RAA-F1 and a primer HEV RAA-R3, the primer HEV RAA-F1 can be a single-stranded DNA molecule as shown in SEQ ID No.2; the primer HEV RAA-R3 can be a single-stranded DNA molecule as shown in SEQ ID No.7;

[0012] A2) a PCR primer pair, the PCR primer pair consisting of primer HEV PCR-F and primer HEV PCR-R, the primer HEV PCR-F may be a single-stranded DNA molecule shown in SEQ ID No.14; the primer HEV PCR-R may be a single-stranded DNA molecule shown in SEQ ID No.15.

[0013] Furthermore, the kit may also include a HEV conserved gene fragment or a recombinant vector carrying the HEV conserved gene fragment, and the nucleotide sequence of the HEV conserved gene fragment may be as shown in SEQ ID No.1.

[0014] Furthermore, the kit may also include Cas13a protein and / or reporter RNA.

[0015] Furthermore, the Cas13a protein may be LwCas13a protein.

[0016] Furthermore, the reporter RNA may be an RNA molecule having a signal reporting function, and when the RNA molecule is degraded, it can report a positive signal and be detected.

[0017] Furthermore, the Cas13a protein may exist independently or in the form of a complex with the crRNA described in the present invention.

[0018] In one embodiment of the present invention, the reporter RNA is RNAse Alert v2 (product of Invitrogen Technology Co., Ltd., USA, catalog number: 4479769).

[0019] Furthermore, the kit may also include one or more of T7 RNA polymerase, NTP (such as NTP Mix), and RNase inhibitor.

[0020] Furthermore, the kit may also include a readable carrier recording the method for detecting hepatitis E virus RNA described herein. The readable carrier may be a kit instruction sheet (e.g., a printed instruction sheet) for practicing the method of the present invention or a computer-readable medium (e.g., a floppy disk, a CD, etc.) on which information has been recorded.

[0021] The various reagent components of the kit may be present in separate containers, or may be pre-combined in whole or in part into a reagent mixture.

[0022] The present invention also provides the crRNA, the crRNA encoding DNA, the primer pair or the complex of the crRNA and Cas13a protein.

[0023] The nucleotide sequence of the DNA encoding the crRNA may be SEQ ID No.12.

[0024] The present invention also provides a composition for detecting hepatitis E virus RNA, which may include the primer pair (PCR primer pair or RAA primer pair) and the crRNA.

[0025] Further, the composition may include the RAA primer pair (primer HEV RAA-F1 having a nucleotide sequence of SEQ ID No. 2 and primer HEV RAA-R3 having a nucleotide sequence of SEQ ID No. 7) and the crRNA (SEQ ID No. 13).

[0026] Further, the composition may include the PCR primer pair (primer HEV PCR-F having a nucleotide sequence of SEQ ID No. 14 and primer HEV PCR-R having a nucleotide sequence of SEQ ID No. 15) and the crRNA (SEQ ID No. 13).

[0027] The present invention also provides any of the following applications of the crRNA, the crRNA encoding DNA, the primer pair, the complex of the crRNA and Cas13a protein, or the composition:

[0028] C1) Use in detecting hepatitis E virus RNA or preparing a product for detecting hepatitis E virus RNA;

[0029] C2) Use in identifying or assisting in the identification of hepatitis E virus or in the preparation of a product for identifying or assisting in the identification of hepatitis E virus;

[0030] C3) Use in diagnosing or assisting in the diagnosis of diseases caused by hepatitis E virus infection or in the preparation of products for diagnosing or assisting in the diagnosis of diseases caused by hepatitis E virus infection;

[0031] C4) Use in screening for diseases caused by hepatitis E virus infection or in preparing products for screening for diseases caused by hepatitis E virus infection;

[0032] C5) Use in monitoring the treatment of diseases caused by hepatitis E virus infection or in preparing products for monitoring the treatment of diseases caused by hepatitis E virus infection;

[0033] C6) Use in screening drugs for preventing and treating hepatitis E virus or in preparing products for screening drugs for preventing and treating hepatitis E virus.

[0034] Furthermore, the product may be a reagent, a test kit, a chip or a test paper.

[0035] The present invention also provides a method for detecting hepatitis E virus RNA, which may include the following steps:

[0036] B1) extracting RNA from the sample to be tested, and reverse transcribing the RNA into cDNA;

[0037] B2) using the cDNA as a template, performing RAA amplification using the primers HEV RAA-F1 and HEV RAA-R3 to obtain a RAA amplification product (if the sample RNA to be tested is subjected to RT-RAA amplification using the primers HEV RAA-F1 and HEV RAA-R3 to obtain a RAA amplification product); or using the cDNA as a template, performing PCR amplification using the primers HEV PCR-F and HEVPCR-R to obtain a PCR amplification product;

[0038] B3) Detection using the CRISPR-Cas13a detection system;

[0039] The CRISPR-Cas13a detection system may include the crRNA.

[0040] Furthermore, the sample to be tested may be a biological blood sample, an organ (such as liver, spleen, kidney, etc.) tissue sample, a cell sample or an environmental sample, etc.

[0041] In the above method, the CRISPR-Cas13a detection system may further include Cas13a protein and / or T7 RNA polymerase.

[0042] Furthermore, the CRISPR-Cas13a detection system may also include reporter RNA, NTP (such as NTP Mix), RNase inhibitors, and RNase-free water.

[0043] Furthermore, in step B2), the reaction conditions for the PCR amplification may be: pre-denaturation at 95°C for 10 min; 95°C for 30 s, 60°C for 30 s, 72°C for 30 s, for 35 cycles; and extension at 72°C for 10 min.

[0044] Furthermore, in step B2), the reaction system (25 μL) for the PCR amplification may be: 1 μL of cDNA template, 2 μL of primer HEV PCR-F 10 μM, 2 μL of primer HEV PCR-R 10 μM, 14.5 μL of 2×Ta q mix, and 5.5 μL of ddH2O.

[0045] Furthermore, in step B2), the reaction conditions for performing the RAA amplification (or RT-RAA amplification) may be: reacting at 39° C. for 20-40 minutes (eg, 20, 25, 30, 35 or 40 minutes).

[0046] Furthermore, in step B2), the reaction system (50 μL) for the RAA amplification (or RT-RAA amplification) may be: 5 μL of cDNA template (or 5 μL of RNA template), 2 μL of primer HEV RAA-F1 (10 μM), 2 μL of primer HEV RAA-R3 (10 μM), 25 μL of ABuffer, 2.5 μL of B Buffer, and 13.5 μL of ddH2O.

[0047] Wherein A Buffer is a buffer solution, and B Buffer is a magnesium acetate solution. A Buffer and B Buffer are components of the RAA detection kit (Hangzhou Zhongce Biotechnology Co., Ltd., catalog number S001ZC) or the RT-RAA detection kit (Hangzhou Zhongce Biotechnology Co., Ltd., catalog number S003ZC).

[0048] Furthermore, the method for detecting using the CRISPR-Cas13a detection system in step B3) can be as follows:

[0049] ① Prepare a CRISPR-Cas13a detection system containing the following components: RAA amplification product or PCR amplification product obtained in step B2), Cas13a protein, crRNA, reporter RNA, NTP, T7 RNA polymerase, RNase inhibitor, HEPES buffer, MgCl2 solution, RNase-free water; ② Perform the reaction; ③ Detect the positive signal.

[0050] In one embodiment of the present invention, the CRISPR-Cas13a detection system (25 μL) may be: template (RAA amplification product or PCR amplification product) 5 μL, LwCas13a protein (1×) 1 μL, NTP Mix mixture (10 mM) 2 μL, T7 RNA polymerase (50000 U / ml) 0.5 μL, RNase inhibitor (Murine RNase inhibitor) (40000 U / ml) 1 μL, crRNA (SEQ ID No.13) (100 ng / μL) 1.5 μL, RNAse Alert v2 (2000 nM) 2.5 μL, HEPES buffer (1 M) 0.5 μL, MgCl2 solution (1 M) 0.25 μL, RNase-free water (RNase-free H2O) 10.75 μL.

[0051] Furthermore, in step ②, the reaction conditions may be: 37°C.

[0052] Furthermore, the positive signal detection in step ③ may be: reading the fluorescence intensity value once every 2 minutes, for 30 times.

[0053] The method for determining the positive signal can be as follows: within the same detection time, the fluorescence intensity value of the experimental group is significantly higher than that of the negative control (ddH2O). After statistical analysis, the fluorescence intensity values ​​of the three repeated experiments are statistically different from those of the negative control, which is determined to be a positive result (positive signal).

[0054] Furthermore, whether the sample to be tested contains HEV can be determined based on the presence or absence of a positive signal, and / or the concentration of HEV in the sample to be tested can be determined based on the strength of the positive signal:

[0055] (1) If there is a positive signal, it is determined that the sample to be tested contains or the candidate contains HEV; if there is no positive signal, it is determined that the sample to be tested does not contain or the candidate does not contain HEV;

[0056] (2) The stronger the positive signal, the higher the HEV content in the sample to be tested; the weaker the positive signal, the lower the HEV content in the sample to be tested.

[0057] The purposes of the above-mentioned applications and methods may be disease diagnosis, disease prognosis and / or disease treatment, and their purposes may also be non-disease diagnosis, non-disease prognosis and non-disease treatment purposes; their direct purpose may be to obtain information on intermediate results of disease diagnosis results, disease prognosis results and / or disease treatment results, and their direct purpose may be non-disease diagnosis, non-disease prognosis and / or non-disease treatment purposes.

[0058] The method for detecting or assisting in detecting hepatitis E virus RNA provided by the present invention can be a non-disease diagnosis and treatment method or a disease diagnosis and treatment method. The non-disease diagnosis and treatment method can be, for example, to detect whether hepatitis E virus RNA is contained in cells before and after the use of drugs when screening drugs for preventing and treating hepatitis E virus RNA at the cell level.

[0059] One of the purposes of the present invention is to establish a highly sensitive and highly specific hepatitis E virus detection method based on the CRISPR-Cas13a system and combined with RAA isothermal amplification technology or PCR amplification. The present invention is based on the principle of the CRISPR-Cas13a system and the selection principle of the target sequence. The HEV conservative sequence (SEQ ID No.1) is first analyzed and obtained, and then 5 crRNA molecules are designed according to the conservative sequence site of the hepatitis E virus, and the optimal crRNA molecule is selected to activate the CRISPR-Cas13a system for hepatitis E virus RNA detection.

[0060] The present invention is based on CRISPR-Cas13a nucleic acid detection technology, and ultimately provides a set of RAA amplification primer pairs or PCR primer pairs, crRNA and detection methods thereof for hepatitis E virus RNA detection through design, construction and screening. The crRNA can achieve highly sensitive and specific detection of hepatitis E virus RNA by activating Cas13a, with a sensitivity of 1 copy / μL. The method of the present invention is simple, rapid, has extremely high sensitivity and specificity, and has important application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0061] Figure 1 Agarose gel electrophoresis for RAA primer screening.

[0062] Figure 2 This is a graph of crRNA screening results.

[0063] Figure 3 This is a graph showing the sensitivity results of hepatitis E virus target sequence detection.

[0064] Figure 4 This is a graph showing the specificity results of hepatitis E virus target sequence detection. DETAILED DESCRIPTION

[0065] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0066] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0067] Example 1. Acquisition of conserved sequences and design and screening of RAA primers

[0068] 1. Analysis of Conserved Region Sequences and Preparation of Plasmid Standards

[0069] The conserved sequence of HEV is: 5'-ggccgcgggatagccctcaccctgtttaaccttgctgacactctgcttggcggcctgccgacagaattgatttcgtcggctggtggccagctgttctactcccgtcccgtcgtctcggcccatggcgagccgactgttaagttgtatacatctgtagagaatgctcagcagg ataagggtattgcaatcccgcatgacattgacctcggagaatctcgtgtggttattcaggattatgacaaccaacatgaacaagatcggccgacgccttctccagccccatcgcgccctttctctgtccttcgagctaatgatgtgctttggctctctctcaccgctgccgagtatga-3'(SEQ ID No.1). The copy number calculation formula of the plasmid standard pUC57-HEV synthesized by Beijing Bomed Gene Technology Co., Ltd. is: copies / μL=6.02×10 23 ×Plasmid concentration (ng / μL)×10 -9 / plasmid length × 660. Plasmid concentration: 200 ng / μL ng / μL. Plasmid length: 350 bp (length of target fragment).

[0070] Plasmid pUC57-HEV is a recombinant vector obtained by replacing the fragment (small fragment) between the EcoRV nuclease recognition sites of the pUC57 vector with the DNA fragment shown in SEQ ID No. 1 in the sequence table, while keeping the other nucleotide sequences of the pUC57 vector unchanged.

[0071] 2. Design of RAA Primers

[0072] RAA primers were designed according to the RPA primer design principle (reference PMID: 27246147), with a T7 transcription sequence at the 5' end of the designed primer (the underlined part in Table 1 is the T7 transcription sequence), so that the double-stranded DNA (dsDNA) amplified by RAA can be recognized and transcribed by T7 RNA polymerase. The designed RAA primer sequences are shown in Table 1 and were synthesized by Shanghai Biotech Co., Ltd.

[0073] Table 1. RAA amplification primers for detecting HEV DNA

[0074] name Sequence (5'-3') HEV RAA-F1 <![CDATA[ aattctaatacgactcactataggg ggcggcctgccgacagaattgatttcgtcg(SEQ ID No.2)]]> HEV RAA-F2 <![CDATA[ aattctaatacgactcactataggg gacagaattgatttcgtcggctggtggcca(SEQ ID No.3)]]> HEV RAA-F3 <![CDATA[ aattctaatacgactcactataggg cagaattgatttcgtcggctggtggccagc(SEQ ID No.4)]]> HEV RAA-R1 aatgtcatgcgggattgcaatacccttatc(SEQ ID No.5) HEV RAA-R2 gggattgcaatacccttatcctgctgagc(SEQ ID No.6) HEV RAA-R3 attgcaatacccttatcctgctgagcattc(SEQ ID No.7)

[0075] 3. RAA Amplification

[0076] The copy number of the plasmid pUC57-HEV was calculated and then serially diluted to: 10 7 copies / μL, 10 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copi es / μL, 10 0 copies / μL. The diluted plasmid was used as a template and amplified with the RAA primers designed in Table 1. The RAA amplification system is shown in Table 2. The prepared system was mixed upside down in the dry powder tube, centrifuged briefly, and placed in a metal bath. The reaction was set at 39°C for 30 minutes. After the amplification was completed, the RAA amplification product was obtained and stored at 4°C for later use.

[0077] Table 2. RAA amplification system

[0078] name volume A Buffer (components in the kit) 25μL B Buffer (components in the kit) 2.5μL template 5μL HEV RAA-F (10 μM) 2μL HEV RAA-R (10 μM) 2μL <![CDATA[ddH2O]]> 13.5μL Total volume 50μL

[0079] Note: A Buffer is a buffer solution, and B Buffer is a magnesium acetate solution. The kit is a RAA detection kit (Hangzhou Zhongce Biotechnology Co., Ltd., catalog number S001ZC). If the template is RNA, the kit is a RT-RAA detection kit (Hangzhou Zhongce Biotechnology Co., Ltd., catalog number S003ZC), and the reaction system and reaction conditions remain the same as above.

[0080] 4. Screening of RAA Primers

[0081] Take the gradient dilution of plasmid standard 10 3 The 3 upstream primers and 3 downstream primers in Table 1 were paired in pairs, and the combination was F1R1, F1R2, F1R3, F2R1, F2R2, F2R3, F3R1, F3R2, and F3R3. The RAA amplification method in step 3 was used for amplification, and the amplification product with water as the template was set as the negative control (NC). The amplification product was detected by agarose gel electrophoresis, and the results were as follows: Figure 1 As shown. The results show that the combination of F1 and R3 (i.e., SEQ ID No. 2 and SEQ ID No. 7) has a higher amplification efficiency. Therefore, the combination of F1R3 (primer HEV RAA-F1 and primer HEV RAA-R3) was selected as the optimal primer pair for RAA amplification of subsequent HEV RNA detection.

[0082] Example 2. Design and screening of crRNA for use in the present invention

[0083] 1. Design of crRNA

[0084] According to the crRNA design principles (reference PMID: 27246147), and the position of the above-mentioned optimal primer pair is used to design crRNA. The present invention designs 5 crRNAs in the HEV RNA conserved sequence (SEQ ID No. 1): HEV-crRNA1, HEV-crRNA2, HEV-crRNA3, HEV-crRNA4 and HEV-crRNA5. The crRNA sequence consists of a repetitive sequence at the 5' end and a reverse complementary sequence of the target sequence at the 3' end. The repetitive sequence is 38nt: 5'-GGGATTTAGACTACCCCAAAAACGAAGGGGACTAAAAC-3', which can bind to the LwCas13a protein. In this study, crRNA was obtained by T7 in vitro amplification transcription. The upstream sequence of the amplified transcribed crRNA sequence is the T7 promoter sequence (5'-TAATACGACTCAC TATAG-3') and the partial repetitive sequence (5'-GGG ATTTAGACTACCCCAA-3'), and the downstream sequence is the first 20nt of the target sequence. The specific sequence is shown in Table 3, and the sequence was synthesized by Shanghai Bioengineering Co., Ltd.

[0085] Table 3. Preparation of crRNA coding DNA sequences and T7 amplification transcription sequences for detecting HEV RNA

[0086]

[0087] 2. crRNA-PCR Amplification

[0088] The synthesized sequence was diluted to 10 μM with ddH2O, and the PCR reaction system was prepared according to Table 4.

[0089] Table 4. PCR amplification system

[0090]

[0091]

[0092] PCR reaction conditions: 95℃5min thermal denaturation; 95℃30s, 55℃30s, 72℃15s, 38 cycles; 72℃ automatic extension for 10min. After amplification, the PCR product was stored at 4℃.

[0093] 3. Purification of PCR Products

[0094] The above PCR product was purified, and the specific steps were as follows: 500 μL Tris balanced phenol (Hao-like biological) and an equal volume of chloroform were added to a centrifuge tube, oscillated and mixed, and then centrifuged briefly, and the supernatant was discarded; 150 μL of the above mixture was added to the PCR product, oscillated and mixed, and then placed in a centrifuge, centrifuged at 12,000 rpm for 10 min; 30 μL of the supernatant was placed in a new centrifuge tube, 70 μL of anhydrous ethanol was added, oscillated and mixed, and then placed in a centrifuge, centrifuged at 12,000 rpm for 10 min, and the supernatant was discarded; 200 μL of 75% ethanol was added, placed in a centrifuge, centrifuged at 12,000 rpm for 10 min, and the supernatant was discarded (this step was repeated three times). The white precipitate was dried at room temperature (no liquid residue), 50 μL ddH2O was added, the concentration was detected using a Nanodrop instrument, and stored at -20°C.

[0095] IV. T7 in vitro transcription

[0096] Take 1 μg of the purified PCR product obtained in step 3, and use the HiScribe T7 Fast and Efficient RNA Synthesis Kit (New England Biolabs, USA, catalog number: E2050S) to transcribe the purified PCR product into crRNA. The transcription system is shown in Table 5.

[0097] Table 5. T7 in vitro transcription system of crRNA

[0098] name volume NTP Mix 10μL 6.7mM each NTP final PCR product (step 3) 1 μg T7 RNA polymerase 2μL <![CDATA[RNase-free H2O]]> Up to 20μL Total volume 20μL

[0099] After mixing the above T7 in vitro transcription system, put it in a water bath and incubate it at 37°C overnight to obtain the transcription product; add 20 μL RNase-free H2O to the transcription product, then add 2 μL DNaseⅠ (to remove excess DNA), mix well, and incubate it at 37°C for 15 minutes to obtain crRNA.

[0100] 5. Purification of crRNA

[0101] Purify the crRNA obtained by the above transcription according to the Agencourt RNA Clean XP instructions (Beckman Coulter). The specific steps are as follows: shake the magnetic beads in the bottle to mix, add 1.8 times the volume of magnetic beads to the centrifuge tube containing the transcription product, gently blow 10 times to mix, and let it stand at room temperature for 3 minutes. Place the centrifuge tube in the magnetic rack and let it stand for 10 minutes. The magnetic beads are adsorbed on the wall of the tube. Gently aspirate the liquid in the tube to prevent the magnetic beads from being aspirated. Add 200μL 70% ethanol (prepared with RNase-free H2O) to the centrifuge tube, incubate at room temperature for 30s, and discard (repeat this process 3 times to wash the magnetic beads). Dry the centrifuge tube at room temperature and remove the residual liquid in the tube. Add 50 μL RNase-free H2O, pipette 10 times to mix, put it into the magnetic rack, aspirate the clear liquid after the magnetic beads adhere to the wall, put it into a new centrifuge tube, measure the concentration of the purified crRNA with the Nanodrop instrument, dilute it to 100 ng with RNase-free H2O, and store it in aliquots at -80℃ for use.

[0102] 6. Screening of crRNA

[0103] 1. Take the gradient diluted plasmid standard 10 3 copies / μL was used as a template, and RAA amplification was performed using the best primers screened in Example 1 (primer HEV RAA-F1 and primer HEV RAA-R3) and the amplification method of step 3 in Example 1 to obtain a RAA amplification product; or PCR amplification was performed using the primers in Example 4 (primer HEV PCR-F and primer HEV PCR-R) and the amplification method of step 2 in Example 4 to obtain a PCR amplification product.

[0104] 2. Take 5 μL of RAA amplification product / PCR amplification product and detect it using different crRNAs according to the method in Example 3, and set the amplification product with water as the template as a negative control.

[0105] Test results such as Figure 2 As shown, the fluorescence values ​​of the five crRNA tests were statistically different from those of the negative control, P < 0.0001. HEV-crRNA5 with the highest fluorescence value was selected as the crRNA for CRISPR-Cas13a detection of hepatitis E virus RNA to further evaluate the sensitivity and specificity of the detection method. Figure 2 : Fluorescence value change curve of 5 crRNA detections within 60 minutes.

[0106] The nucleotide sequence of the encoding DNA of HEV-crRNA5 is: 5'-GGGATTTAGACTACCCCAAAA ACGAAGGGGACTAAAACatacaacttaacagtcggctcgccatgg-3' (SEQ ID No. 12), and the nucleotide sequence of HEV-crR NA5 is 5'-GGGAUUUAGACUACCCCAAAAACGAAGGGGACUAAAA Cccauggcgagccgacuguuaaguuguau-3' (SEQ ID No. 13), wherein positions 1-38 are anchor sequences for binding to Cas protein, and positions 39-66 are guide sequences for binding to target sequences.

[0107] Example 3. Establishment of RAA-CRISPR-Cas13a method for detecting HEV RNA

[0108] 1. Preparation of CRISPR-Cas13a detection system

[0109] 5 μL of the RAA amplification product in Example 1 was taken as a template for CRISPR-Cas13a detection, and the configuration system was shown in Table 6 (the template was the RAA amplification product). At the same time, water was set as a template as a negative control.

[0110] Table 6. CRISPR-Cas13a detection system

[0111]

[0112]

[0113] Note: LwCas13a protein is a product of Hangzhou Zhongce Biotechnology Co., Ltd. (Cat. No.: R101zc). The reporter RNA is RNaseAlert TM QC System v2, specifically a product of Invitrogen, catalog number 4479769. Contains reporter RNA, which generates fluorescent signals when degraded. NTP Mix is ​​a product of BBI, catalog number B600056-0500. T7 RNA polymerase is a product of New England Biolabs, USA, catalog number: M0251S. RNase inhibitor (Murine RNaseinhibitor) is a product of New England Biolabs, USA, catalog number: M0314L. RNase-free H2O is a product of Beijing Bomade Gene Technology Co., Ltd., catalog number: RA114-01. HEPES Buffer Solution is a product of gibco., catalog number 15630-106.

[0114] 2. Fluorescence intensity detection

[0115] The prepared detection system was placed in a fluorescence quantitative PCR instrument, and the FAM channel was used to detect the change in fluorescence signal. Reaction conditions: 37°C, the fluorescence intensity value was read every 2 minutes, and read 30 times.

[0116] Result determination: Within the same detection time, the fluorescence intensity value of the experimental group was significantly higher than that of the negative control (ddH2O). After statistical analysis, there was a statistical difference between the fluorescence intensity values ​​of the three repeated experiments and the negative control, which was determined to be a positive result (positive signal).

[0117] Further, whether the sample to be tested contains HEV is determined based on the presence or absence of a positive signal, and / or the concentration of HEV in the sample to be tested is determined based on the strength of the positive signal:

[0118] (1) If there is a positive signal, it is determined that the sample to be tested contains or the candidate contains HEV; if there is no positive signal, it is determined that the sample to be tested does not contain or the candidate does not contain HEV;

[0119] (2) The stronger the positive signal, the higher the HEV content in the sample to be tested; the weaker the positive signal, the lower the HEV content in the sample to be tested.

[0120] Example 4. Establishment of PCR-CRISPR-Cas13a method for detecting HEV RNA

[0121] 1. Design of HEV PCR amplification primers (cDNA)

[0122] 1. Specific PCR primer F (HEV PCR-F) targeting the upstream of the gap of the positive strand of HEV RNA cDNA, connected to the T7 sequence: 5'- aattctaatacgactcactataggg cagctgttctactcccgtcc-3' (SEQ ID No. 14, the underlined part is the T7 sequence); the nucleic acid sequence length is 45 bases;

[0123] 2. Specific PCR primer R targeting the downstream of the gap of the cDNA positive strand of HEV RNA (HEV PCR-R): 5'-TGCGGGATTGCAATACCCTT-3' (SEQ ID No. 15); its nucleic acid sequence length is 20 bases.

[0124] 2. PCR Amplification

[0125] If the template is RNA to be tested, PrimeScript TM1st Strand cDNA Synthesis Kit (TakaraBio, Inc., Otsu, Japan, Catalog No.: 6110A) was used to reverse transcribe it into cDNA. The reverse transcription system is as follows:

[0126] Table 7. Reverse transcription system

[0127]

[0128] After the above system is mixed, reverse transcription reaction is carried out: 30°C for 10 min; 42°C for 45 min; 95°C for 5 min; 70°C for 15 min. The obtained product is used as a cDNA template for subsequent experiments.

[0129] If the plasmid standard 10 3 The PCR amplification product was obtained by using the above-designed primers as templates. The PCR amplification system is shown in Table 8.

[0130] Table 8. PCR amplification system

[0131] name volume template 1μL PCR-F (10 μM) 2μL PCR-R (10 μM) 2μL 2×Taq mix 14.5μL <![CDATA[ddH2O]]> 5.5μL Total volume 25μL

[0132] The PCR reaction conditions were as follows: pre-denaturation at 95°C for 10 min; 35 cycles of 95°C for 30 s, 60°C for 30 s, and 72°C for 30 s; and extension at 72°C for 10 min.

[0133] 3. Preparation of CRISPR-Cas13a detection system

[0134] The above PCR amplification product was used as a template for CRISPR-Cas13a detection, and the configuration system was shown in Table 6 (the template was a PCR product). At the same time, water was set as a template as a negative control.

[0135] 4. Fluorescence intensity detection

[0136] The prepared detection system was placed in a fluorescence quantitative PCR instrument, and the FAM channel was used to detect the change in fluorescence signal. Reaction conditions: 37°C, the fluorescence intensity value was read every 2 minutes, and read 30 times.

[0137] Result determination: Within the same detection time, the fluorescence intensity value of the experimental group was significantly higher than that of the negative control (ddH2O). After statistical analysis, there was a statistical difference between the fluorescence intensity values ​​of the three repeated experiments and the negative control, which was determined to be a positive result (positive signal).

[0138] Further, whether the sample to be tested contains HEV is determined based on the presence or absence of a positive signal, and / or the concentration of HEV in the sample to be tested is determined based on the strength of the positive signal:

[0139] (1) If there is a positive signal, it is determined that the sample to be tested contains or the candidate contains HEV; if there is no positive signal, it is determined that the sample to be tested does not contain or the candidate does not contain HEV;

[0140] (2) The stronger the positive signal, the higher the HEV content in the sample to be tested; the weaker the positive signal, the lower the HEV content in the sample to be tested.

[0141] Example 5: Sensitivity test of the method of the present invention

[0142] The plasmid standard was diluted in series, and the concentrations after dilution were: 10 7 copies / μL, 10 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL, 10 0 co pies / μL. Amplification was performed according to the RAA method in Example 1 (the primer combination was the F1R3 combination) or the PCR method in Example 4, and the amplified product was detected using the CRISPR-Cas13a detection system to detect the sensitivity of the method of the present invention. The specific steps are as follows:

[0143] 1. Perform RAA amplification on the gradient diluted HEV RNA plasmid according to the primers (F1R3 combination) and method of Example 1 to obtain RAA amplification products of different concentrations. Alternatively, perform PCR amplification on the gradient diluted HEV RNA plasmid according to the primers and method of Example 4 to obtain PCR amplification products of different concentrations. The concentrations after dilution are: 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL, 10 0 copies / μL.

[0144] 2. Take 5 μL of RAA amplification product or PCR amplification product, and use the CRISPR-Cas13a system for detection according to the method in Example 3 or Example 4, and set the amplification product with water as the template as a negative control.

[0145] Test results such as Figure 3As shown, the CRISPR-Cas13a system detects 10 0 The fluorescence signal of the plasmid amplification product with 0.1447 copies / μL was statistically significant compared with the negative control, p<0.05, and the fluorescence values ​​of the positive plasmid samples with other concentrations were all less than 0.0001 compared with the negative control. Figure 3 :The line graph of the fluorescence value changes of the CRISPR-Cas13a system detecting plasmids of different concentrations within 60 minutes. It can be concluded that the sensitivity of RAA / PCR-CRISPR-Cas13a in detecting hepatitis E virus plasmids is 1 copy / μL.

[0146] Example 6: Specificity detection of the method of the present invention

[0147] 1. Blood samples of hepatitis A virus (HAV), hepatitis B virus (HBV), hepatitis C virus (HCV), hepatitis D virus (HDV), hepatitis E virus (HEV), and human immunodeficiency virus (HIV) were obtained from clinics to extract viral nucleic acids as detection templates, and different viral nucleic acids were detected according to the method in Example 3 or Example 4 to verify the specificity of the method of the present invention. The specific steps are as follows:

[0148] 1. Blood samples of patients with hepatitis A virus (HAV), hepatitis B virus (HBV), hepatitis C virus (HCV), hepatitis D virus (HDV), hepatitis E virus (HEV), and human immunodeficiency virus (HIV) obtained clinically were used to extract nucleic acid according to the extraction instructions of the magnetic bead virus DNA / RNA extraction kit (Biotech Biotechnology Co., Ltd., catalog number: AU17011) and used as detection templates, and RAA amplification was performed according to the primers (F1R3 combination) and method of Example 1 or PCR amplification was performed according to the primers and method of Example 4 to obtain RAA amplification products or PCR amplification products.

[0149] 2. Take 5 μL of RAA amplification product or PCR amplification product respectively, and use the CRISPR-Cas13a system to detect each viral nucleic acid according to the method in Example 3 or Example 4, and set the amplification product with water as the template as a negative control.

[0150] Test results such as Figure 4 As shown, the CRISPR-Cas13a system detected a positive HEV fluorescence signal, while the others were negative. Figure 4 : A line graph showing the fluorescence value changes of the CRISPR-Cas13a system detecting viral nucleic acid plasmids within 60 minutes; thus, it was concluded that RAA / PCR-CRISPR-Cas13a had good specificity in detecting hepatitis E virus plasmids.

[0151] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. A kit for detecting hepatitis E virus RNA, characterized in that: The kit includes a primer pair and crRNA, the sequence of the crRNA consists of an anchor sequence and a guide sequence, and the guide sequence is positions 39-66 of SEQ ID No.

13.

2. The kit according to claim 1, characterized in that The nucleotide sequence of the crRNA is SE Q ID No.

13.

3. The kit according to claim 1 or 2, characterized in that The primer pair is any of the following: A1) a RAA primer pair, the RAA primer pair consisting of primer HEV RAA-F1 and primer HEV RAA-R3, the primer HEV RAA-F1 is a single-stranded DNA molecule shown in SEQ ID No.2; the primer HEV RAA-R3 is a single-stranded DNA molecule shown in SEQ ID No.7; A2) a PCR primer pair, the PCR primer pair consisting of primer HEV PCR-F and primer HEV PCR-R, the primer HEVPCR-F is a single-stranded DNA molecule shown in SEQ ID No.14; the primer HEV PCR-R is a single-stranded DNA molecule shown in SEQ ID No.

15.

4. The kit according to any one of claims 1 to 3, characterized in that The kit also includes a HEV conservative gene fragment or a recombinant vector carrying the HEV conservative gene fragment, and the nucleotide sequence of the HEV conservative gene fragment is shown in SEQ ID No.

1.

5. The kit according to any one of claims 1 to 4, characterized in that The kit also includes Cas13a protein and / or reporter RNA.

6. the crRNA described in claim 1 or 2, the coding DNA of the crRNA described in claim 1 or 2, the primer pair described in claim 3 or the complex of the crRNA described in claim 1 or 2 and Cas13a protein.

7. A composition for detecting hepatitis E virus RNA, characterized in that: The composition comprises the primer pair described in claim 3 and the crRNA described in claim 1 or 2.

8. The crRNA described in claim 1 or 2, the crRNA encoding DNA described in claim 1 or 2, the primer pair described in claim 3, the complex of the crRNA described in claim 1 or 2 and Cas13a protein, or any of the following applications of the composition described in claim 7: C1) Use in detecting hepatitis E virus RNA or preparing a product for detecting hepatitis E virus RNA; C2) Use in identifying or assisting in the identification of hepatitis E virus or in the preparation of a product for identifying or assisting in the identification of hepatitis E virus; C3) Use in diagnosing or assisting in the diagnosis of diseases caused by hepatitis E virus infection or in the preparation of products for diagnosing or assisting in the diagnosis of diseases caused by hepatitis E virus infection; C4) Use in screening for diseases caused by hepatitis E virus infection or in preparing products for screening for diseases caused by hepatitis E virus infection; C5) Use in monitoring the treatment of diseases caused by hepatitis E virus infection or in preparing products for monitoring the treatment of diseases caused by hepatitis E virus infection; C6) Use in screening drugs for preventing and treating hepatitis E virus or in preparing products for screening drugs for preventing and treating hepatitis E virus.

9. A method for detecting hepatitis E virus RNA, characterized in that: The method comprises the following steps: B1) extracting RNA from the sample to be tested, and reverse transcribing the RNA into cDNA; B2) using the cDNA as a template, performing RAA amplification using the primers HEV RAA-F1 and HEV RAA-R3 described in claim 3 to obtain a RAA amplification product; or using the cDNA as a template, performing PCR amplification using the primers HEV PCR-F and HEV PCR-R described in claim 3 to obtain a PCR amplification product; B3) Detection using the CRISPR-Cas13a detection system; The CRISPR-Cas13a detection system includes the crRNA described in claim 1 or 2.

10. The method according to claim 9, characterized in that The CRISPR-Cas13a detection system also includes Cas13a protein and / or T7 RNA polymerase.

Images