Primer probe combination for plasmid DNA residue detection and application and kit thereof
By providing specific primer probe combinations for microdroplet digital PCR technology, the sample interference and standard preparation problems of existing plasmid DNA residue detection methods are solved, and rapid and stable detection is achieved, improving the accuracy and repetition of detection. reduces costs.
Patent Information
- Application Number
- CN202411359633.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-27
- Publication Date
- 2024-12-13
AI Technical Summary
The existing plasmid DNA residue detection methods have problems such as sample interference, underestimation of detection volume, unstable method, low specificity, poor anti-interference, and inconsistent efficiency of standard preparation and amplification, resulting in large errors and high detection costs.
Provide a combination of primer probes for plasmid DNA residue detection, including primer pairs and probes for specific nucleotide sequences, for microdroplet digital PCR technology, avoiding additional standard and sample pretreatment, and directly detecting plasmids DNA residue, high repeatability and precision.
Fast and stable plasmid DNA residue detection is achieved, avoiding sample interference and errors in standard preparation, improving the accuracy and repeatability of the detection, and reducing the detection cost.
Smart Images
Figure CN119120784A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of biomedicine, and in particular relates to a primer-probe combination for detecting plasmid DNA residues, and an application and a kit thereof. Background Art
[0002] With the rapid development of cell therapy and gene therapy in recent years, the application of viral vectors such as lentivirus and adeno-associated virus (AAV) has become more and more widespread. Generally, the production process of viral vectors requires the use of a multi-plasmid transfection process, and the residual plasmid DNA has the risk of self-replication of gene fragments and random insertion into the body's genome. Therefore, regulatory agencies will strictly control the residual plasmid DNA of viral vectors.
[0003] There are three methods for detecting residual plasmid DNA in the prior art: DNA probe hybridization method, PicoGreen fluorescence method and quantitative PCR method. Among them, the DNA probe hybridization method has problems such as sample interference leading to false positives, underestimated detection amount, unstable method, and long detection time; the fluorescent staining method has problems such as low specificity and poor anti-interference. Quantitative PCR method (abbreviated as QPCR method) is also a commonly used method for detecting residual DNA in biological products. The quantitative PCR method is used to detect residual plasmid DNA as follows: after the recombinant AAV virus sample is pretreated with proteinase K, the PCR reaction system is prepared, and the standard curve is prepared with plasmid standards, and the pretreated sample is diluted and added to the packaged PCR reaction system for PCR amplification. The residual amount of plasmid DNA in the recombinant AAV virus sample is calculated back by the fitted standard curve. However, the quantitative PCR method has a large error when using the standard curve for quantitative detection, due to the difference in amplification efficiency between the sample and the plasmid standard, and the additional establishment of standard products and quantification increases the method establishment cycle and cost. There are inconsistencies in the preparation of standard products and amplification efficiency.
[0004] Digital PCR technology does not require the establishment of additional standards, and its detection is not affected by the efficiency of primer amplification. The previous detection process of viruses such as adeno-associated viruses involves more complicated sample processing, such as nuclease digestion of extracapsid DNA and protease cleavage of viral capsids. Digital PCR technology does not require additional sample pretreatment for the detection of plasmid DNA residues in recombinant AAV viruses, and accurate and repeatable detection data can be obtained. Therefore, providing a fast and stable method for detecting plasmid DNA residues based on digital PCR technology has attracted much attention. Summary of the invention
[0005] In order to solve the above problems, the present invention provides a primer-probe combination for detecting residual plasmid DNA, its application and a kit. The primer-probe combination provided by the present invention includes a primer pair and a probe; the primer pair has a nucleotide sequence as shown in SEQ ID NO.1-2 or SEQ ID NO.4-5, and the probe has a nucleotide sequence as shown in SEQ ID NO.3 or SEQ ID NO.6. The kit prepared by the primer-probe combination provided by the present invention can be used for the detection of residual plasmid DNA in lentivirus, γ-retrovirus, adenovirus or adeno-associated virus vectors, does not require the establishment of additional standards, does not require additional sample pretreatment, and can obtain accurate and repeatable detection data, with good repeatability and precision.
[0006] the term:
[0007] 1. Droplet Digital Polymerase Chain Reaction (ddPCR);
[0008] 2. Origin of replication (ORI).
[0009] To achieve the above purpose, the technical solution adopted by the present invention is as follows:
[0010] In a first aspect, the present invention provides a primer-probe combination for detecting residual plasmid DNA, characterized in that the primer-probe combination comprises a primer pair and a probe;
[0011] The primer pair has the nucleotide sequence shown in SEQ ID NO.1-2, and the probe has the nucleotide sequence shown in SEQ ID NO.3; or
[0012] The primer pair has the nucleotide sequence shown in SEQ ID NO.4-5, and the probe has the nucleotide sequence shown in SEQ ID NO.6.
[0013] Specifically, the primer pair of the primer-probe combination includes a forward primer and a reverse primer.
[0014] Preferably, the forward primer comprises a nucleotide sequence as shown in SEQ ID NO.1 or SEQ ID NO.4.
[0015] Preferably, the reverse primer comprises a nucleotide sequence as shown in SEQ ID NO.2 or SEQ ID NO.5.
[0016] Specifically, the concentration ratio of the forward primer, reverse primer and probe in the primer-probe combination is 2:2:1.
[0017] Specifically, the probe may be labeled with a fluorescent group or a quenching group at the 5' end or the 3' end.
[0018] More specifically, the fluorescent group is selected from FAM, VIC, TET, CAL Gold 540, JOE, HEX, TAMRA, ROX, CY3 or CY5; the quenching group is selected from DABCYL, BHQ1, BHQ2, BHQ3 or ECLIPE.
[0019] Preferably, the fluorescent group is FAM, and the quenching group is BHQ1.
[0020] Preferably, the probe is labeled with a fluorescent group at the 5' end and a quencher group at the 3' end.
[0021] In a second aspect, the present invention provides use of the above primer-probe combination in preparing a kit.
[0022] In a third aspect, the present invention provides a kit, comprising the above-mentioned primer-probe combination.
[0023] Specifically, the kit also includes ddPCR premixed reaction liquid and a 96-well plate dedicated to digital PCR.
[0024] In a fourth aspect, the present invention provides the use of the above-mentioned kit in the detection of residual plasmid DNA.
[0025] Specifically, the kit is used to detect residual plasmid DNA in lentivirus, γ-retrovirus, adenovirus or adeno-associated virus vectors.
[0026] Preferably, the kit is used to detect residual plasmid DNA in adeno-associated viruses.
[0027] In a fifth aspect, the present invention provides a method for detecting residual plasmid DNA, which comprises using the above-mentioned primer-probe combination or kit.
[0028] Specifically, the method comprises the following steps:
[0029] (1) After gradient dilution of the sample to be tested, the sample is mixed with a reaction mixture containing a primer-probe combination, vortexed and centrifuged to generate droplets;
[0030] (2) performing a PCR amplification reaction and reading the copy number of the sample after the reaction is completed;
[0031] (3) Calculate the residual plasmid DNA based on the copy number of the sample.
[0032] More specifically, the solution used for dilution in step (1) is nuclease-free water.
[0033] Preferably, the solution used for dilution in step (1) is nuclease-free water containing 0.05% P-F68.
[0034] More specifically, the volume ratio of the reaction mixture containing the primer-probe combination in step (1) to the diluted sample is 1-5:1.
[0035] Preferably, the volume ratio of the reaction mixture containing the primer-probe combination in step (1) to the diluted sample is 3:1.
[0036] More specifically, the preparation method of the reaction mixture containing the primer-probe combination in step (1) is: mixing ddPCR 2X Supermix, primers, probes and water.
[0037] Preferably, the primer has a nucleotide sequence as shown in SEQ ID NO.1-2 or SEQ ID NO.4-5.
[0038] Preferably, the probe has a nucleotide sequence as shown in SEQ ID NO.3 or SEQ ID NO.6.
[0039] Preferably, the conditions for the PCR amplification are as follows:
[0040] S1, 95℃ for 10min, heating rate 2℃ / s;
[0041] S2, 94℃ for 30s, heating rate 2℃ / s;
[0042] S3, 60℃ reaction for 1min, heating rate 2℃ / s;
[0043] S4, steps S2-S3 are set to 40 cycles of reaction;
[0044] S5. React at 98°C for 10 min, with a heating rate of 2°C / s.
[0045] The present invention has the following beneficial effects:
[0046] The kit prepared by the primer-probe combination provided by the present invention can be used for the detection of plasmid DNA residues in lentivirus, γ-retrovirus, adenovirus or adeno-associated virus vectors, does not require the establishment of additional standards, does not require additional sample pretreatment, and can obtain accurate and repeatable detection data with good repeatability and precision. BRIEF DESCRIPTION OF THE DRAWINGS
[0047] Figure 1This is a raindrop diagram of the ORI-1 and ORI-2 primer-probe combinations.
[0048] Figure 2 Raindrop plots of 100X and 1000X dilutions of ORI-1 primer-probe combination.
[0049] Figure 3 Raindrop plots of 100X and 1000X dilutions of the ORI-2 primer-probe combination.
[0050] Figure 4 This is a raindrop diagram of the ORI-3 probe combination. DETAILED DESCRIPTION
[0051] The specific embodiments of the present invention will be described in detail below. In order to avoid too much unnecessary details, the well-known structures or functions will not be described in detail in the following examples. Unless otherwise defined, the technical and scientific terms used in the following examples have the same meanings as those generally understood by those skilled in the art to which the present invention belongs.
[0052] Example 1 Primer-probe combination of the present invention
[0053] The sequence information of the primers and probes in the ORI-1 primer-probe combination is shown in Table 1, and the sequence information of the primers and probes in the ORI-2 primer-probe combination is shown in Table 2. According to Table 3, the reaction mixture 1 and the reaction mixture 2 were prepared respectively.
[0054] Table 1 ORI-1 primer and probe sequence information
[0055] name Sequence (5'→3') Serial Number ORI-1-F GTAGCACCGCCTACATACCT SEQ ID NO.1 ORI-1-R GTCTTGAGTCCAACCCGGTA SEQ ID NO.2 ORI-1-P FAM-CGCCACTGGCAGCAGCCACT-BHQ1 SEQ ID NO.3
[0056] Table 2 ORI-2 primer and probe sequence information
[0057] name Sequence (5'→3') Serial Number ORI-2-F AAGTCGTGTCTTACCGGGTT SEQ ID NO.4 ORI-2-R ATACCTGTCCGCCTTTCTCC SEQ ID NO.5 ORI-2-P FAM-CGTTCAGCCCGACCGCTGCG-BHQ1 SEQ ID NO.6
[0058] Table 3 Preparation of reaction mixture
[0059]
[0060] Example 2 Determination of residual plasmid DNA
[0061] The virus packaging cells were lysed with a detergent containing Triton X-100: the released AAV was then digested with nuclease and clarified and filtered, and finally purified by chromatography using CORE700 chromatography filler. The purified AAV was divided into several portions and stored in a -80°C refrigerator. Before testing, an AAV sample was taken for plasmid DNA residue detection.
[0062] Add reaction mixture 1 or reaction mixture 2 to a 96-well plate dedicated to digital PCR at 16.5 μL / well. After the AAV sample is melted, dilute the sample 100 times, 200 times, 1000 times, and 2000 times with nuclease-free water containing 0.05% P-F68 according to the estimated amount of residual plasmid DNA. Take 5.5 μL of each diluted AAV sample and add it to the corresponding position of the 96-well plate. Vortex the liquid in the 96-well plate and centrifuge it briefly. Turn on the automatic droplet generator, select the probe method droplet generation program, put the 96-well plate in it, and start the run after confirmation to generate droplets.
[0063] After the droplet generation is completed, the newly generated 96-well plate containing the droplets is taken out, and the plate is sealed with a PX1 plate sealer and PCR amplification is performed according to the PCR reaction conditions in Table 4. After the PCR reaction is completed, the 96-well plate is taken out and placed in a droplet reader, and the droplet reading program is run after setting the relevant parameters such as the detection fluorescence channel such as FAM.
[0064] Table 4 PCR reaction conditions
[0065]
[0066]
[0067] Result processing: According to the sample copy number reading results, the residual amount of plasmid DNA was calculated according to the formula: plasmid DNA copy number copies / μL = reading value (copies / μL) × 4 × dilution factor. The experiment was repeated twice, and the test results are shown in Table 5.
[0068] Table 5 Residual amount of plasmid DNA
[0069]
[0070] The results showed that the back-calculated values of samples at different dilutions in each experiment were consistent, and the back-calculated values of the test results of the same sample at different times were consistent. This detection method has good repeatability and precision.
[0071] By analyzing the ORI-1 and ORI-2 primer-probe combination raindrop plots ( Figure 1 ), when the sample was diluted 100 times, the fluorescence intensity of the positive droplets was about 12000, and that of the negative droplets was about 1000, the clustering was obvious, and both pairs of primers could meet the requirements.
[0072] The raindrop diagram of the ORI-1 primer-probe combination or ORI-2 primer-probe combination diluted 100X and 1000X respectively is as follows Figure 2-Figure 3 The results show that the back-calculated values of samples at different dilutions are consistent, and both sets of primer probe pairs can meet the detection requirements.
[0073] Comparative Example 1 ORI-3 Primer Probe Combination
[0074] The sequence information of the primers and probes in the ORI-3 primer-probe combination is shown in Table 6. Reaction mixture 3 was prepared according to Table 7. Referring to the method described in "Example 2 Determination of residual plasmid DNA", the residual plasmid DNA in the AAV sample was determined using the reaction mixture 3. The results are shown in Table 8 and the raindrop diagram is shown in Table 8. Figure 4 According to the test results, the ORI-3 primer-probe combination cannot accurately detect.
[0075] Table 6 ORI-3 primer and probe sequence information
[0076] name Sequence (5'→3') Serial Number ORI-1-F GTAGCACCGCCTACATACCT SEQ ID NO.1 ORI-1-R GTCTTGAGTCCAACCCGGTA SEQ ID NO.2 ORI-2-P FAM-CGTTCAGCCCGACCGCTGCG-BHQ1 SEQ ID NO.6
[0077] Table 7 Preparation of reaction mixture 3
[0078] name Volume (μL) ddPCR 2X Supermix 11 ORI-1-F (20 μM) 0.99 ORI-1-R (20 μM) 0.99 ORI-2-P (10 μM) 0.55 water 2.97 Total volume 16.5
[0079] Table 8 Residual amount of plasmid DNA in reaction solution 3
[0080]
[0081] The above detailed description is a specific description of one of the feasible embodiments of the present invention, and the embodiment is not intended to limit the scope of the present invention. It should be pointed out that any equivalent implementation or change that does not deviate from the present invention should be included in the scope of the technical solution of the present invention. Therefore, the protection scope of the patent of the present invention shall be based on the attached requirements.
Claims
1. A primer-probe combination for detecting residual plasmid DNA, It is characterized in that The primer-probe combination includes a primer pair and a probe; The primer pair has the nucleotide sequence shown in SEQ ID NO.1-2, and the probe has the nucleotide sequence shown in SEQ ID NO.3; or The primer pair has the nucleotide sequence shown in SEQ ID NO.4-5, and the probe has the nucleotide sequence shown in SEQ ID NO.
6.
2. The primer-probe combination according to claim 1, It is characterized in that The primer pair of the primer-probe combination includes a forward primer and a reverse primer; The forward primer comprises a nucleotide sequence as shown in SEQ ID NO.1 or SEQ ID NO.4; The reverse primer includes a nucleotide sequence as shown in SEQ ID NO.2 or SEQ ID NO.
5.
3. The primer-probe combination according to claim 2, It is characterized in that The concentration ratio of the forward primer, the reverse primer and the probe in the primer-probe combination is 2:2:
1.
4. The primer-probe combination according to claim 1, It is characterized in that The probe may be labeled with a fluorescent group or a quenching group at the 5' end or the 3' end; The fluorescent group is selected from FAM, VIC, TET, CAL Gold 540, JOE, HEX, TAMRA, ROX, CY3 or CY5; the quenching group is selected from DABCYL, BHQ1, BHQ2, BHQ3 or ECLIPE.
5. Use of the primer-probe combination according to any one of claims 1 to 4 in preparing a kit.
6. A kit, It is characterized in that The kit comprises the primer combination according to any one of claims 1 to 5.
7. Use of the kit according to claim 6 in detecting residual plasmid DNA.
8. The use according to claim 7, It is characterized in that The kit is used for detecting residual plasmid DNA in lentivirus, gamma-retrovirus, adenovirus or adeno-associated virus vectors.
9. A method for detecting residual plasmid DNA, It is characterized in that The method comprises using the primer-probe combination of claims 1 to 4 or the kit of claim 6; the method comprises the following steps: (1) diluting the sample to be tested, mixing it with the reaction mixture containing the primer-probe combination, vortexing it, and centrifuging it to generate droplets; (2) performing a PCR amplification reaction and reading the copy number of the sample after the reaction is completed; (3) Calculate the residual plasmid DNA based on the copy number of the sample.
10. The method according to claim 9, It is characterized in that The conditions of the PCR amplification are as follows: S1, 95℃ for 10min, heating rate 2℃ / s; S2, 94℃ for 30s, heating rate 2℃ / s; S3, 60℃ reaction for 1min, heating rate 2℃ / s; S4, steps S2-S3 are set to 40 cycles of reaction; S5. React at 98°C for 10 min, with a heating rate of 2°C / s.