Complete set of nucleic acid, kit and detection method for detecting severe fever with thrombocytopenia syndrome virus by RT-ERA method

Abstract

The invention relates to a complete set of nucleic acid, a kit and a detection method for detecting a severe fever with thrombocytopenia syndrome virus by an RT-ERA method. The complete set of nucleic acid contains a fluorescent probe SFTSV NSs P1, a forward primer F1 and a reverse primer R1. The kit contains the nucleic acid set. The detection method adopts the kit. Aiming at the SFTSV, the highly conservative NSs gene of the SFTSV is taken as a target, effective detection is realized by an RT-ERA method, the result is reliable, the cost is relatively low, and the method has the characteristics of simplicity, rapidness and sensitivity.

Description

Technical Field

[0001] The invention relates to a complete set of nucleic acids, a kit and a detection method for detecting fever with thrombocytopenia syndrome virus by RT-ERA method. The complete set of nucleic acids comprises primers and probes, and belongs to the field of molecular biotechnology. Background Art

[0002] Severe fever with thrombocytopenia syndrome (SFTS) is a natural epidemic disease caused by infection with severe fever with thrombocytopenia syndrome virus (SFTSV), also known as Dabie bandavirus (DBV). The disease was first reported in China in 2009 and later reported in South Korea, Japan, the United States and other places; its main symptoms include fever, thrombocytopenia, dizziness, nausea, and severe patients can cause multiple organ failure, with a mortality rate of up to 30%. SFTSV is mainly transmitted through tick bites, and can also be transmitted from person to person through contact with the patient's blood or other body fluids. It is also possible to be transmitted through the respiratory tract. The peak season of the disease is mainly concentrated in March to November each year, and the peak period is May to June. The main population of the disease is farmers, and they are mainly distributed in mountainous and hilly areas. People over 60 years old have a higher risk of infection, and the mortality rate increases with age, which may be related to the weakening of the immune system function of the elderly. Due to the lack of effective therapeutic drugs and preventive vaccines, establishing rapid diagnostic testing methods and taking timely measures are of great significance to controlling the epidemic.

[0003] The detection methods of SFTSV include nucleic acid detection, serological detection and virus isolation and identification. At present, a variety of methods have been developed to detect the viral RNA, mainly targeting the highly conserved regions of the L, M or S genes of SFTSV. Among these detection methods, real-time fluorescence quantitative PCR (RT-PCR) is the gold standard for accuracy and sensitivity, but it has high requirements for equipment and operators, and the reaction time is long (about 2 hours). The emergence of diagnostic tools such as reverse transcription loop-mediated isothermal amplification (RT-LAMP) and CRISPR-based nucleic acid detection has greatly shortened the detection time. Enzyme-linked immunosorbent assay (ELISA) and immunofluorescence assay (IFA) are commonly used for serological diagnosis, but serological detection has low sensitivity and specificity. Virus isolation and identification have high accuracy, but the identification operation is complicated and time-consuming. Therefore, accurate and rapid diagnostic technology is essential for providing appropriate care, controlling the spread of the virus, and effectively controlling the disease.

[0004] Reverse transcription enzymatic recombinase amplification (RT-ERA) is an enzymatic isothermal amplification technology developed in my country. It is based on the principle of self-amplification and replication of the genetic material of organisms. Through protein directed evolution, DNA and ribozyme affinity maturation and other technologies, specific tool enzymes from bacteria, viruses and bacteriophages are transformed and mutated and their functions are screened. RT-ERA can complete the detection within 5 to 20 minutes under isothermal conditions (generally 37°C to 42°C). ERA technology has been used in the detection of pathogens such as norovirus, new coronavirus, and chikungunya virus, but there is no technical solution for detecting SFTSV using ERA technology. Summary of the invention

[0005] The main purpose of the present invention is to overcome the problems existing in the prior art and provide a set of nucleic acids for detecting fever with thrombocytopenia syndrome virus by RT-ERA method, taking the conservative region of the NSs gene of the virus as the target gene, which can be used for detecting fever with thrombocytopenia syndrome virus SFTSV by RT-ERA method; at the same time, a kit containing the set of nucleic acids and a corresponding detection method are also provided, which can accurately, quickly and effectively detect SFTSV.

[0006] The technical solution of the present invention to solve the technical problem is as follows:

[0007] A set of nucleic acids for detecting fever with thrombocytopenia syndrome virus by RT-ERA method, characterized in that the set of nucleic acids consists of a fluorescent probe and a primer pair, and the primer pair consists of a forward primer and a reverse primer; the fluorescent probe is SFTSV NSs P1, and its sequence is that a thymine base labeled with a fluorescent group, tetrahydrofuran, and a thymine base labeled with a quenching group are inserted in sequence between the 30th base and the 31st base of SEQ ID NO:1, and a blocking group is added to the 3' end of SEQ ID NO:1; the forward primer is F1, and its sequence is SEQ ID NO:7; the reverse primer is R1, and its sequence is SEQ ID NO:13.

[0008] After using the above-mentioned set of nucleic acids, the genomic RNA of the sample to be tested is used as a template to perform constant temperature RT-ERA amplification to obtain RT-ERA amplification products, and the amplification results are judged according to the fluorescent signal value of the amplification curve, thereby realizing the detection of fever with thrombocytopenia syndrome virus SFTSV by RT-ERA method.

[0009] Preferably, the fluorescent group is FAM, the quenching group is BHQ, and the blocking group is C3-spacer.

[0010] Preferably, the target gene of the set of nucleic acids is the NSs gene sequence of the fever with thrombocytopenia syndrome virus, and the NSs gene sequence is SEQ ID NO:14.

[0011] The above preferred scheme can better realize the detection of fever with thrombocytopenia syndrome virus SFTSV by RT-ERA method.

[0012] The present invention also provides:

[0013] A kit for detecting fever with thrombocytopenia syndrome virus by RT-ERA method, characterized in that the kit comprises a fluorescent probe solution, a forward primer solution, and a reverse primer solution, and the fluorescent probe, forward primer, and reverse primer belong to the set of nucleic acids described above.

[0014] Preferably, the kit further comprises an RT-fluorescence amplification reagent, a dissolving agent, an activating agent, and ultrapure water; wherein the RT-fluorescence amplification reagent is a lyophilized powder, and the dissolving agent, the activating agent and the ultrapure water are all liquids.

[0015] More preferably, the RT-fluorescence amplification reagent and the dissolving agent are both provided by a commercially available basic universal RT-ERA kit; and the activating agent is a magnesium acetate solution.

[0016] More preferably, the kit adopts a 50 μl reaction system, each reaction tube contains 20 μl of solvent, 2.1 μl of 10 μM forward primer, 2.1 μl of 10 μM reverse primer, 0.6 μl of 10 μM fluorescent probe, 21.2 μl of ultrapure water, 2 μl of activator, and 2 μl of nucleic acid sample to be tested; the fluorescent ERA amplification time of the kit is within 20 min.

[0017] The above kit can be used to effectively detect fever with thrombocytopenia syndrome virus SFTSV by RT-ERA method.

[0018] The present invention also provides:

[0019] An RT-ERA detection method for detecting fever with thrombocytopenia syndrome virus for non-diagnostic purposes, characterized in that the kit described above is used; the RT-ERA detection method comprises the following steps:

[0020] Step 1: Add the reagent, fluorescent probe solution, forward primer solution, reverse primer solution, and ultrapure water of the kit into a reaction tube to obtain a premixed reaction solution;

[0021] Step 2: Transfer the premixed reaction solution to the RT-fluorescence amplification reagent, shake and mix until the RT-fluorescence amplification reagent is mixed, and centrifuge;

[0022] Step 3: Add the nucleic acid sample to be tested into the reaction tube, mix well and centrifuge;

[0023] Step 4: Add the activator to the reaction tube cover, cover the tube tightly, centrifuge to allow the activator to enter the liquid in the tube, shake and mix, and centrifuge again to obtain the sample group; at the same time, use sterile water as the blank control group;

[0024] Step 5: Place the reaction tube in a fluorescence thermostatic amplification instrument to perform RT-ERA amplification and collect the fluorescence value;

[0025] Step 6. The reaction is completed and the data is saved. If there is no amplification curve in the blank control group and the fluorescence overflow value of the sample group is greater than the preset value and there is an amplification curve, the nucleic acid sample to be tested is determined to be positive. If the fluorescence overflow value of the sample group is less than the preset value and there is no amplification curve, the nucleic acid sample to be tested is determined to be negative.

[0026] Preferably, the kit adopts a 50 μl reaction system. When obtaining the sample set in the fourth step, each reaction tube contains 20 μl of solvent, 2.1 μl of 10 μM forward primer, 2.1 μl of 10 μM reverse primer, 0.6 μl of 10 μM fluorescent probe, 21.2 μl of ultrapure water, 2 μl of activator, and 2 μl of nucleic acid sample to be tested.

[0027] Preferably, in the fifth step, during RT-ERA amplification, the temperature is 37°C-42°C for 20 minutes, and the FAM channel fluorescence value is collected every 30 seconds; in the sixth step, the preset value is 300.

[0028] The above detection method can be used to successfully detect fever with thrombocytopenia syndrome virus (SFTSV) by RT-ERA for non-diagnostic purposes. The results are reliable, the cost is relatively low, and it is simple, rapid, and sensitive.

[0029] Compared with the prior art, the present invention targets the fever with thrombocytopenia syndrome virus SFTSV, takes its highly conserved NSs gene as the target, designs a variety of probe primer combinations, and obtains a set of nucleic acids P1-F1R1 with the best fluorescence intensity after optimization and screening, which has good detection specificity and detection sensitivity. The kit of the present invention with this set of nucleic acids as the core has a suitable amplification temperature of 37°C-42°C, which is lower than other isothermal methods, and can effectively detect the fever with thrombocytopenia syndrome virus SFTSV by RT-ERA. The detection method of the present invention using this kit can complete amplification within 40 minutes, and the detection limit (detection sensitivity) can reach 100 copies / μl. Compared with other detection methods, the results of the present invention are reliable, the cost is relatively low, and it has the characteristics of simplicity, rapidity and sensitivity.

[0030] The present invention is suitable for on-site rapid detection of fever with thrombocytopenia syndrome virus (SFTSV), provides technical support for emergency detection and prevention and control of SFTSV, and provides necessary means for early rapid screening and risk prevention and control of SFTSV in my country. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 This is a concentration amplification diagram of the positive control serial dilution in Example 2 of the present invention.

[0032] Figure 2 This is the positive control standard curve of Example 2 of the present invention.

[0033] Figure 3 Schematic diagram of all combinations of probes and primers screened in Example 3 of the present invention.

[0034] Figure 4 This is a diagram of the combined amplification containing the P1 probe in Example 3 of the present invention.

[0035] Figure 5 This is the RT-ERA amplification diagram of the detection limit of SFTSV by the probe primer combination P1-F1R1 in Example 4 of the present invention, and its minimum detection limit is 100 copies / μl.

[0036] Figure 6 This is the specific RT-ERA amplification diagram of the probe primer combination P1-F1R1 in Example 5 of the present invention. DETAILED DESCRIPTION

[0037] The inventors' research group of the present invention designed 6 fluorescent probes modified with fluorescent groups, 3 forward primers, and 1 reverse primer for the RT-ERA method based on the NSs gene sequence of the fever with thrombocytopenia syndrome virus SFTSV. Using a positive control containing the NSs gene, 36 combinations were tested to screen out the best probe primer combination P1-F1R1. After testing, the detection limit (detection sensitivity) of SFTSV using the RT-ERA method using the probe primer combination P1-F1R1 can reach 100 copies / μl, with good specificity and high detection accuracy. Based on the above research results, the present invention proposes a set of nucleic acids for detecting fever with thrombocytopenia syndrome virus by RT-ERA method, a kit containing the set of nucleic acids, and a corresponding detection method.

[0038] The present invention will be described in further detail below with reference to the accompanying drawings and in combination with embodiments, but the present invention is not limited to the examples given.

[0039] For the experimental operations involved in the following content, if the specific experimental conditions are not specified, they shall be carried out according to conventional conditions, for example, the conditions described in "Molecular Cloning: A Laboratory Manual" edited by SAMBROOK.J et al., 4th edition (Molecular Cloning: A Laboratory Manual; NEW York: Cold Spring Harbor Laboratory Press, 2017), or the conditions recommended by the manufacturer.

[0040] The experimental materials and reagents involved in the following content are commercially available unless otherwise specified.

[0041] Example 1

[0042] In this example, fluorescent probes and primers for ERA detection were designed and synthesized for fever with thrombocytopenia syndrome virus (SFTSV).

[0043] By searching and comparing the NCBI database ( https: / / www.ncbi.nlm.nih.gov) The sequences of different subtypes of febrile thrombocytopenia syndrome virus (SFTSV) were identified and the conserved regions of their NSs genes were screened as target sequences.

[0044] According to the RT-ERA fluorescent primer and probe design guide provided by Suzhou Xinda Company, the design of probes and primers for the ERA reaction follows the following principles: (1) The primer length should be 28-35 nt nucleotides; (2) The GC content of the primer is controlled at 35%-60%; (3) The length of the primer amplification fragment is between 100-250bp; (4) The probe length is 46-52 nucleotides, of which the 5' end of the restriction enzyme cleavage site has at least 30 nucleotides and the 3' end has at least 15 nucleotides; (5) The probe fluorophore and quencher can only be labeled on thymine (T); (6) A blocking group is added to the 3' end of the probe. According to the above principles, PrimerPremier5.0 software was used to design probe and primer sequences, and the quality of primers (whether they contained hairpin structures, dimers, mismatched double strands) was evaluated. The specificity of primers was verified by Primer-blast, and finally 6 probe sequences, 3 forward primer sequences, and 1 reverse primer sequence were screened. The specific sequences are shown in Table 1; among them, tetrahydrofuran (THF) was inserted into the fluorescent probe as the restriction exonuclease cleavage site, and the left and right thymine bases of THF were added with FAM fluorescent groups and BHQ quenching groups, respectively, and C3-spacer blocking groups were added to the 3' end. All probes and primers were synthesized by Suzhou Zixi Biotechnology Co., Ltd.

[0045] Table 1. Screening probe and primer sequences

[0046]

[0047]

[0048] Example 2

[0049] In this example, a positive control substance for ERA detection was synthesized and a standard curve was generated using the positive control substance.

[0050] The method for obtaining the positive control is as follows:

[0051] The T7 promoter sequence (TAATACGACTCACTATAG) was added to the front end of the NSs gene target sequence of the fever with thrombocytopenia syndrome virus SFTSV (as shown in SEQ ID NO: 14), and the NotI restriction site sequence (GCGGCCGC) was added to the rear end, and then cloned into the pUC18 vector (synthesized by GenScript Biotech Co., Ltd.) and sequenced, and named as SFTSV NSs plasmid.

[0052] The SFTSV NSs plasmid was digested with NotI restriction endonuclease, purified by gel cutting and used as a template for in vitro transcription using RiboMax T7 In Vitro Transcription System (Promega, USA). The DNA template was completely degraded with DNase enzyme reagent, and the obtained RNA product was purified using an RNA purification kit (Qiagen). The obtained RNA fragment was the SFTSV NSs positive control.

[0053] The concentration of SFTSV NSs positive control was determined by Qubit4.0, and the formula (6.02×10 23 )×[concentration (ng / μL)×10 -9 ] Calculate its copy number concentration by 10-fold dilution to obtain 1×10 1 copies / μL, 1×10 2 copies / μL, 1.0×10 3 copies / μL, 1.0×10 4 copies / μL, 1.0×10 5 copies / μL, 1.0×10 6 The SFTSV nucleic acid detection kit (Da'an Gene, DA0340) was used to detect the SFTSV NSs positive control (RNA fragment) with a series of dilution concentrations. The amplification diagram is shown in Figure 1 As shown, draw its standard curve as Figure 2 As shown, the fitting straight line is: Y = -3.543X + 41.36, R 2 =0.9898.

[0054] The target sequence of the NSs gene of severe fever with thrombocytopenia syndrome virus (SFTSV) is SEQ ID NO:14: atgtcgctgagcaaatgctccaacgttgacctcaaatctgtagcaatgaatgccaacactgtcaggcttgagccatctctaggagagtaccccaccctcaggagagacctcgttgagtgctcttgtagtgtgttgactctgtcaatggtcaagaggatgggtaagatgaccaacactgtttggttatttggcaacccaaaaaatcctcttcaccagcttgagcccggacttgagcagttgttggacatgtactacaaggacatgaggtgctactcccagagagagctgagtgctctcaggtggcctagtggaaaaccatctgtatggttcctacaggcagctcacatgttcttctccatcaagaacagctgggcaatggaaaccggaagagagaactggcggggcctcttccacaggattacaaaaggccagaagtacctttttgaaggggacatgatattggattctcttgaagccattgagaagcgaaggcttagacttgggttacctgagatcctaataactggactatccccaattctggatgtggccctcctccagatagagtcacttgcaaggctaagaggcatgagcttgaaccaccacttattcacttctccctcattgcgtaagcctctattggactgttgggacttctttattcctgtccgcaaaaagaagacagatggctcttacagtgtcttggatgaggatgaagagcctggagtccttcatggttacccacatctgatggcacactatttaaataggtgccctttccacaacctcatcaggtttgatgaagagctgagaactgcagccctgaacaccatctggggaagagattggccagccattggtgacctcccgaaggaggtctaa。

[0055] Example 3

[0056] In this example, the SFTSV NSs positive control obtained in Example 2 was used as a template to screen the optimal fluorescent probe and primers.

[0057] The SFTSV RT-ERA detection kit was used, which included a fluorescent probe (10 μM) solution, a forward primer (10 μM) solution, a reverse primer (10 μM) solution, an RT-fluorescence amplification reagent (lyophilized powder), a dissolving agent (basic universal RT-ERA reagent provided, product number KS104), an activator (magnesium acetate) and ultrapure water, and the SFTSV NSs positive control obtained in Example 2 was used as a template to screen the optimal fluorescent probe and primer. The reaction system for each sample is as follows:

[0058]

[0059]

[0060] The specific implementation steps are as follows:

[0061] The first step is to add the solvent, fluorescent probe solution, forward primer solution, reverse primer solution and ultrapure water in the kit into a transparent tube to obtain a premixed solution.

[0062] Step 2: Transfer the premixed solution to the RT-fluorescence amplification reagent (lyophilized powder, containing RNA reverse transcription reagent), shake thoroughly until the amplification reagent is mixed, and centrifuge briefly.

[0063] Step 3: Add SFTSV NSs positive control to the reaction tube, mix well and centrifuge briefly.

[0064] Step 4: Add 2 μl of activator to the reaction tube cap, carefully close the tube cap, centrifuge briefly to allow the activator to enter the premixed solution, vortex briefly to mix, and centrifuge quickly again to obtain the sample group; at the same time, use sterile water as the blank control group.

[0065] Step 5: Place the reaction tube in the fluorescence thermostatic amplification instrument GS8 (40°C-42°C) for RT-ERA amplification for 20 minutes, and collect the FAM channel fluorescence value every 30 seconds.

[0066] Step 6. After the reaction is completed, save and analyze the data.

[0067] This example uses the 6 probes, 6 forward primers and 1 reverse primer screened in Example 1, with a total of 36 combinations, as shown in the following examples: Figure 3 In this example, 2 μl of SFTSV NSs positive control (10 4 The combination containing the P1 probe was found to be superior to other probe-primer combinations. The amplification diagram of the combination containing the P1 probe is shown in Figure 4 As shown, the probe primer combination with the highest amplification efficiency is P1-F1R1, and the specific sequence is shown in Table 2 below.

[0068] Table 2. Sequences of P1-F1R1 combination

[0069]

[0070] Example 4

[0071] In this example, the sensitivity of the probe primer combination P1-F1R1 obtained in Example 3 was identified.

[0072] The copy concentration is 10 6 The SFTSV NSs positive control with a concentration of 10 copies / μl was used as a template for sensitivity evaluation and diluted 10 times in a concentration gradient to prepare 10 6 copies / μl, 10 5 copies / μl, 10 4 copies / μl, 10 3 copies / μl, 10 2 copies / μl, 10 1 The positive standard of 1000 copies / μl was used as standby. The above quantitative samples were measured using the optimized RT-ERA amplification reaction system and the probe primer combination P1-F1R1. The results are as follows Figure 5 As shown, the detection limit (detection sensitivity) of SFTSV can reach 100 copies / μl.

[0073] Example 5

[0074] In this example, the probe primer combination P1-F1R1 obtained in Example 3 was subjected to specificity analysis.

[0075] This example uses virus samples related to mosquito-borne transmission or with similar clinical symptoms, specifically: fever with thrombocytopenia syndrome virus SFTSV, novel coronavirus COV-19, Japanese encephalitis virus JEV, dengue virus DENV, chikungunya virus CHIKV and Zika virus ZIKA for simultaneous detection, using the probe primer combination P1-F1R1 obtained in Example 3 for detection, and setting a negative control group NC, the results are as follows Figure 6 As shown, only the fever with thrombocytopenia syndrome virus SFTSV produced a fluorescence curve, while no amplification curve was produced for other pathogens, which shows that the probe primer combination P1-F1R1 obtained in Example 3 has good specificity.

[0076] Example 6

[0077] In this embodiment, the RT-ERA method of the present invention and the prior art RT-qPCR method are used to detect the same sample respectively, and a comparative analysis is performed.

[0078] There were 26 samples in total, including 8 virus strain samples and 16 clinical samples.

[0079] Using the existing RT-qPCR method, 18 cases were detected to be positive and 8 cases were negative.

[0080] The dual fluorescence RT-ERA method of the present invention detected 16 positive cases and 10 negative cases; the diagnostic sensitivity of RT-ERA was 88.9% (16 / 18), the diagnostic specificity was 100% (8 / 8), and the Kappa value was 92.3%, indicating that the dual fluorescence RT-ERA rapid detection method established by the present invention has high detection accuracy for real samples.

[0081] Table 3. Comparison of RT-ERA and RT-qPCR detection

[0082]

[0083]

[0084] In addition to the above embodiments, the present invention may also have other implementation modes. Any technical solution formed by equivalent replacement or equivalent transformation falls within the protection scope required by the present invention.

Claims

1. A set of nucleic acids for detecting fever with thrombocytopenia syndrome virus by RT-ERA method, Its characteristics are: The nucleic acid set consists of a fluorescent probe and a primer pair, wherein the primer pair consists of a forward primer and a reverse primer; the fluorescent probe is SFTSV NSs P1, and its sequence is a thymine base labeled with a fluorescent group, tetrahydrofuran, and a thymine base labeled with a quenching group inserted in sequence between the 30th base and the 31st base of SEQ ID NO:1, and a blocking group is added to the 3' end of SEQ ID NO:1; the forward primer is F1, and its sequence is SEQ ID NO:7; the reverse primer is R1, and its sequence is SEQ ID NO:

13.

2. A nucleic acid kit for detecting fever with thrombocytopenia syndrome virus by RT-ERA method according to claim 1, Its characteristics are: The fluorescent group is FAM, the quenching group is BHQ, and the blocking group is C3-spacer.

3. A nucleic acid kit for detecting fever with thrombocytopenia syndrome virus by RT-ERA method according to claim 1, Its characteristics are: The target gene of the set of nucleic acids is the NSs gene sequence of the fever with thrombocytopenia syndrome virus, and the NSs gene sequence is SEQ ID NO:

14.

4. A kit for detecting fever with thrombocytopenia syndrome virus by RT-ERA method, Its characteristics are: The kit comprises a fluorescent probe solution, a forward primer solution, and a reverse primer solution, wherein the fluorescent probe, forward primer, and reverse primer belong to the nucleic acid set according to any one of claims 1 to 3.

5. A kit for detecting fever with thrombocytopenia syndrome virus by RT-ERA method according to claim 4, Its characteristics are: The kit also includes RT-fluorescence amplification reagent, a dissolving agent, an activating agent, and ultrapure water; wherein the RT-fluorescence amplification reagent is a lyophilized powder, and the dissolving agent, the activating agent, and the ultrapure water are all liquid.

6. A kit for detecting fever with thrombocytopenia syndrome virus by RT-ERA method according to claim 5, Its characteristics are: The RT-fluorescence amplification reagent and the dissolving agent are both provided by a commercially available basic universal RT-ERA method kit; the activating agent is a magnesium acetate solution.

7. A kit for detecting fever with thrombocytopenia syndrome virus by RT-ERA method according to claim 5, Its characteristics are: The kit adopts a 50 μl reaction system, and each reaction tube contains 20 μl of a dissolving agent, 2.1 μl of a 10 μM forward primer, 2.1 μl of a 10 μM reverse primer, 0.6 μl of a 10 μM fluorescent probe, 21.2 μl of ultrapure water, 2 μl of an activator, and 2 μl of a nucleic acid sample to be tested; the fluorescent ERA amplification time of the kit is within 20 minutes.

8. An RT-ERA assay for detecting fever with thrombocytopenia syndrome virus for non-diagnostic purposes, Its characteristics are: Using the kit according to any one of claims 4 to 7; The RT-ERA detection method comprises the following steps: Step 1: Add the reagent, fluorescent probe solution, forward primer solution, reverse primer solution, and ultrapure water of the kit into a reaction tube to obtain a premixed reaction solution; Step 2: Transfer the premixed reaction solution to the RT-fluorescence amplification reagent, shake and mix until the RT-fluorescence amplification reagent is mixed, and centrifuge; Step 3: Add the nucleic acid sample to be tested into the reaction tube, mix well and centrifuge; Step 4: Add the activator to the reaction tube cover, cover the tube tightly, centrifuge to allow the activator to enter the liquid in the tube, shake and mix, and centrifuge again to obtain the sample group; at the same time, use sterile water as the blank control group; Step 5: Place the reaction tube in a fluorescence thermostatic amplification instrument to perform RT-ERA amplification and collect the fluorescence value; Step 6. The reaction is completed and the data is saved. If there is no amplification curve in the blank control group and the fluorescence overflow value of the sample group is greater than the preset value and there is an amplification curve, the nucleic acid sample to be tested is determined to be positive. If the fluorescence overflow value of the sample group is less than the preset value and there is no amplification curve, the nucleic acid sample to be tested is determined to be negative.

9. The RT-ERA detection method for detecting HFTS virus for non-diagnostic purposes according to claim 8, Its characteristics are: The kit uses a 50 μl reaction system. When obtaining the sample group in the fourth step, each reaction tube contains 20 μl of a dissolving agent, 2.1 μl of a 10 μM forward primer, 2.1 μl of a 10 μM reverse primer, 0.6 μl of a 10 μM fluorescent probe, 21.2 μl of ultrapure water, 2 μl of an activator, and 2 μl of a nucleic acid sample to be tested.

10. The RT-ERA detection method for detecting fever with thrombocytopenia syndrome virus for non-diagnostic purposes according to claim 9, Its characteristics are: In the fifth step, during RT-ERA amplification, the temperature is 37°C-42°C for 20 minutes, and the FAM channel fluorescence value is collected every 30 seconds; in the sixth step, the preset value is 300.

Images