Light addressing high-flux photoelectrochemical biosensor as well as preparation method and application thereof

Abstract

The invention relates to the technical field of biosensing, in particular to a light addressing high-flux photoelectrochemical biosensor and a preparation method and application thereof, the sensor comprises a substrate, and a working electrode, a reference electrode, a counter electrode and a mobile light source which are arranged on the substrate; the substrate is provided with a plurality of detection areas which are distributed in an array, and the working electrodes comprise a plurality of array working electrodes which are distributed in different detection areas; the array working electrode is sequentially modified with a photoactive material, a DNA (Deoxyribose Nucleic Acid) concatemer sensing interface and circulating tumor cells; wherein the light active material is an alpha-Fe2O3 / Bi2S3 II type heterojunction, and the light active material is a Bi2S3 II type heterojunction. The reference electrode is a saturated Ag / AgCl electrode, the counter electrode is a platinum electrode, and the moving light source is an infrared laser pen. According to the light-addressing high-throughput photoelectrochemical biosensor provided by the invention, the defects that high-throughput CTC detection cannot be realized in the existing detection technology and the like are overcome by constructing a multi-detection-region detection array photoelectrochemical biosensing electrode.

Description

Technical Field

[0001] The present application relates to the field of biosensor technology, and in particular to a light-addressable high-throughput photoelectrochemical biosensor and a preparation method and application thereof. Background Art

[0002] Circulating tumor cells (CTCs), as an important marker, are a type of tumor cells that fall off from the primary lesion and metastasize along the blood circulation system. They are the main cause of tumor metastasis. The highly sensitive detection of CTCs provides more real-time information for early diagnosis and prognosis of cancer. At present, methods such as Cell Search technology, flow cytometry, microfluidic chips, inductively coupled plasma mass spectrometry, Raman imaging, and dielectric electrophoresis are applied to the detection research and application of CTCs. However, due to its low sensitivity, long time consumption, complex structure, and inability to detect large quantities of samples, it is difficult to meet the clinical detection needs. Photoelectrochemical (PEC) biosensor is a detection method that combines the biorecognition process (probe part) and the photoelectric conversion process (photoelectrically active substances), has low background signals, and is simple to operate. Among them, the light-addressable PEC biosensor (LA-PECS) that realizes detection in different detection areas by moving the light source is one of the effective methods to meet the needs of high-throughput and rapid detection. At present, the research on the application of LA-PECS in the high-sensitivity and high-throughput detection of tumor cells at home and abroad mainly focuses on the construction of photoactive systems and the amplification of detection signals.

[0003] Photoactive materials are an important component of LA-PECS. They are crucial for molecular fixation, signal generation and transmission during the sensor construction process, and have a direct impact on the sensitivity and stability of the photoelectric sensing system. With the rapid development of nanomaterial synthesis technology, the photoelectron recombination efficiency can be effectively changed by compounding materials with different band gaps or different particle sizes, thereby improving the photocurrent, which is one of the effective means to achieve high sensitivity and low detection line detection of PEC biosensors. The existing technology constructs a biorecognition detection interface or constructs a DNA concatemer based on nucleic acid aptamers for cell detection. Although DNA aptamers and DNA concatemers show unique advantages in the construction of biosensing interfaces, there are still problems in the process of CTCs capture, such as insufficient affinity for binding to cells, a small number of aptamers per unit electrode area, and low efficiency in capturing tumor cells. Summary of the invention

[0004] The embodiments of the present application provide a light-addressable high-throughput photoelectrochemical biosensor and a preparation method and application thereof. By constructing a multi-detection zone detection array photoelectrochemical biosensor electrode, the shortcomings of existing detection technologies such as the inability to achieve high-throughput detection of CTCs are overcome.

[0005] To solve the above technical problems, in the first aspect, an embodiment of the present application provides a light-addressable high-throughput photoelectrochemical biosensor, comprising: a substrate and a working electrode, a reference electrode, a counter electrode and a mobile light source arranged on the substrate; the substrate has a plurality of detection areas distributed in an array, and the working electrode comprises a plurality of array working electrodes distributed in different detection areas; the array working electrode is sequentially modified with photoactive materials, DNA multimer sensing interfaces and circulating tumor cells; wherein the photoactive material is an α-Fe2O3 / Bi2S3Ⅱ type heterojunction; the reference electrode is a saturated Ag / AgCl electrode, the counter electrode is a platinum electrode, and the mobile light source is an infrared laser pen.

[0006] In some exemplary embodiments, each array working electrode includes a photoactive material, a DNA concatemer sensing interface, circulating tumor cells, and a capture electrode for capturing circulating tumor cells; the capture electrode is FTO / α-Fe2O3 / Bi2S3 / Aptamer-DNAConcateme.

[0007] In some exemplary embodiments, the DNA concatemer sensing interface is obtained by preparing a self-assembled DNA concatemer; the self-assembled DNA concatemer is prepared by mixing an amino-functionalized auxiliary DNA chain, a connecting DNA chain, and a capture DNA chain, and adding them to a solvent for incubation and assembly; wherein the amino-functionalized auxiliary DNA chain has a nucleotide sequence as shown in SEQ ID NO.1 (AAAAAAAAAAAAAAACGGCACCTTCCTCGGCA); the connecting DNA chain has a nucleotide sequence as shown in SEQ ID NO.2 (CGGCACCTGGGGGAGTATTGCGGAGGAAGGTGCCG); the capture DNA chain has a nucleotide sequence as shown in SEQ ID NO.3 (TACACCCCCAGGTGCCGAAAAAATGCTACGGG TCCAAGTTTTTCTCTTGGACCCAAAAACACTACAGAGGTTGCGTCTGTCCCACGTTGTC ATGGGGGGTTGGCCTG) and a nucleotide sequence as shown in SEQ ID NO.4 (CACTACAGAGGTTGCGTCTGTCCCA CGTTGTCATGGGGGGTTGGCCTGAAAAAAAAAAAAAAACGGCACCTGGGGGAGTAAA AAAGGGTCCAAGAGAAAAACTTGGACCCGTAGCAT) contains an aptamer sequence targeting EpCAM protein CTC; the solvent includes Tris-HCl and EDTA solution.

[0008] In some exemplary embodiments, the substrate has five detection areas distributed in an array, and the diameter of the detection area is 0.5 mm; the array working electrodes located in different detection areas are separated by insulating glue.

[0009] In the second aspect, the embodiments of the present application also provide a method for preparing a light-addressable high-throughput photoelectrochemical biosensor, which is applied to the light-addressable high-throughput photoelectrochemical biosensor described in the above embodiments, and includes the following steps: first, providing a substrate, and forming a plurality of detection areas distributed in an array on the substrate; then, preparing a photoactive material, dripping the photoactive material on each detection area, and obtaining a sensing electrode after drying; the photoactive material is an α-Fe2O3 / Bi2S3Ⅱ type heterojunction; next, preparing a self-assembled DNA concatemer to form a DNA concatemer biosensing interface; dripping a chitosan solution and a glutaraldehyde solution on each detection area, incubating and assembling the self-assembled DNA concatemer to obtain a capture electrode; then, adding circulating tumor cells of different concentrations to different detection areas, respectively, to form array working electrodes in different detection areas; finally, assembling the array working electrode, reference electrode, counter electrode and mobile light source to obtain a light-addressable high-throughput photoelectrochemical biosensor.

[0010] In some exemplary embodiments, the reference electrode is a saturated Ag / AgCl electrode, the counter electrode is a platinum electrode, and the moving light source is an infrared laser pen.

[0011] In some exemplary embodiments, the substrate is FTO conductive glass; a substrate is provided, and a plurality of detection areas distributed in an array are formed on the substrate, including: ultrasonically cleaning and drying the FTO conductive glass using acetone, NaOH solution and deionized water in sequence, and then using insulating glue and a circular mold to open a plurality of detection areas distributed in an array on the FTO conductive glass.

[0012] In some exemplary embodiments, the photoactive material is prepared, including: mixing Bi(NO3)3·5H2O and thiourea to prepare a Bi2S3 solution; adding Fe(NO3)3·9H2O to the Bi2S3 solution, and preparing an α-Fe2O3 / Bi2S3 type II heterojunction photoactive material by a hydrothermal method.

[0013] In some exemplary embodiments, preparing a self-assembled DNA concatemer to form a DNA concatemer biosensing interface includes: mixing an amino-functionalized auxiliary DNA chain, a connecting DNA chain, and a capture DNA chain in proportion, adding the mixture to a Tris-HCl and EDTA solution, incubating and assembling the mixture at a certain temperature to obtain a self-assembled DNA concatemer and form a DNA concatemer biosensing interface; the amino-functionalized auxiliary DNA chain has a nucleotide sequence as shown in SEQ ID NO.1 (AAAAAAAAAAAAAAACGGCACCTTCCTCGGCA); the connecting DNA chain has a nucleotide sequence as shown in SEQ ID NO.2 (CGGCACCTGGGGGAGTATTGCGGAGGAAGGTGCCG); the capture DNA chain has a nucleotide sequence as shown in SEQ ID NO.3 (TACACCCCCAGGTGCCGAAAAAATGCTACGGGTCCAAGTTTTTC TCTTGGACCCAAAAACACTACAGAGGTTGCGTCTGTCCCACGTTGTCATGGGGGGTTG GCCTG) and a nucleotide sequence as shown in SEQ ID NO.4 (TACACCCCCAGGTGCCGAAAAAATGCTACGGGTCCAAGTTTTTC TCTTGGACCCAAAAACACTACAGAGGTTGCGTCTGTCCCACGTTGTCATGGGGGGTTG GCCTG); The aptamer sequence shown in NO.4 (CACTACAGAGGTTGCGTCTGTCCCACGTTGTCATGG GGGGTTGGCCTGAAAAAAAAAAAAAAACGGCACCTGGGGGAGTAAAAAAGGGTCCAAGAGAAAAACTTGGACCCGTAGCAT) contains the aptamer sequence targeting EpCAM protein CTC.

[0014] In a third aspect, the embodiments of the present application also provide an application of the light-addressable high-throughput photoelectrochemical biosensor described in the above embodiments in the high-throughput and high-sensitivity detection of circulating tumor cells.

[0015] The technical solution provided by the embodiment of the present application has at least the following advantages:

[0016] The embodiment of the present application provides a light-addressable high-throughput photoelectrochemical biosensor and its preparation method and application. The sensor includes: a substrate and a working electrode, a reference electrode, a counter electrode and a mobile light source arranged on the substrate; the substrate has a plurality of detection areas distributed in an array, and the working electrode includes a plurality of array working electrodes distributed in different detection areas; the array working electrode is sequentially modified with a photoactive material, a DNA concatemer sensing interface and circulating tumor cells; wherein the photoactive material is an α-Fe2O3 / Bi2S3Ⅱ type heterojunction; the reference electrode is a saturated Ag / AgCl electrode, the counter electrode is a platinum electrode, and the mobile light source is an infrared laser pen.

[0017] The light-addressed high-throughput photoelectrochemical biosensor provided in this application uses α-Fe2O3 / Bi2S3Ⅱ-type heterojunction, DNA concatemer (DNA concatemer) biosensor interface and captured circulating tumor cells to construct a working electrode, which provides reference significance for clinical rare cell detection research and application. On the one hand, the application uses α-Fe2O3 / Bi2S3Ⅱ-type heterojunction photoactive materials to overcome the shortcomings of low photogenerated carrier separation efficiency and low signal-to-noise ratio in the prior art. On the other hand, the application uses a DNA concatemer sensing interface to efficiently capture CTCs, overcoming the shortcomings of the existing detection technology due to the extremely small number of CTCs in the blood, low sensitivity, and low signal-to-noise ratio. The light-addressed photoelectrochemical biosensor provided in this application not only solves the existing photoelectric sensing technology in CTC detection low sensitivity, high detection limit, and inability to achieve efficient detection of multiple samples, but also realizes high sensitivity, high specificity and high-throughput detection of CTCs, providing a new way for early detection and clinical research of tumors. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] One or more embodiments are exemplarily described by pictures in the corresponding drawings, and these exemplified descriptions do not constitute limitations on the embodiments. Unless otherwise stated, the pictures in the drawings do not constitute proportional limitations.

[0019] Figure 1 It is a schematic flow chart of a method for preparing a light-addressable high-throughput photoelectrochemical biosensor provided in one embodiment of the present application.

[0020] Figure 2 This is a schematic diagram of agarose gel electrophoresis characterization of the construction process of the DNA concatemer provided in one embodiment of the present application.

[0021] Figure 3 This is a schematic diagram of impedance and photocurrent characterization during the modification construction process provided in one embodiment of the present application.

[0022] Figure 4 This is a schematic diagram of the linear curve of photocurrent corresponding to different CTC concentrations in different detection areas of the photoelectrochemical biosensor provided in one embodiment of the present application and the detected CTC. DETAILED DESCRIPTION

[0023] As can be seen from the background technology, the existing technology constructs a biorecognition detection interface or constructs a DNA concatemer based on nucleic acid aptamers for cell detection. Although DNA aptamers and DNA concatemers show unique advantages in the construction of biosensor interfaces, there are still problems in the CTCs capture process, such as insufficient affinity for binding to cells, a small number of aptamers per unit electrode area, and low efficiency in tumor cell capture.

[0024] With the rapid development of nanomaterial synthesis technology, the effective change of photoelectron recombination efficiency after compounding materials with different band gaps or different particle sizes, thereby improving the photocurrent, is one of the effective means to achieve high sensitivity and low detection line detection of PEC biosensors. For example, a flower-like composite material (AuNPs / MoS2 / TiO2) with a hierarchical structure was prepared in the related technology as the photoactive material of the sensing system for the detection of chloramphenicol (CAP). It has a good linear relationship in the concentration range of 5pM-100nM, and the detection limit is as low as 0.5pM. There is also a related technology that proposes to synthesize a new nanocomposite material GR-CdS:Mn NPs from reduced graphene oxide (GR) and CdS:Mn nanoparticles, and based on this, a dual-signal amplified PEC sensor is designed for HTLV-IIDNA detection, which can detect 1.0×10 -16 ~5×10 -12 M range, the detection limit is 3.3×l0 -17 M. However, in the research on signal amplification of sensing systems, in the search for semiconductor electrode materials with energy level gradient matching to construct PEC sensing systems, the low photoelectric conversion efficiency of the selected materials, the complex synthesis methods of nanomaterials, and the inaccurate matching of the energy level structure of composite materials are still the technical bottlenecks for improving the detection sensitivity of PEC sensing systems. In addition, the construction of the detection interface for biorecognition is also the key to achieving high-sensitivity detection of PEC sensors. Nucleic acid aptamers (Aptamer) are single-stranded oligonucleotide sequences synthesized from deoxyribonucleic acid (DNA) or ribonucleic acid (RNA). Due to their high affinity and sequence programmability, they are used to construct high-sensitivity PEC biosensors. There are also related technologies that have developed an aptamer-DNA concatemer-quantum dot (QDs) probe through DNA hybridization and covalent assembly to construct a biosensing interface for CCRF-CEM cell detection with a detection limit of 50 cells mL -1 Another related technology has constructed a nucleic acid aptamer-mediated DNA concatemer for the capture and high-sensitivity fluorescence detection of Acinetobacter baumannii, with a detection limit of 52.67 cells mL -1 Although DNA aptamers and DNA concatemers show unique advantages in the construction of biosensing interfaces, there are still problems in the CTCs capture process, such as insufficient affinity for binding to cells, a small number of aptamers per unit electrode area, and low efficiency in tumor cell capture.

[0025] In order to solve the above technical problems, the embodiment of the present application provides a light-addressed high-throughput photoelectrochemical biosensor and its preparation method and application. The sensor includes: a substrate and a working electrode, a reference electrode, a counter electrode and a mobile light source arranged on the substrate; the substrate has a plurality of detection areas distributed in an array, and the working electrode includes a plurality of array working electrodes distributed in different detection areas; the array working electrode is sequentially modified with photoactive materials, DNA concatemer sensing interfaces and circulating tumor cells; wherein the photoactive material is an α-Fe2O3 / Bi2S3 type II heterojunction; the reference electrode is a saturated Ag / AgCl electrode, the counter electrode is a platinum electrode, and the mobile light source is an infrared laser pen. The embodiment of the present application provides a light-addressed high-throughput photoelectrochemical biosensor, which overcomes the shortcomings of the existing detection technology such as the inability to achieve high-throughput detection of CTCs by constructing a multi-detection zone detection array photoelectrochemical biosensor electrode.

[0026] The following will describe the various embodiments of the present application in detail with reference to the accompanying drawings. However, it will be appreciated by those skilled in the art that in the various embodiments of the present application, many technical details are provided in order to enable the reader to better understand the present application. However, even without these technical details and various changes and modifications based on the following embodiments, the technical solution claimed in the present application can be implemented.

[0027] See also Figures 1 to 4 The embodiment of the present application provides a light-addressable high-throughput photoelectrochemical biosensor, comprising: a substrate and a working electrode, a reference electrode, a counter electrode and a mobile light source arranged on the substrate; the substrate has a plurality of detection areas distributed in an array, and the working electrode comprises a plurality of array working electrodes distributed in different detection areas; the array working electrode is sequentially modified with a photoactive material, a DNA concatemer sensing interface and circulating tumor cells; wherein the photoactive material is an α-Fe2O3 / Bi2S3Ⅱ type heterojunction; the reference electrode is a saturated Ag / AgCl electrode, the counter electrode is a platinum electrode, and the mobile light source is an infrared laser pen.

[0028] In view of the problems of low photoelectric conversion efficiency of selected materials, complex synthesis methods of nanomaterials, inaccurate energy level structure matching of composite materials, etc. in the process of LA-PECS construction, in seeking semiconductor electrode materials with matching energy level gradients to construct PEC sensing systems, as well as insufficient affinity of DNA aptamers for cell binding in the construction of biosensor interfaces and CTCs capture process, low capture efficiency due to small number of aptamers per unit electrode area, and complex construction process and operation, the present application provides a light-addressable high-throughput photoelectrochemical biosensor, wherein the working electrode comprises a multi-detection zone detection array working electrode, and an array working electrode is constructed using α-Fe2O3 / Bi2S3Ⅱ type heterojunction, DNA concatemer biosensor interface and circulating tumor cells, which provides reference for clinical rare cell detection research and application, and meets the high-throughput and high-sensitivity requirements of existing light-addressable photoelectric sensing technology in CTC detection.

[0029] In some embodiments, each array working electrode includes a photoactive material, a DNA concatemer sensing interface, circulating tumor cells, and a capture electrode for capturing circulating tumor cells; the capture electrode is FTO / α-Fe2O3 / Bi2S3 / Aptamer-DNA Concateme. Aptamer is a nucleic acid aptamer, which is a single-stranded oligonucleotide sequence synthesized from deoxyribonucleic acid (DNA) or ribonucleic acid (RNA). Due to its high affinity and sequence programmability, it is used to construct a high-sensitivity PEC biosensor.

[0030] In some embodiments, the DNA concatemer sensing interface is obtained by preparing a self-assembled DNA concatemer; the self-assembled DNA concatemer is prepared by mixing an amino-functionalized auxiliary DNA chain, a connecting DNA chain, and a capture DNA chain, and adding them to a solvent for incubation and assembly; wherein the amino-functionalized auxiliary DNA chain has a nucleotide sequence as shown in SEQ ID NO.1 (AAAAAAAAAAAAAAACGGCACCTTCCTCGGCA); the sequence of the amino-functionalized auxiliary DNA chain is: 5′-NH2-C12-AAAAAAAAAAAAAAACGGCACCTTCCTCGGCA-3′.

[0031] The connecting DNA chain has the nucleotide sequence shown in SEQ ID NO. 2, that is, the connecting DNA chain has the nucleotide sequence of 5′-CGGCACCTGGGGGAGTATTGCGGAGGAAGGTGCCG-3′.

[0032] The capture DNA chain has an aptamer sequence containing targeting EpCAM protein CTC as shown in SEQ ID NO.3 and SEQ ID NO.4, that is, the capture DNA chain has an aptamer sequence containing targeting EpCAM protein CTC 5′-TACACCCCCAG GTGCCGAAAAAATGCTACGGGTCCAAGTTTTTCTCTTGGACCCAAAAACACTACAGAG GTTGCGTCTGTCCCACGTTGTCATGGGGGGTTGGCCTG-3′ and 5′-CACTACAGAGGTTGCG TCTGTCCCACGTTGTCATGGGGGGTTGGCCTGAAAAAAAAAAAAAAACGGCACCTGGG GGAGTAAAAAAGGGTCCAAGAGAAAAACTTGGACCCGTAGCAT-3′.

[0033] It should be noted that the solvent includes tris(hydroxymethyl)aminomethane hydrochloride (Tris-HCl) and EDTA solution.

[0034] In some embodiments, the substrate has five detection areas distributed in an array, and the diameter of the detection area is 0.5 mm; the array working electrodes located in different detection areas are separated by insulating glue.

[0035] The embodiment of the present application also provides a method for preparing a light-addressable high-throughput photoelectrochemical biosensor, which is applied to the light-addressable high-throughput photoelectrochemical biosensor described in the above embodiment, and includes the following steps: first, providing a substrate, and forming a plurality of detection areas distributed in an array on the substrate; then, preparing a photoactive material, dripping the photoactive material on each detection area, and preparing a sensing electrode after drying; the photoactive material is an α-Fe2O3 / Bi2S3Ⅱ type heterojunction; next, preparing a self-assembled DNA concatemer to form a DNA concatemer biosensing interface; dripping a chitosan solution and a glutaraldehyde solution on each detection area, incubating and assembling with the self-assembled DNA concatemer to obtain a capture electrode; then, adding circulating tumor cells of different concentrations to different detection areas, respectively, to form array working electrodes in different detection areas; finally, assembling the array working electrode, reference electrode, counter electrode and mobile light source to obtain a light-addressable high-throughput photoelectrochemical biosensor.

[0036] In some embodiments, the reference electrode is a saturated Ag / AgCl electrode, the counter electrode is a platinum electrode, and the moving light source is an infrared laser pen.

[0037] In some embodiments, the substrate is FTO conductive glass; a substrate is provided, and a plurality of detection areas distributed in an array are formed on the substrate, including: ultrasonically cleaning and drying the FTO conductive glass with acetone, NaOH solution and deionized water in sequence, and then using insulating glue and a circular mold to open a plurality of detection areas distributed in an array on the FTO conductive glass.

[0038] In some embodiments, preparing a photoactive material includes: mixing Bi(NO3)3·5H2O and thiourea to prepare a Bi2S3 solution; adding Fe(NO3)3·9H2O to the Bi2S3 solution, and using a hydrothermal method to prepare an α-Fe2O3 / Bi2S3 type II heterojunction photoactive material.

[0039] In some embodiments, self-assembled DNA concatemers are prepared to form a DNA concatemer biosensor interface, including: mixing an amino-functionalized auxiliary DNA chain, a connecting DNA chain, and a capture DNA chain in proportion, adding them to a Tris-HCl and EDTA solution, incubating and assembling at a certain temperature to obtain a self-assembled DNA concatemer and form a DNA concatemer biosensor interface; wherein the amino-functionalized auxiliary DNA chain has a nucleotide sequence as shown in SEQ ID NO.1 (AAAAAAAAAAAAAAACGGCACCTTCCTCGGCA); the sequence of the amino-functionalized auxiliary DNA chain is: 5′-NH2-C12-AAAAAAAAAAAAAAACGGCACCTTCCTCGGCA-3′.

[0040] The connecting DNA chain has the nucleotide sequence shown in SEQ ID NO. 2, that is, the connecting DNA chain has the nucleotide sequence of 5′-CGGCACCTGGGGGAGTATTGCGGAGGAAGGTGCCG-3′.

[0041] The capture DNA chain has an aptamer sequence containing targeting EpCAM protein CTC as shown in SEQ ID NO.3 and SEQ ID NO.4, that is, the capture DNA chain has an aptamer sequence containing targeting EpCAM protein CTC 5′-TACACCCCCAG GTGCCGAAAAAATGCTACGGGTCCAAGTTTTTCTCTTGGACCCAAAAACACTACAGAG GTTGCGTCTGTCCCACGTTGTCATGGGGGGTTGGCCTG-3′ and 5′-CACTACAGAGGTTGCG TCTGTCCCACGTTGTCATGGGGGGTTGGCCTGAAAAAAAAAAAAAAACGGCACCTGGG GGAGTAAAAAAGGGTCCAAGAGAAAAACTTGGACCCGTAGCAT-3′.

[0042] See also Figures 1 to 4 The present application provides a light-addressable photoelectrochemical biosensor and a method for preparing the same. The light-addressable photoelectrochemical biosensor and a method for preparing the same are further described in detail below in conjunction with the embodiments.

[0043] like Figure 1 As shown, a method for preparing a light-addressable photoelectrochemical sensor comprises the following steps:

[0044] ① Preparation of multi-detection zone detection array photoelectrochemical biosensor electrodes: FTO conductive glass of a certain size was used, and ultrasonic cleaning and drying were performed using acetone, NaOH and deionized water in sequence. Then, an insulating glue (such as Figure 1 The insulating ab adhesive) shown in the figure and a circular mold of a certain diameter are used to design five completely independent detection areas to construct an array photoelectrochemical biosensing electrode.

[0045] ② Preparation of α-Fe2O3 / Bi2S3 type II heterojunction photoactive material: Add a certain concentration of synthetic α-Fe2O3 / Bi2S3, thiourea, bismuth nitrate pentahydrate and ferric nitrate nonahydrate into deionized water, heat to a certain temperature, and synthesize α-Fe2O3 / Bi2S3 heterojunction photoactive material by hydrothermal method.

[0046] ③ Preparation of DNA concatemer biosensing interface: A certain concentration of amino-functionalized auxiliary DNA chain (NH3-DNA1), connecting DNA chain (DNA2) and capture DNA chain (DNA3, DNA4) were mixed in a certain volume ratio, added to Tris-HCl and EDTA solution, incubated at a certain temperature and assembled into DNA concatemers. Among them, the amino-functionalized auxiliary DNA chain has a nucleotide sequence as shown in SEQ ID NO.1 (AAAAAAAAAAAAAAACGGCACCTTCCTCGG CA); the sequence of the amino-functionalized auxiliary DNA chain is: 5′-NH2-C12-AAAAAAAAAAAAAAACGGCACC TTCCTCGGCA-3′.

[0047] The connecting DNA chain has the nucleotide sequence shown in SEQ ID NO. 2, that is, the connecting DNA chain has the nucleotide sequence of 5′-CGGCACCTGGGGGAGTATTGCGGAGGAAGGTGCCG-3′.

[0048] The capture DNA chain has an aptamer sequence containing targeting EpCAM protein CTC as shown in SEQ ID NO.3 and SEQ ID NO.4, that is, the capture DNA chain has an aptamer sequence containing targeting EpCAM protein CTC 5′-TACACCCCCAG GTGCCGAAAAAATGCTACGGGTCCAAGTTTTTCTCTTGGACCCAAAAACACTACAGAG GTTGCGTCTGTCCCACGTTGTCATGGGGGGTTGGCCTG-3′ and 5′-CACTACAGAGGTTGCG TCTGTCCCACGTTGTCATGGGGGGTTGGCCTGAAAAAAAAAAAAAAACGGCACCTGGG GGAGTAAAAAAGGGTCCAAGAGAAAAACTTGGACCCGTAGCAT-3′.

[0049] Solvents include Tris-HCl and EDTA solutions.

[0050] ④ Preparation of multi-detection zone detection array photoelectrochemical biological working electrode: a certain concentration of α-Fe2O3 / Bi2S3 type II heterojunction photoactive material was dropped on the five detection areas of the FTO glass electrode, and after drying, the FTO / α-Fe2O3 / Bi2S3 sensing electrode was obtained; then, a certain amount of chitosan (such as Figure 1 chitosan (abbreviated as CS) solution and glutaraldehyde (as shown Figure 1The glutaraldehyde (abbreviated as GA) solution shown in the figure is added dropwise to the detection area of ​​the electrode, and incubated with a certain amount of aptamer DNA concatemers for a certain period of time to prepare a capture electrode; finally, different concentrations of CTC are added to different detection areas (such as Figure 1 Different content of MCF-7 as shown), a multi-detection zone detection array photoelectrochemical biological working electrode was prepared.

[0051] ⑤ Light-addressable photoelectrochemical sensors (such as Figure 1 Preparation of Light-Adressable) and high-throughput detection of CTC: The working electrode FTO / α-Fe2O3 / Bi2S3 / CS / Aptamer-DNA Concatemer / MCF-7, the saturated Ag / AgCl electrode as the reference electrode, the platinum electrode as the counter electrode, and the infrared laser pen as the mobile light source are assembled into a photoelectrochemical sensor. By moving the laser pen, the CHI760E electrochemical workstation records and detects the photoelectrochemical signal according to the corresponding relationship between the CTC concentration and the photoelectric signal, realizing the CTC light-addressable photoelectrochemical high-throughput detection.

[0052] The FTO conductive glass described in step ① is 2cm×8cm, and the diameter of the detection area is 0.5mm.

[0053] In step ②, the amounts of thiourea, bismuth nitrate pentahydrate and ferric nitrate nonahydrate are 4 mmol, 2 mmol and 0.2 mmol respectively; the heating temperature is 160° C. to 200° C.; and the heating time is 1 h to 3 h.

[0054] In step ③, the volume ratio of DNA1, DNA2, DNA3, and DNA4 is 1:1:1:1 (all concentrations are 10 μM), and the heating temperature is 80°C to 95°C; the multi-body biosensor interface assembly is based on the hybridization assembly of DNA1, DNA2, DNA3, and DNA4; one end of the DNA1 contains an amino group, and DNA3 and DNA4 contain aptamer sequences targeting CTCs containing EpCAM protein.

[0055] The amount of CTC used in step ④ is 20 μL, and the concentration is 50, 100, 250, 500, 1000 cells mL -1 ; The incubation temperature is 37℃ and the time is 1h to 3h.

[0056] In step ⑤, the saturated Ag / AgCl electrode is the reference electrode, the platinum electrode is the counter electrode, and the infrared laser pen is the mobile light source. 0.1M PBS (pH=7.4) buffer solution is used as the detection solution, and the CHI760E electrochemical workstation is used to record and detect the photoelectrochemical signal.

[0057] Example:

[0058] A preparation method and application process of a light-addressable photoelectrochemical sensor Figure 1 As shown:

[0059] (1) Preparation of multi-detection zone array photoelectrochemical biosensor electrode: FTO conductive glass (2 cm × 8 cm) was used, and after ultrasonic cleaning and drying with acetone, NaOH and deionized water in sequence, insulating glue and a circular mold with a diameter of 0.5 mm were used on a single electrode to design 5 completely independent detection areas to construct an array photoelectrochemical biosensor electrode.

[0060] (2) Preparation of α-Fe2O3 / Bi2S3 type II heterojunction photoactive material: A certain concentration of 4 mmol thiourea, 2 mmol bismuth nitrate pentahydrate and 0.2 mmol ferric nitrate nonahydrate was added to 25 mL deionized water and heated to 180°C to synthesize the α-Fe2O3 / Bi2S3 heterojunction photoactive material by a one-pot method.

[0061] (3) Preparation of DNA concatemer biosensing interface: 10 μM amino-functionalized auxiliary DNA strand (NH3-DNA1), linker DNA strand (DNA2), and capture DNA (DNA3, DNA4) were added to a Tris-HCl and EDTA solution at a volume ratio of 1:1:1:1 and heated to 95°C. The solution was incubated and assembled into DNA concatemers (e.g. Figure 2 shown).

[0062] (4) Preparation of multi-detection zone detection array photoelectrochemical biological working electrode: 20 μL α-Fe2O3 / Bi2S3 (10 mg mL -1 ) solution was dropped on 5 detection areas of FTO glass electrode, and after drying, FTO / α-Fe2O3 / Bi2S3 sensing electrode was prepared; then, 20 μL chitosan (CS) solution (0.1%) and 20 μL glutaraldehyde (GA) (2.5%) solution were dropped on the detection area of ​​the electrode, and incubated with 20 μL aptamer DNA concatemer at 37 °C for 2 h to prepare the capture electrode; the last 20 μL, with concentrations of 50, 100, 250, 500, and 1000 cells mL -1 CTCs were added to detection zones 1-5 respectively; incubated at 37° C. for 1 h to prepare a multi-detection zone detection array photoelectrochemical biological working electrode.

[0063] (5) Preparation of light-addressable photoelectrochemical sensor and high-throughput detection of CTC: The working electrode FTO / α-Fe2O3 / Bi2S3 / CS / Aptamer-DNA Concatemer / MCF-7, the saturated Ag / AgCl electrode as the reference electrode, the platinum electrode as the counter electrode, and the infrared laser pen as the mobile light source are assembled into a photoelectrochemical sensor. By moving the laser pen, 0.1M PBS (pH=7.4) buffer solution is used as the detection solution, and the CHI760E electrochemical workstation records and detects the photoelectrochemical signal. According to the corresponding relationship between the CTC concentration and the photoelectric signal, the CTC light-addressable photoelectrochemical high-throughput detection is realized.

[0064] The assembly process of the electrochemical biosensor was characterized by impedance and cyclic voltammetry spectroscopy, e.g. Figure 3 According to the corresponding relationship between CTC concentration and photoelectric signal, the linear relationship curve between CTC concentration and photoelectric value I is calculated as I(nA)=-36.88lg C(cells mL -1 )+255.23, (C is CTC concentration), detection range is 50-1000 cells mL -1 , the detection limit is 1 cell mL -1 (S / N=3), (e.g. Figure 4 shown).

[0065] The application of light-addressable photoelectrochemical biosensing detection technology based on type II heterojunction photoactive material modified electrodes and DNA aptamer multimer biosensing interface in the high-throughput and high-sensitivity detection of CTCs will have extremely important application prospects and sustainable scientific research value.

[0066] Compared with the prior art, the light-addressable photoelectrochemical biosensor and its preparation method provided by the present application have the following advantages:

[0067] On the one hand, the light-addressable photoelectrochemical biosensor provided in the present application uses insulating glue and a circular mold to construct five detection areas of equal size on FTO conductive glass, and constructs a multi-detection area detection array photoelectrochemical biosensor electrode, which overcomes the shortcomings of existing detection technologies such as the inability to achieve high-throughput detection of CTCs.

[0068] On the other hand, the light-addressable photoelectrochemical biosensor provided in the present application uses an infrared laser pen as a mobile light source to overcome the shortcomings of the laser light source in the prior art, such as relatively large size, high price, and inconvenient movement.

[0069] The light-addressable photoelectrochemical biosensor provided in this application uses α-Fe2O3 / Bi2S3Ⅱ-type heterojunction, DNA concatemer biosensor interface and captured circulating tumor cells to construct a working electrode, which provides reference significance for clinical rare cell detection research and application. Specifically, this application uses α-Fe2O3 / Bi2S3Ⅱ-type heterojunction photoactive materials to overcome the shortcomings of low photogenerated carrier separation efficiency and low signal-to-noise ratio in the prior art. At the same time, this application uses a DNA concatemer sensor interface to efficiently capture CTCs, overcoming the shortcomings of existing detection technologies such as low sensitivity and low signal-to-noise ratio due to the extremely small number of CTCs in the blood.

[0070] In addition, an embodiment of the present application also provides an application of the light-addressable high-throughput photoelectrochemical biosensor described in the above embodiment in high-throughput and high-sensitivity detection of circulating tumor cells.

[0071] Based on the above technical scheme, the embodiment of the present application provides a light-addressed high-throughput photoelectrochemical biosensor and its preparation method and application. The sensor includes: a substrate and a working electrode, a reference electrode, a counter electrode and a mobile light source arranged on the substrate; the substrate has a plurality of detection areas distributed in an array, and the working electrode includes a plurality of array working electrodes distributed in different detection areas; the array working electrode is sequentially modified with photoactive materials, DNA concatemer sensing interfaces and circulating tumor cells; wherein the photoactive material is an α-Fe2O3 / Bi2S3 type II heterojunction; the reference electrode is a saturated Ag / AgCl electrode, the counter electrode is a platinum electrode, and the mobile light source is an infrared laser pen. The light-addressed photoelectrochemical biosensor and its preparation method provided in the present application solve the problems of low sensitivity, high detection limit and inability to realize efficient detection of multiple samples in existing photoelectric sensing technology.

[0072] The light-addressed high-throughput photoelectrochemical biosensor provided in this application uses α-Fe2O3 / Bi2S3Ⅱ-type heterojunction, DNA concatemer (DNA concatemer) biosensor interface and captured circulating tumor cells to construct a working electrode, which provides reference significance for clinical rare cell detection research and application. On the one hand, the application uses α-Fe2O3 / Bi2S3Ⅱ-type heterojunction photoactive materials to overcome the shortcomings of low photogenerated carrier separation efficiency and low signal-to-noise ratio in the prior art. On the other hand, the application uses a DNA concatemer sensing interface to efficiently capture CTCs, overcoming the shortcomings of the existing detection technology due to the extremely small number of CTCs in the blood, low sensitivity, and low signal-to-noise ratio. The light-addressed photoelectrochemical biosensor provided in this application not only solves the existing photoelectric sensing technology in CTC detection low sensitivity, high detection limit, and inability to achieve efficient detection of multiple samples, but also realizes high sensitivity, high specificity and high-throughput detection of CTCs, providing a new way for early detection and clinical research of tumors.

[0073] Those skilled in the art can understand that the above-mentioned embodiments are specific examples for implementing the present application, and in practical applications, various changes can be made to them in form and detail without departing from the spirit and scope of the present application. Any person skilled in the art can make their own changes and modifications without departing from the spirit and scope of the present application, so the scope of protection of the present application shall be based on the scope defined in the claims.

Claims

1. A light-addressable high-throughput photoelectrochemical biosensor, It is characterized in that It comprises: a substrate and a working electrode, a reference electrode, a counter electrode and a mobile light source arranged on the substrate; The substrate has a plurality of detection areas distributed in an array, and the working electrode comprises a plurality of array working electrodes distributed in different detection areas; The array working electrode is modified with a photoactive material, a DNA concatemer sensing interface and circulating tumor cells in sequence; wherein the photoactive material is α-Fe 2 O 3 / Bi 2 S 3 Type II heterojunction; The reference electrode is a saturated Ag / AgCl electrode, the counter electrode is a platinum electrode, and the movable light source is an infrared laser pen.

2. The light-addressable high-throughput photoelectrochemical biosensor according to claim 1, It is characterized in that Each array working electrode includes a photoactive material, a DNA concatemer sensing interface, circulating tumor cells, and a capture electrode for capturing circulating tumor cells; the capture electrode is FTO / α-Fe 2 O 3 / Bi 2 S 3 / Aptamer-DNAConcateme.

3. The light-addressable high-throughput photoelectrochemical biosensor according to claim 1, It is characterized in that The DNA concatemer sensing interface is obtained by preparing a self-assembled DNA concatemer; the self-assembled DNA concatemer is prepared by mixing an amino-functionalized auxiliary DNA chain, a connecting DNA chain, and a capturing DNA chain, and adding them to a solvent for incubation and assembly; wherein, The amino-functionalized auxiliary DNA strand has a nucleotide sequence as shown in SEQ ID NO.1; The connecting DNA strand has a nucleotide sequence as shown in SEQ ID NO.2; The capture DNA chain has an aptamer sequence containing EpCAM protein CTC targeting as shown in SEQ ID NO.3 and SEQ ID NO.4; the solvent includes Tris-HCl and EDTA solution.

4. The light-addressable high-throughput photoelectrochemical biosensor according to claim 1, It is characterized in that The substrate has five detection areas distributed in an array, and the diameter of the detection area is 0.5 mm; the array working electrodes located in different detection areas are separated by insulating glue.

5. A method for preparing a light-addressable high-throughput photoelectrochemical biosensor, applied to the light-addressable high-throughput photoelectrochemical biosensor as claimed in any one of claims 1 to 4, It is characterized in that The following steps are involved: Providing a substrate, and forming a plurality of detection areas distributed in an array on the substrate; Prepare a photoactive material, drop the photoactive material on each detection area, and make a sensing electrode after drying; the photoactive material is α-Fe 2 O 3 / Bi 2 S 3 Type II heterojunction; preparing self-assembled DNA concatemers to form DNA concatemer biosensing interfaces; Dropping chitosan solution and glutaraldehyde solution on each detection area, incubating with the self-assembled DNA concatemers and assembling to prepare a capture electrode; Adding circulating tumor cells of different concentrations to different detection areas, respectively, to form array working electrodes in the different detection areas; The array working electrode, reference electrode, counter electrode and mobile light source are assembled to prepare a light-addressable high-throughput photoelectrochemical biosensor.

6. The method for preparing the light-addressable high-throughput photoelectrochemical biosensor according to claim 5, It is characterized in that The reference electrode is a saturated Ag / AgCl electrode, the counter electrode is a platinum electrode, and the movable light source is an infrared laser pen.

7. The method for preparing the light-addressable high-throughput photoelectrochemical biosensor according to claim 5, It is characterized in that The substrate is FTO conductive glass; Providing a substrate, and forming a plurality of detection areas distributed in an array on the substrate, comprising: The FTO conductive glass was ultrasonically cleaned and dried using acetone, NaOH solution and deionized water in turn, and then a plurality of detection areas distributed in an array were opened on the FTO conductive glass using insulating glue and a circular mold.

8. The method for preparing the light-addressable high-throughput photoelectrochemical biosensor according to claim 5, It is characterized in that The method for preparing the photoactive material comprises: Bi(NO 3 ) 3 ·5H 2 O, thiourea mixed to obtain Bi 2 S 3 Solution; Will Fe(NO 3 ) 3 9H 2 O join Bi 2 S 3 In the solution, α-Fe 2 O 3 / Bi 2 S 3 Type II heterojunction photoactive materials.

9. The method for preparing the light-addressable high-throughput photoelectrochemical biosensor according to claim 5, It is characterized in that The method of preparing the self-assembled DNA concatemers to form the DNA concatemer biosensing interface comprises: The amino-functionalized auxiliary DNA chain, the connecting DNA chain, and the capturing DNA chain are mixed in proportion, added into a Tris-HCl and EDTA solution, incubated and assembled at a certain temperature to obtain a self-assembled DNA concatemer, and form a DNA concatemer biosensing interface; The amino-functionalized auxiliary DNA strand has a nucleotide sequence as shown in SEQ ID NO.1; The connecting DNA strand has a nucleotide sequence as shown in SEQ ID NO.2; The capture DNA strand has an aptamer sequence containing EpCAM protein CTC targeting as shown in SEQ ID NO.3 and SEQ ID NO.

4.

10. Use of the light-addressable high-throughput photoelectrochemical biosensor according to any one of claims 1 to 4 in high-throughput and high-sensitivity detection of circulating tumor cells.

Images