PTK7 targeted nucleic acid aptamer coupling medicine and new application thereof

Abstract

The invention provides a PTK7 targeted nucleic acid aptamer coupling drug and a new application thereof, through research, drugs are respectively coupled at the third end and the fifth end of a targeted PTK7 nucleic acid aptamer, the constructed drug is found to have obvious difference in stability and drug effect, aiming at a PTK7 target spot, the most preferable targeted nucleic acid aptamer and the most preferable drug are found, and the most suitable connexon is selected, so that the PTK7 targeted nucleic acid aptamer coupling drug can be used for preparing the PTK7 targeted nucleic acid aptamer coupling drug and the new application of the PTK7 targeted nucleic acid aptamer coupling drug. Based on a covalent coupling reaction of sulfydryl-maleimide, a PTK7 targeted aptamer coupling drug SM capable of remarkably improving the anti-tumor effect is constructed, and a new direction is provided for screening more efficient anti-tumor drugs.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular relates to a PTK7-targeted nucleic acid aptamer-coupled drug and a new application thereof. Background Art

[0002] PTK7 (protein tyrosine kinase 7) is a receptor tyrosine kinase in the Wnt pathway, involved in Wnt signaling during hematopoiesis, somatic progenitor cell development, and stem cell development. It is overexpressed in multiple tumor types, including advanced triple-negative breast cancer, non-small cell lung cancer, ovarian cancer, colorectal cancer, gastric cancer, and esophageal cancer. Furthermore, PTK7 expression is associated with lymph node metastasis and is highly expressed in tumor-initiating cells (TICs) or cancer stem cells (CSCs), as well as stromal cells, which are closely associated with tumor recurrence and progression. The development of targeted drugs targeting PTK7 is expected to overcome the limited efficacy of drugs against malignancies such as triple-negative breast cancer and non-small cell lung cancer. For example, Chinese patent application publication number CN 113491773 A discloses an artemisinin derivative aptamer-drug conjugate, its preparation method, and uses. By conjugating a PTK7-targeting aptamer to the drug molecules, Compretin, and artemisinin, the PTK7-targeting aptamer-drug conjugate effectively inhibits cells and tumors that overexpress PTK7. Although existing aptamer-drug conjugates have demonstrated some anti-tumor efficacy in the treatment of certain tumors, there is still a lack of highly effective anti-tumor aptamer-drug conjugates for tumors such as non-small cell lung cancer and colorectal cancer. Therefore, there is an urgent need to develop a PTK7-targeted aptamer-drug conjugate with greater stability and efficacy, and to fully validate its anti-tumor efficacy. Summary of the Invention

[0003] To address the above-mentioned problems, the present invention provides a PTK7-targeting aptamer-coupled drug and its application. By studying the coupling of drugs at the 3' and 5' ends of the PTK7-targeting aptamer, it was found that the constructed drugs had obvious differences in stability and efficacy. Targeting the PTK7 target, the most preferred targeting aptamer and the most preferred drug were found, and the most suitable linker was selected. Based on the covalent coupling reaction of thiol-maleimide, a PTK7-targeting aptamer-coupled drug SM with significantly improved anti-tumor effect was constructed, providing a new direction for screening more efficient anti-tumor drugs.

[0004] In one aspect, the present invention provides a PTK7-targeting aptamer-drug conjugate, comprising a PTK7-targeting aptamer and a linker-containing drug, wherein the linker-containing drug is coupled to the 3' end of the aptamer.

[0005] This study explores the specific preparation process and structure of aptamer-drug conjugates targeting PTK7, hoping to develop safer and more effective anti-tumor drugs by providing more detailed insights. By comparing the plasma stability of the constructed aptamer-drug conjugates by conjugating the drug to the 5'- and 3'-termini of the PTK7-targeting aptamer, it was found that the drug conjugated to the 3'-terminus of the PTK7-targeting aptamer exhibited better stability and was less susceptible to degradation during long-term incubation in plasma, suggesting that it could be used to prepare more promising anti-tumor drugs.

[0006] Furthermore, the nucleic acid aptamer targeting PTK7 has a sequence as shown in SEQ ID No. 1 in the sequence listing.

[0007] By screening more suitable nucleic acid aptamers targeting PTK7 and using them to construct nucleic acid aptamer-conjugated drugs, it is helpful to improve their affinity with the target, thereby improving the targeting effect.

[0008] Furthermore, the drug is the auristatin microtubule inhibitor MMAE.

[0009] Compared with other drugs, the drug constructed by coupling MMAE with a nucleic acid aptamer targeting PTK7 has a better tumor inhibition effect.

[0010] However, MMAE can only be coupled to the 3' end of the aptamer to produce a highly stable drug. When coupled to the 5' end, the stability is unsatisfactory and the anti-tumor efficacy cannot be fully exerted. The present invention, through in-depth research on aptamer-drug conjugates constructed with MMAE, ultimately successfully obtained an aptamer-drug conjugate SM that is highly stable, has excellent targeting effects, and significantly stronger anti-tumor effects. This fully unleashes the efficacy of MMAE and fully taps its anti-tumor potential.

[0011] Furthermore, the linker is a Vc linker, and the linker-containing drug has the following structural formula:

[0012] .

[0013] Furthermore, the PTK7-targeting nucleic acid aptamer and the linker-containing drug are prepared through a covalent coupling reaction based on thiol-maleimide.

[0014] Furthermore, the structural formula of the PTK7-targeting aptamer-drug conjugate is as follows:

[0015]

[0016] The ribbon with thiol groups is a nucleic acid aptamer targeting PTK7.

[0017] On the other hand, the present invention provides a use of a PTK7-targeting aptamer-drug conjugate for preparing a reagent for improving plasma stability, wherein the aptamer-drug conjugate comprises a PTK7-targeting aptamer and a linker-containing drug, wherein the linker-containing drug is coupled to the 3' end of the aptamer.

[0018] Studies have shown that when the aptamer-drug conjugated to the PTK7-targeting drug is coupled to the 3' end of the aptamer, the amount of nucleic acid fragmentation in plasma is significantly increased compared to when the drug is coupled to the 5' end of the aptamer. The higher the amount of nucleic acid fragmentation, the less likely it is to break. In other words, coupling the drug to the 3' end of the aptamer can significantly improve stability.

[0019] Furthermore, the nucleic acid aptamer is Sgc8, having the sequence shown in SEQ ID No. 1 in the sequence listing; the drug is the auristatin microtubule inhibitor MMAE, and the linker is a Vc linker.

[0020] In another aspect, the present invention provides a use of a PTK7-targeting aptamer-drug conjugate for preparing a reagent for improving tumor inhibition effects, wherein the aptamer-drug conjugate comprises a PTK7-targeting aptamer and a linker-containing drug, wherein the linker-containing drug is coupled to the 3' end of the aptamer.

[0021] Furthermore, the nucleic acid aptamer targeting PTK7 has a sequence as shown in SEQ ID No. 1 in the sequence listing; the drug is an auristatin-type microtubule inhibitor; and the tumor includes any one or more of colorectal cancer, lung cancer, ovarian cancer, breast cancer, and pancreatic cancer.

[0022] In some embodiments, the auristatin tubulin inhibitor is MMAE, and the linker is a Vc linker.

[0023] As previously mentioned, the 3-terminal-coupled drug SM of the PTK7-targeting aptamer exhibits improved stability in plasma and is less susceptible to degradation after long-term incubation. Therefore, theoretically, when delivered in vivo, the 3-terminal-coupled drug of the PTK7-targeting aptamer may exhibit better anti-tumor efficacy than the 5-terminal-coupled drug MS. However, greater drug stability does not necessarily guarantee higher anti-tumor activity. Whether anti-tumor activity can be enhanced depends on whether the aptamer-coupled drug structure itself promotes drug activity.

[0024] Extensive research has shown that, for most tumor cells, the anti-tumor activity of the drug SM coupled to the 3-terminus of the nucleic acid aptamer is significantly improved compared to the drug MS coupled to the 5-terminus of the nucleic acid aptamer. This may be because when the nucleic acid aptamer targeting PTK7 is coupled to the 3-terminus, its conformation is more conducive to the anti-cancer activity of the MMAE drug.

[0025] However, there are significant differences in the anticancer activity of the aptamer-coupled drug for different tumor cells. The present invention verifies the inhibitory effects of drugs coupled to the 3-terminal or 5-terminal ends of aptamers targeting PTK7 in a variety of different tumors. It is found that for some tumor cells, such as pancreatic cancer, lung cancer, breast cancer, colon cancer, ovarian cancer, etc., the inhibitory effect of drugs coupled to the 3-terminal end of aptamers targeting PTK7 is significantly better than that of drugs coupled to the 5-terminal end. The most obvious effect is in breast cancer and pancreatic cancer cells, where the 3-terminal coupled drug can achieve almost 100% inhibition rate; however, in some tumor cells, such as soft tissue sarcoma and bladder cancer Scaber cells, the inhibitory effect of drugs coupled to the 3-terminal end of aptamers targeting PTK7 is not significantly different from that of drugs coupled to the 5-terminal end. In osteosarcoma, thymic carcinoma, and central nervous system tumor cells, drugs coupled to the 3-terminal end of aptamers targeting PTK7 are even slightly worse than those coupled to the 5-terminal end. This also shows that the higher the stability, the better the tumor inhibition effect, but it is necessary to analyze them separately for different tumor cells.

[0026] It is understood that the tumor-suppressing activity of aptamer-drug conjugates is related to the following four aspects: 1. The sequence of the aptamer; 2. The drug conjugated to the aptamer; 3. The linker; and 4. The connection method. These four aspects complement each other and work together to enhance the anti-tumor effect.

[0027] First, regarding aptamer sequences, different tumor cells bind to different receptors, resulting in varying binding strengths. The same aptamer sequence may have stronger targeting ability in some tumor cells but weaker targeting ability in others. Therefore, designing aptamers with specific sequences for drug conjugation is essential for different tumor cell types. However, aptamers with stronger targeting efficacy do not necessarily lead to higher tumor inhibitory activity. It is important to comprehensively consider whether the aptamer's conformation is optimized after drug conjugation to effectively release the drug's activity. Second, regarding drug selection, different drugs exhibit varying inhibitory activity against different tumor cell types. Some drugs are highly effective against specific tumor cell types but less so against others. Therefore, it is important to select the appropriate drug for each tumor cell type. Furthermore, after conjugating a drug to an aptamer, it is important to consider the impact of the conjugation method on the conformation and its effect on drug efficacy, including whether changes in the spatial structure caused by different linkers may affect drug activity. Linkers play a crucial role in this process; their spatial conformation, affinity, and binding efficiency can all influence drug efficacy. Choosing different linkers can significantly alter drug efficacy. Finally, the choice of linker is crucial: whether the aptamer is conjugated to the drug via its 5' or 3' end. This linker method can influence the aptamer's sequence stability and targeting efficacy, while also significantly impacting the release of active drug activity. In summary, comprehensive consideration of the aptamer, linker, drug, and linker method is crucial to selecting the appropriate combination for a specific tumor cell. This allows for the development of an aptamer-drug conjugate that effectively inhibits that tumor cell and enhances anti-tumor efficacy.

[0028] Furthermore, the tumors include lung cancer, breast cancer and pancreatic cancer.

[0029] In some approaches, particularly for pancreatic and breast cancer, the aptamer-3-terminus-coupled SM constructed by the present invention can achieve a 100% tumor inhibition rate against these cancers, significantly improving efficacy and demonstrating significant potential. This may be because the aptamer (SEQ ID No. 1) targeting PTK7, when coupled to the MMAE drug at its 3-terminus and using a Vc linker, creates a SM drug that is particularly suitable for the treatment of pancreatic and breast cancer.

[0030] In another aspect, the present invention provides a use of a PTK7-targeting aptamer-drug conjugate for preparing a reagent for improving tumor inhibition effects, wherein the aptamer-drug conjugate comprises a PTK7-targeting aptamer and a linker-containing drug, wherein the linker-containing drug is coupled to the 5-end of the aptamer, and the PTK7-targeting aptamer has a sequence as shown in SEQ ID No. 1 in the sequence listing; the drug is the auristatin-type microtubule inhibitor MMAE, and the linker is a Vc linker; the tumor comprises any one or more of osteosarcoma, thymic carcinoma, and central neurocytoma.

[0031] Studies have shown that for osteosarcoma, thymic carcinoma, and central neurocytoma, the drug MS constructed by using a PTK7-targeted nucleic acid aptamer (SEQID No. 1) and coupling the drug MMAE at the 5-terminus with a Vc linker can significantly improve the inhibitory effect on ovarian cancer cells. Therefore, it is recommended for the treatment of osteosarcoma, thymic carcinoma, and central neurocytoma.

[0032] Furthermore, the structural formula of the drug coupled to the 5-end of the nucleic acid aptamer is as follows:

[0033]

[0034] In another aspect, the present invention provides use of sgc8c for preparing a reagent for improving the targeting property of a nucleic acid aptamer-drug conjugate targeting PTK7, wherein the sgc8c has a sequence as shown in SEQ ID No. 1 in the sequence listing.

[0035] Studies have shown that compared with other nucleic acid aptamers, the nucleic acid aptamer-drug conjugate targeting PTK7 prepared using sgc8c has better affinity with the target protein and more obvious targeting effect, thereby improving the anti-tumor effect.

[0036] In another aspect, the present invention provides the use of MMAE with a Vc linker for preparing a reagent for improving the efficacy of a nucleic acid aptamer-drug conjugate targeting PTK7, wherein the drug containing the Vc linker has the following structural formula:

[0037] .

[0038] Compared with other linkers, the PTK7-targeted nucleic acid aptamer-drug conjugate constructed using the Vc linker has better anti-tumor efficacy.

[0039] The present invention has the following beneficial effects:

[0040] (1) It was found that the blood stability of the PTK7-targeting aptamer conjugated with a drug at the 3-terminus was significantly improved compared with the 5-terminus conjugated drug;

[0041] (2) We screened different PTK7-targeting aptamers and found that sgc8c significantly improved the targeting effect compared with other aptamers, and thus the constructed aptamer-drug conjugates could also significantly improve the efficacy;

[0042] (3) Comparison of the differences between SMs constructed with different linkers to further improve the anti-tumor efficacy;

[0043] (4) Construct a PTK7-targeted nucleic acid aptamer-drug conjugate that can significantly improve the anti-tumor effect and inhibit a variety of malignant tumors. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 is the mass spectrum of the SM prepared in Example 1;

[0045] Figure 2 is the mass spectrum of the MS prepared in Example 2;

[0046] Figure 3 is the mass spectrum of SD prepared in Example 3;

[0047] Figure 4 This is a schematic diagram of the results of nucleic acid fragmentation detection of SM and MS in Example 4 at different time points after incubation in mouse plasma in vitro;

[0048] Figure 5 Schematic diagram of the affinity test results between SM and human PTK7 protein in Example 5;

[0049] Figure 6 Schematic diagram of the affinity test results between JHG35-2AM and human PTK7 protein in Example 5;

[0050] Figure 7 Schematic diagram of the affinity test results between CJH-C4M and human PTK7 protein in Example 5;

[0051] Figure 8 This is a schematic diagram showing the comparative results of the cytotoxicity of SM and SD in Example 6;

[0052] Figure 9 This is a schematic diagram of the results of SM's inhibition of HT-29 cell proliferation in Example 7;

[0053] Figure 10 This is a schematic diagram of the results of SM's inhibition of NCI-H1975 cell proliferation in Example 7;

[0054] Figure 11 This is a schematic diagram of the results of SM's inhibition of SKOV3 cell proliferation in Example 7;

[0055] Figure 12 Schematic diagram of the results of SM's inhibition of SUM159 cell proliferation in Example 7;

[0056] Figure 13 This is a schematic diagram of the inhibitory effect of SM on HT-29 tumor volume in Example 8;

[0057] Figure 14 This is a schematic diagram of the inhibitory effect of SM on HT-29 tumor volume ratio in Example 8;

[0058] Figure 15 This is a schematic diagram showing the effect of SM on the body weight of mice in Example 8;

[0059] Figure 16 This is a schematic diagram showing the effect of SM on the body weight ratio of mice in Example 8;

[0060] Figure 17 This is a schematic diagram showing the inhibitory effect of SM on human lung cancer NCI-H1975 tumor volume in Example 9;

[0061] Figure 18 This is a schematic diagram showing the inhibitory effect of SM on the tumor volume ratio of human lung cancer NCI-H1975 in Example 9;

[0062] Figure 19 This is a schematic diagram of the effect on mouse body weight in Example 9;

[0063] Figure 20 This is a schematic diagram of the effect of the weight ratio of mice in Example 9;

[0064] Figure 21 This is a schematic diagram showing the inhibitory effect of SM on human ovarian cancer SKOV3 tumor volume in Example 10;

[0065] Figure 22 This is a schematic diagram showing the inhibitory effect of SM on the tumor volume ratio of human ovarian cancer SKOV3 in Example 10;

[0066] Figure 23 This is a schematic diagram of the effect on mouse body weight in Example 10;

[0067] Figure 24 Schematic diagram of the effect of the weight ratio of mice in Example 10;

[0068] Figure 25 Schematic diagram of the inhibitory effect of SM on human breast cancer SUM159 tumor volume in Example 11;

[0069] Figure 26 Schematic diagram of the inhibitory effect of SM on the tumor volume ratio of human breast cancer SUM159 in Example 11;

[0070] Figure 27 This is a schematic diagram of the effect on mouse body weight in Example 11;

[0071] Figure 28 This is a schematic diagram showing the effect of the weight ratio of mice in Example 11;

[0072] Figure 29 This is a schematic diagram of the inhibitory effect of SM on human pancreatic cancer MIA PaCa-2 tumor volume in Example 12;

[0073] Figure 30 This is a schematic diagram of the inhibitory effect of SM on the tumor volume ratio of human pancreatic cancer MIA PaCa-2 in Example 12;

[0074] Figure 31 This is a schematic diagram of the effect on mouse body weight in Example 12;

[0075] Figure 32 This is a schematic diagram of the effect of the weight ratio of mice in Example 12;

[0076] Figure 33 This is a schematic diagram showing the inhibitory effect of SM on human lung cancer A549 tumor volume in Example 13;

[0077] Figure 34 This is a schematic diagram showing the inhibitory effect of SM on the tumor volume ratio of human lung cancer A549 in Example 13;

[0078] Figure 35 This is a schematic diagram of the effect on mouse body weight in Example 13;

[0079] Figure 36 This is a schematic diagram of the effect of the weight ratio of mice in Example 13;

[0080] Figure 37 This is a schematic diagram of the inhibitory effect of SM on pancreatic cancer PDX tumor volume in Example 14;

[0081] Figure 38 This is a schematic diagram of the inhibitory effect of SM on pancreatic cancer PDX tumor volume ratio in Example 14;

[0082] Figure 39 This is a schematic diagram of the effect on mouse body weight in Example 14;

[0083] Figure 40 This is a schematic diagram of the effect of the weight ratio of mice in Example 14;

[0084] Figure 41 This is a schematic diagram showing the inhibitory effect of SM on breast cancer MDA-MB-468 tumor volume in Example 15;

[0085] Figure 42 This is a schematic diagram showing the inhibitory effect of SM on the tumor volume ratio of breast cancer MDA-MB-468 in Example 15;

[0086] Figure 43 This is a schematic diagram of the effect on mouse body weight in Example 15;

[0087] Figure 44 This is a schematic diagram of the effect of the weight ratio of mice in Example 15;

[0088] Figure 45 This is a schematic diagram of the inhibitory effect of SM on ovarian cancer OVCAR3 tumor volume in Example 16;

[0089] Figure 46This is a schematic diagram showing the inhibitory effect of SM on the tumor volume ratio of ovarian cancer OVCAR3 in Example 16;

[0090] Figure 47 This is a schematic diagram of the effect on mouse body weight in Example 16;

[0091] Figure 48 This is a schematic diagram of the effect of the weight ratio of mice in Example 16;

[0092] Figure 49 This is a schematic diagram of the inhibitory effect of SM on pancreatic cancer BxPC3 tumor volume in Example 17;

[0093] Figure 50 This is a schematic diagram of the inhibitory effect of SM on the tumor volume ratio of pancreatic cancer BxPC3 in Example 17;

[0094] Figure 51 This is a schematic diagram of the effect on mouse body weight in Example 17;

[0095] Figure 52 This is a schematic diagram of the effect of the weight ratio of mice in Example 17;

[0096] Figure 53 This is a schematic diagram of the inhibitory effect of SE on colorectal cancer HT-29 tumor volume in Example 21;

[0097] Figure 54 This is a schematic diagram of the inhibitory effect of SE on the tumor volume ratio of colorectal cancer HT-29 cells in Example 21;

[0098] Figure 55 This is a schematic diagram of the effect on mouse body weight in Example 21;

[0099] Figure 56 This is a schematic diagram of the effect of the weight ratio of mice in Example 21;

[0100] Figure 57 This is a diagram showing the tumor inhibition effect of SM on Scaber tumors treated with intravesical instillation in Example 22. DETAILED DESCRIPTION

[0101] The present invention will be further described in detail below with reference to the accompanying drawings and examples. It should be noted that the following examples are intended to facilitate understanding of the present invention and do not have any limiting effect on the present invention.

[0102] Example 1. Preparation of PTK7-targeted nucleic acid aptamer 3-terminus coupled drug SM

[0103] In this example, a PTK7 (sgc8c, publicly available sequence) aptamer-drug conjugate (SM) was prepared, with VcMMAE (MMAE with a Vc linker) conjugated to the 3-terminus. SM was synthesized using a thiolmaleimide chemistry, as shown in the following reaction formula:

[0104]

[0105] Among them, the ribbon with thiol group is nucleic acid aptamer, and DMTr is dimethoxytrityl protecting group.

[0106] The preparation process is as follows:

[0107] (1) Preparation of thiol-modified PTK7 aptamer aqueous solution:

[0108] First, compound a in the above reaction formula needs to be synthesized. Compound a is directly synthesized in a solid phase synthesizer (K&A H8). The synthesis reaction formula is as follows (the synthesis process of compound a is conventional in the art):

[0109]

[0110] Controlled-pore glass (3'thiol SS CPG) beads modified with thiol groups were used as the solid-phase support for the synthesis reaction. The synthesis reagents required rigorous dehydration and deoxygenation during the reaction. The nucleic acid sequence (sgc8c: 5'-3': ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA) (SEQ ID No. 1) was input into the solid-phase synthesizer control software. The bases were coupled sequentially from the 3' to the 5' sequence to produce the target oligonucleotide chain.

[0111] After synthesis, the solid support (Compound a) was rinsed with acetonitrile and dried. The solid support was then treated with 30% concentrated ammonia to remove the protecting groups on the oligonucleotide chain and hydrolyze it from the support. After heating, the reaction mixture was cooled and 10% by volume of 3 M sodium chloride solution (based on the volume of ammonia added) was added. After mixing, anhydrous ethanol (2.5 times the volume of ammonia added) was added. Mixing was repeated until a white, flocculent precipitate formed, representing the crude product. The supernatant was removed by centrifugation and dried to a minimum. The product was then reconstituted in pure water and filtered to obtain the crude product. The fractions were purified using HPLC and collected. The DMT protecting group was removed by treatment with 40% aqueous acetic acid, exposing the 5'-terminal hydroxyl group to yield Compound I.

[0112] At this time, the thiol group of the nucleic acid aptamer product was protected by a disulfide bond and reduced using 20 times the equivalent of TCEP. After that, desalting and removing small molecules, an aqueous solution of the PTK7 nucleic acid aptamer modified with thiol groups at the three ends (Compound II) was obtained.

[0113] (2) Preparation of nucleic acid aptamer-drug conjugated SM:

[0114]

[0115] Add an aqueous solution of a 3'-terminal thiol-modified PTK7 nucleic acid aptamer (1 equivalent) and a mixed solution of VcMMAE (CAS: 646502-53-6, purchased from Shanghai Haoyuan Biopharmaceutical Technology Co., Ltd.) in acetonitrile / water (1 / 5-3 / 1, preferably 1 / 1) (2-30 equivalents, preferably 3 equivalents) to a centrifuge tube. Maintain the temperature at 4-40°C, preferably 25°C, and stir for 2-24 hours, preferably 12 hours. Purify with a reverse phase preparative column and freeze-dry to obtain the PTK7 nucleic acid aptamer-conjugated drug SM (Sgc8c-MMAE) with 3'-terminal MMAE conjugated. The yield is approximately 75%, and the drug is freeze-dried after desalting. Mass spectrometry is as follows: Figure 1 As shown, SM: Calculated: 14147.1 (Found: 14147).

[0116] This example also uses different PTK7-targeting aptamers JHG35-2A (ATAACGGATTGCCACGCCGCCGGGTTTTCTTCGTACGGGTCGTTAT, SEQ ID No. 2) and CJH-C4 (GTTCGTGGTGTGCTGGATGTCCCGGGGGGGGCTTGTCGGTTTTCCAGGGGTGGGAGTGACACATCCAGCAGCACGA, SEQ ID No. 3). Following the same method provided in this example, VcMMAE was coupled at the 3-end to construct JHG35-2AM and CJH-C4M, and their successful preparation was verified by mass spectrometry.

[0117] Example 2: Preparation of PTK7-targeted nucleic acid aptamer 5-terminus-coupled drug MS

[0118] In this example, a PTK7 (sgc8c: ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA) nucleic acid aptamer-drug MS was prepared with a VcMMAE drug coupled to the 5-terminus. The MS was synthesized using a thiolmaleimide chemical reaction, as shown in the following reaction formula:

[0119]

[0120] Among them, the ribbon with thiol is a nucleic acid aptamer, DMTr is a dimethoxytrityl protecting group, It is a solid phase carrier.

[0121] The preparation process is as follows:

[0122] (1) Preparation of thiol-modified PTK7 aptamer aqueous solution:

[0123] Controlled-pore glass (CPG) beads were used as a solid-phase support for the synthesis reaction. The synthesis reagents required rigorous dehydration and deoxygenation during the reaction. The nucleic acid sequence (sgc8c: 5'-3': ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA) (SEQ ID No. 1) was entered into the solid-phase synthesizer control software. Bases were coupled sequentially from the 3' to the 5' end, and a thiol phosphoramidite monomer was introduced at the 5' end to generate the target oligonucleotide chain. After synthesis, the solid-phase support was rinsed with acetonitrile and dried. The oligonucleotide chain was then treated with 30% concentrated ammonia to remove protecting groups and hydrolyze it from the support. After heating, the reaction mixture was cooled, and 10% by volume of 3 M sodium chloride solution (based on the volume of ammonia added) was added. After mixing, anhydrous ethanol (2.5 times the volume of ammonia added) was added. Mixing was repeated until a white, flocculent precipitate formed, representing the crude product. The supernatant was removed by centrifugation and dried to a minimum, then reconstituted with purified water. The crude product was filtered and purified using HPLC, with the corresponding fractions collected. The thiol groups of the aptamer product were now disulfide-protected and reduced using 20 equivalents of TCEP. After desalting to remove small molecules, an aqueous solution of the 5-terminal thiol-modified PTK7 aptamer was obtained.

[0124] (2) Preparation of nucleic acid aptamer-drug conjugated MS:

[0125] A 5'-terminal thiol-modified PTK7 aptamer aqueous solution (1 equivalent) and a mixed solution of acetonitrile / water (1 / 5-3 / 1, preferably 1 / 1) (2-30 equivalents, preferably 3 equivalents) of the auristatin microtubule inhibitor VcMMAE with a Vc linker were added to a centrifuge tube. The temperature was maintained at 4-40°C, preferably 25°C, and the reaction was stirred for 2-24 hours, preferably 12 hours. Purification was performed on a reverse phase preparative column and freeze-dried to obtain the 5'-terminal MMAE-coupled PTK7 aptamer-drug MS (MMAE-Sgc8c) with a yield of approximately 70%. The product was desalted and freeze-dried for later use. The mass spectrometry was as follows: Figure 2 As shown, MS: Calculated: 14147.1 (Found: 14147).

[0126] Example 3. Preparation of ApDC coupled with different drugs

[0127] In this example, two aptamer-drug conjugates, PTK7 (sgc8c, a publicly available sequence), were prepared, each end coupled to the GGFG-Dxd (Deruxtecan) drug. SD was synthesized using a thiolmaleimide chemical reaction, with the following reaction formulas:

[0128]

[0129] (1) The preparation process of the thiol-modified PTK7 nucleic acid aptamer aqueous solution is shown in Example 1.

[0130] (2) Preparation of nucleic acid aptamer-coupled drug SD:

[0131] A 3'-terminal thiol-modified PTK7 nucleic acid aptamer aqueous solution (1 equivalent) and a mixture of acetonitrile / water (1 / 5-3 / 1, preferably 1 / 1) of DNA topoisomerase I inhibitor Deruxtecan (CAS No.: 1599440-13-7, purchased from Shanghai Haoyuan Biopharmaceutical Technology Co., Ltd.) (2-30 equivalents, preferably 3 equivalents) were added to a centrifuge tube. The temperature was maintained at 4-40°C, preferably 25°C, and the reaction was stirred for 2-24 hours, preferably 12 hours. Purification was performed on a reverse phase preparative column and freeze-dried to obtain the PTK7 nucleic acid aptamer-conjugated drug SD (Sgc8c-Deruxtecan) with a 3'-terminal Deruxtecan conjugated thereto with a yield of approximately 75%. After desalting, the drug was freeze-dried for later use. Mass spectrometry was performed as shown in FIG. Figure 3 As shown, SD: Calculated: 13778 (Found: 13778).

[0132] Example 4. Comparison of Plasma Stability of Drugs Conjugated to Different Sites of Aptamers

[0133] This example uses the SM of a three-terminal drug and the MS of a five-terminal drug prepared in Example 1 and Example 2, respectively, for comparative experiments on the in vitro plasma stability of drugs. The specific process is as follows:

[0134] SM and MS were added to mouse plasma at a final concentration of 20 μM, respectively, and incubated in a constant temperature shaker at 37°C and 200 rpm for 5 different time points (0 h, 0.5 h, 1 h, 2 h, 4 h). The nucleic acids in the incubated samples were separated by 10% denaturing PAGE, and blank mouse plasma, SM pure chain and MS pure chain were set as control groups. The electrophoresis conditions were: 160 V, 60 min, and the sample loading amount was 2 μM. After electrophoresis, 1× Gel Red was used to stain in the dark for 5 min. After staining, the gel was washed two to three times, and the Cy3 channel was selected for gel imaging. Image Quant was used for data processing to further analyze the amount of nucleic acid fragmentation of SM and MS at different time points after incubation in mouse plasma in vitro. The results are shown in the figure. Figure 4 As shown in the figure, the amount of nucleic acid fragmentation in SM at different time points of incubation in mouse plasma in vitro was higher than that in MS, and MS showed almost complete fragmentation after 4 hours of incubation. This indicates that the stability of the Sgc8 aptamer with a 3-terminal drug conjugation is significantly improved compared to the 5-terminal drug conjugation, indicating that the 3-terminal drug-modified ApDC has higher stability. Greater drug stability can prevent drug degradation during in vivo transport when administered via intravenous injection, thereby enhancing drug efficacy. Therefore, it can be inferred that SM also has better efficacy than MS.

[0135] Example 5: SPR Characterization of Different PTK7 Aptamer-Drug Conjugates

[0136] In this comparative example, the binding of SM prepared in Example 1 and two other PTK7 aptamer-drug conjugates, JHG35-2AM and CJH-C4M, to human PTK7 protein was characterized by SPR experiments.

[0137] The specific process is as follows:

[0138] Human PTK7 protein was immobilized on a CM5 chip using pH 4.5 NaAC buffer, with His protein used as a control protein and ethanolamine solution used to block unreacted carboxyl groups in the chip. SM, JHG35-2AM, and CJH-C4M samples diluted with mobile phase (DPBS solution containing 5 mM MgCl2) were then passed over the chip surface in descending order of concentration, with 180 s of binding and 180 s of dissociation at a flow rate of 30 μL / min. After each cycle, 1.5 M NaCl solution was used for regeneration at a flow rate of 30 μL / min for 30 s. The equilibrium dissociation constant Kd was obtained by analysis with Biacore Insight Evaluation software, as shown in the following figure. Figure 5-Figure 7 As shown. Figure 5 It can be seen that SM binds most strongly to human PTK7 protein, with a Kd value of 2.97nM. Figure 6 It was found that the binding ability of JHG35-2AM to human PTK7 protein was similar to that of SM, with a Kd value of 7.48 nM. Figure 7 As shown, CJH-C4M binds relatively weakly to the human PTK7 protein, with a Kd value of 34.2 nM. Its slow binding and rapid dissociation result in a higher Kd value. This suggests that the aptamer in SM has a better affinity for the target human PTK7 protein, resulting in a more targeted effect and contributing to improved therapeutic efficacy.

[0139] Example 6: Comparison of cytotoxicity of different drugs: SM, SD, and SE

[0140] HT-29 cells were seeded into 96-well plates (3,000 cells per well) and cultured at 37°C under 5% carbon dioxide for 24 hours. PTK7 aptamer drugs SM (Sgc8c-MMAE) (prepared in Example 1), SD (Sgc8c-Dxd) (prepared in Example 3), and SE (prepared in Example 20) were added at the same concentration but with different conjugated drugs. After 24 hours of culture at 37°C under 5% carbon dioxide, the drug-containing culture medium was discarded and replaced with drug-free culture medium for a further 96 hours. After a total of 120 hours, the inhibitory effect of the drugs was determined using a CCK8 assay. The results are shown in the figure below. Figure 8 As shown. Figure 8 It can be seen that the inhibitory effects of aptamer-coupled drugs SM, SD, and SE on colorectal HT-29 cells gradually increased with the increase of drug concentration, and the inhibitory activity was SE>SM>SD, among which the IC50 of SE was about 60 nM, the IC50 of SM was about 250 nM, and the IC50 of SD was about 2500 nM.

[0141] Example 7: Effect of Aptamer-Drug Conjugates on the Inhibition of Malignant Cell Proliferation

[0142] In this example, the SM prepared in Example 1 was used in proliferation inhibition experiments on human colorectal cancer HT-29, human lung cancer NCI-H1975, human ovarian cancer SKOV3, human breast cancer SUM159, and osteosarcoma Saos-2 cells. The specific process is as follows:

[0143] HT-29, NCI-H1975, SKOV3, SUM159, and Saos-2 cells were seeded into 96-well plates (3000 cells per well) and cultured at 37°C, 5% CO2 for 24 hours. Different concentrations of the PTK7 aptamer SM (Sgc8c-MMAE) were then added. After 24 hours of incubation at 37°C, 5% CO2, the drug-containing medium was discarded and replaced with drug-free medium for an additional 96 hours (SUM159 cells were cultured for 48 hours). The inhibitory effects of the drugs were determined using a CCK8 assay kit after 120 hours (72 hours for SUM159 cells).

[0144] This example investigates the results of SM's inhibition of cell proliferation in HT-29, NCI-H1975, SKOV3, SUM159, and Saos-2 cells. Figures 9-12 The results of SM's inhibition of HT-29, NCI-H1975, SKOV3, and SUM159 cell proliferation are shown. Figure 9 The results of SM's inhibition of HT-29 cell proliferation are as follows: Figure 9 It can be seen that SM has a good inhibitory effect on human colorectal cancer HT-29 cells, with an IC50 value of 250 nM. Figure 10 The results of SM inhibition on NCI-H1975 cell proliferation are as follows: Figure 10 It can be seen that SM has a good inhibitory effect on human lung cancer NCI-H1975 cells, with an IC50 value of 131 nM. Figure 11 The results of SM's inhibition of SKOV3 cell proliferation are as follows: Figure 11 It can be seen that SM has a good inhibitory effect on human ovarian cancer SKOV3 cells, with an IC50 value of 500 nM. Figure 12 The results of SM's inhibition of SUM159 cell proliferation are as follows. Figure 12 It can be seen that SM has a good inhibitory effect on human breast cancer SUM159 cells, with an IC50 value of 105 nM.

[0145] In this example, the inhibitory effect of MS on the proliferation of HT-29, NCI-H1975, SKOV3, SUM159, and Saos-2 cells was also investigated under the same conditions. The results were compared with those of SM in Table 1. A lower IC50 value indicates a higher activity in inhibiting tumor cells.

[0146] Table 1. Results of inhibition of tumor cell proliferation by SM and SM

[0147]

[0148] As shown in Table 1, with the exception of osteosarcoma Saos-2, the SM prepared from aptamers with 3-terminal drug conjugation exhibited significantly better inhibition of tumor cell proliferation than the MS prepared from PTK7 aptamers with 3-terminal drug conjugation, with significantly lower IC50 values. This difference was particularly significant, with the IC50 value for human breast cancer SUM159 cells reduced by over 50%. This suggests that conjugating drugs to the 3-terminal end of aptamers can enhance the inhibitory effect on tumor cell proliferation.

[0149] Example 8: Effect of Aptamer-Drug Conjugates on Tumor Inhibition of Colorectal Cancer HT-29

[0150] This example uses the SM prepared in Example 1 for a tumor inhibition experiment in a colorectal cancer HT-29 xenograft tumor model. The specific process is as follows:

[0151] A colorectal cancer cell HT-29 cell-bearing mouse model was established with a tumor volume of 100-200 mm 3 Twenty-four mice were randomly divided into 6 groups. SM was divided into different dose groups of 3.5 mg / kg (0.25 μmol / kg), 7 mg / kg (0.5 μmol / kg), and 10.5 mg / kg (0.75 μmol / kg), different dosing times, and different dosing intervals. The Saline group and the SM group were administered by tail vein every four days, for a total of 5, 7, and 8 times, respectively. The SM group was administered by tail vein every 7 days, for a total of 5 times. The body weight of the mice, the length (a), and the width (b) of the tumor were measured and recorded at each injection. The formula for calculating tumor volume (V) is: V = (a×b 2 ) / 2. Tumor volume exceeds 1500 mm 3 The experimental endpoint was that the mice lost more than 15% of their body weight, and the experiment was terminated by euthanasia. Figure 13-14 As shown in the figure, compared with the Saline group, the tumors in the mice in the SM group were effectively inhibited. The inhibition rate of the SM 3.5 mg / kg q4d×8 group was 42%, the inhibition rate of the SM 7 mg / kg q7d×5 group was 68%, the inhibition rate of the SM 7 mg / kg q4d×5 group was 98%, the inhibition rate of the SM 7 mg / kg q4d×7 group was 94.5%, and the inhibition rate of the SM 10.5 mg / kg q7d×5 group was 96%. The body weight of the mice was also observed, and the results are shown in the figure below. Figure 15-16 As shown, there was no significant difference in the body weight of mice in the SM group compared with the Saline group. Therefore, the most preferred group was the SM 7 mg / kg q4d×5 group, which was administered via tail vein every four days for a total of 5 doses.

[0152] Compared with the tumor inhibitory effect of SE in the HT-29 tumor model in Example 21, although SE had higher cytotoxicity than SM at the same concentration in Example 6, SM (0.5 μmol / kg) showed better in vivo tumor inhibitory effect at a lower dose than SE (2 μmol / kg), indicating that MMAE is a more preferred drug molecule that can be coupled to the nucleic acid aptamer sgc8c.

[0153] This example further examined the inhibitory effect of the MS prepared in Example 2 on a colorectal cancer HT-29 xenograft tumor model. Relative to the Saline group, the inhibition rates of the MS 7 mg / kg q4d x 5 group, the MS 7 mg / kg q4d x 7 group, and the MS 10.5 mg / kg q7d x 5 group were 76.5%, 75.8%, and 75.6%, respectively. This indicates that the aptamer-3-terminus-conjugated drug SM significantly enhances the inhibitory activity of colorectal cancer HT-29 cells, making it suitable for use as a therapeutic agent against colorectal cancer HT-29.

[0154] Example 9: Effect of Aptamer-Drug Conjugates on Tumor Inhibition in Human Lung Cancer NCI-H1975

[0155] This example uses the SM prepared in Example 1 for a tumor inhibition experiment in a human lung cancer NCI-H1975 xenograft tumor model. The specific process is as follows:

[0156] Take the human lung cancer cell NCI-H1975 cell tumor-bearing mouse model, the tumor volume is 100-200 mm 3 Twelve mice were randomly divided into three groups. The Saline group and the SM group were administered with 0.36 mg / kg (0.5 μmol / kg) of MMAE equivalent to the tail vein every four days for a total of five times. The Paclitaxel group was administered with 10 mg / kg intraperitoneally every four days for a total of four times. The body weight of the mice, the length (a) and the width (b) of the tumor were measured and recorded at each injection. The formula for calculating the tumor volume (V) is: V = (a×b 2 ) / 2. Tumor volume exceeds 1500 mm 3 The experimental endpoint was that the mice lost more than 15% of their body weight, and the experiment was terminated by euthanasia. Figure 17-18 As shown, compared with the Saline group, the paclitaxel group had a tumor inhibition rate of 60%, and the SM group achieved a 99% objective response rate and complete remission of the tumor. Figure 19-20 As shown, there was no significant difference in the body weight of mice in the SM group compared with the Saline group, indicating that SM has good biosafety at this dose.

[0157] This example further examined the inhibitory effect of the MS prepared in Example 2 on the human lung cancer NCI-H1975 xenograft tumor model. It was found that compared to the Saline group, the inhibition rate of the MS 7 mg / kg q4d x 5 group was only 76.5%, significantly lower than that of the SM group. This indicates that the aptamer 3-terminus-conjugated drug SM can significantly enhance the inhibitory activity of human lung cancer NCI-H1975 cells, making it more suitable as a therapeutic drug against human lung cancer.

[0158] At the same time, this example also examined the inhibitory effects of SD (Sgc8c-Dxd) (prepared in Example 3) and SE (prepared in Example 20) on the human lung cancer NCI-H1975 xenograft tumor model. It was found that the tumor inhibition rate of the SM group was significantly higher than that of the SD group and the SE group.

[0159] Example 10: Effect of Aptamer-Drug Conjugates on Tumor Inhibition of Human Ovarian Cancer SKOV3

[0160] This example uses the SM prepared in Example 1 for a tumor inhibition experiment in a human ovarian cancer SKOV3 xenograft tumor model. The specific process is as follows:

[0161] A human ovarian cancer cell SKOV3 tumor-bearing mouse model was established with a tumor volume of 100-200 mm 3 Six mice were randomly divided into two groups. The Saline group and the SM group were administered MMAE equivalent to 0.36 mg / kg (0.5 μmol / kg) via tail vein every four days for a total of five doses. The body weight, tumor length (a), and tumor width (b) of the mice were measured and recorded at each injection. Tumor volume (V) was calculated as follows: V = (a×b 2 ) / 2. Tumor volume exceeds 1500 mm 3 The experimental endpoint was that the mice lost more than 15% of their body weight, and the experiment was terminated by euthanasia. Figure 21-22 As shown in Figure 2, compared with the Saline group, the SM group had a tumor inhibition rate of 96%. At the same time, the weight of the mice was observed, and the results were as follows: Figure 23-24 As shown, there was no significant difference in the body weight of mice in the SM group compared with the Saline group, indicating that SM has good biosafety at this dose.

[0162] This example further examined the inhibitory effect of the MS prepared in Example 2 on a human ovarian cancer SKOV3 xenograft tumor model. The MS 7 mg / kg q4d x 5 group demonstrated a 98.2% inhibition rate, compared to the Saline group, slightly higher than the SM group. This suggests that the aptamer-drug 5-terminus conjugated MS is more effective in enhancing the inhibitory activity of human ovarian cancer SKOV3 cells and is therefore more suitable as a therapeutic agent for human ovarian cancer.

[0163] At the same time, this example also investigated the inhibitory effects of SD (Sgc8c-Dxd) (prepared in Example 3) and SE (prepared in Example 20) on human ovarian cancer SKOV3 xenograft tumor models, and found that the tumor inhibition rate of the SM group was significantly higher than that of the SD group and the SE group.

[0164] Example 11: Effect of Aptamer-Drug Conjugated Drugs on Tumor Inhibition in Human Breast Cancer SUM159

[0165] This example uses the SM prepared in Example 1 for a tumor inhibition experiment in a human breast cancer SUM159 xenograft tumor model. The specific process is as follows:

[0166] Take the human breast cancer cell SUM159 cell tumor-bearing mouse model, the tumor volume is 100-200 mm 3 Twenty-five mice were randomly divided into five groups. SM was divided into different dose groups of 5.25 mg / kg (0.375 μmol / kg), 7 mg / kg (0.5 μmol / kg), and 10.5 mg / kg (0.75 μmol / kg). The Saline group, 5.25 mg / kg SM group, and 7 mg / kg SM group were administered via tail vein every four days, for a total of five doses. The 7 mg / kg SM and 10.5 mg / kg SM groups were administered via tail vein every seven days, for a total of four doses. The body weight of the mice, the length (a), and the width (b) of the tumor were measured and recorded at each injection. The formula for calculating the tumor volume (V) is: V = (a×b 2 ) / 2. Tumor volume exceeds 1500 mm 3 The experimental endpoint was that the mice lost more than 15% of their body weight, and the experiment was terminated by euthanasia. Figure 25-26 As shown in the figure, compared with the Saline group, SM in the dose range of 5.25-10.5 mg / kg can significantly inhibit mouse tumors, among which SM 7 mg / kg q4d×5 and SM 10.5 mg / kgq7d×4 have the strongest tumor inhibition effect, with a tumor inhibition rate of more than 70%. At the same time, the weight of the mice was observed, and the results are as follows Figure 27-28 As shown, there was no significant difference in the body weight of mice in each SM dose group compared with the Saline group, indicating that SM has good biosafety within the dose range of 5.25-10.5 mg / kg.

[0167] This example further examined the inhibitory effect of the MS prepared in Example 2 on a human breast cancer SUM159 xenograft tumor model. The results showed that, relative to the Saline group, the inhibition rates of the MS 7 mg / kg q4d×5 group and the MS 7 mg / kg q7d×5 group were significantly lower than those of the SM 7 mg / kg q4d×5 group and the SM 7 mg / kg q7d×5 group. This indicates that the aptamer 3-terminus-coupled drug SM significantly enhances the inhibitory activity of human breast cancer SUM159 cells, making it more suitable as a therapeutic agent against human breast cancer.

[0168] Example 12: Effect of Aptamer-Drug Conjugates on Tumor Inhibition of Human Pancreatic Cancer MIA PaCa-2

[0169] This example uses the SM prepared in Example 1 for a tumor inhibition experiment in a human pancreatic cancer MIA PaCa-2 xenograft tumor model. The specific process is as follows:

[0170] A mouse model bearing human pancreatic cancer cell MIA PaCa-2 was established, with a tumor volume of 100-200 mm 3 Ten mice were randomly divided into two groups. Each group received a tail vein injection of saline and SM every four days, with a dose of 0.36 mg / kg (0.5 μmol / kg) of MMAE equivalent. The mice were administered for a total of five times. The weight, tumor length (a), and tumor width (b) of the mice were measured and recorded at each injection. Tumor volume (V) was calculated as follows: V = (a×b 2 ) / 2. Tumor volume exceeds 1500 mm 3 The experimental endpoint was that the mice lost more than 15% of their body weight, and the experiment was terminated by euthanasia. Figure 29-30 As shown, compared with the Saline group, the tumors in the SM group mice achieved a 99% objective response rate and complete remission. At the same time, the weight of the mice was observed, and the results were as follows Figure 31-Figure 32 As shown, there was no significant difference in the body weight of mice in the SM group compared with the Saline group, indicating that SM has good biosafety at this dose.

[0171] This example further investigated the inhibitory effect of the MS prepared in Example 2 on a human pancreatic cancer MIA PaCa-2 xenograft tumor model. It was found that compared with the Saline group, the inhibition rate of the MS 7 mg / kg q4d×5 group was only 51.5%, which was significantly lower than that of SM. This indicates that the aptamer 3-terminal conjugated drug SM can significantly enhance the inhibitory activity of human pancreatic cancer MIA PaCa-2 cells, reaching 99% and achieving almost complete inhibition. Therefore, SM is more suitable as a therapeutic drug against human pancreatic cancer.

[0172] At the same time, this example also investigated the inhibitory effects of SD (Sgc8c-Dxd) (prepared in Example 3) and SE (prepared in Example 20) on the human pancreatic cancer MIA PaCa-2 xenograft tumor model. It was found that the tumor inhibition rate of the SM group was significantly higher than that of the SD group and the SE group.

[0173] Example 13: Effect of Aptamer-Drug Conjugates on Tumor Inhibition of Human Lung Cancer A549

[0174] This example uses the SM prepared in Example 1 for a tumor inhibition experiment in a human lung cancer A549 xenograft tumor model. The specific process is as follows:

[0175] A549 human lung cancer cell-bearing mouse model was established with a tumor volume of 100-200 mm 3 Twelve mice were randomly divided into three groups. The Saline group and the SM group were administered with MMAE equivalent to 0.36 mg / kg (0.5 μmol / kg) via tail vein every four days for a total of five times. The Cisplatin group was administered with 2.5 mg / kg via intraperitoneal injection every seven days for a total of two times. The body weight, tumor length (a) and tumor width (b) of the mice were measured and recorded at each injection. The formula for calculating tumor volume (V) is: V = (a×b 2 ) / 2. Tumor volume exceeds 1500 mm 3 The experimental endpoint was that the mice lost more than 15% of their body weight, and the experiment was terminated by euthanasia. Figure 33-Figure 34 As shown in Figure 2, compared with the Saline group, the inhibition rate of the cisplatin group on mouse tumors was 10%, while the inhibition rate of the SM group on mouse tumors reached 62%. At the same time, the weight of the mice was observed, and the results were as follows. Figure 35-36 As shown, there was no significant difference in the body weight of mice in the SM group compared with the Saline group, indicating that SM has good biosafety at this dose.

[0176] This example further examined the inhibitory effect of the MS prepared in Example 2 on a human non-small cell lung cancer A549 xenograft tumor model. The MS 7 mg / kg q4d x 5 group showed an inhibition rate of 60%, slightly lower than that of the SM group, compared to the Saline group. This suggests that the 3-terminal conjugated aptamer drug SM can enhance the inhibitory activity of human non-small cell lung cancer A549 cells and is therefore more suitable as a therapeutic agent against human non-small cell lung cancer.

[0177] However, when targeting human lung cancer NCI-H1975, the effects of SM and MS on the therapeutic effect are more obvious, while when targeting non-small cell lung cancer A549, the effects of SM and MS on the therapeutic effect are somewhat reduced. This shows that the connection method of nucleic acid aptamer-drug conjugates has different effects on different types of lung cancer.

[0178] Example 14: Effect of Aptamer-Drug Conjugated Drugs on Pancreatic Cancer PDX Tumor Inhibition

[0179] The SM prepared in Example 1 was used for a tumor inhibition experiment in a pancreatic cancer PDX xenograft tumor model. The specific process was as follows:

[0180] Pancreatic cancer PDX tumor blocks were taken and implanted using a trocar. After 19 days, the tumor volume reached 100-200 mm 3 , pancreatic cancer PDX model tumor volume is 100-200 mm 3 Ten mice were randomly divided into two groups. The Saline group and the SM group were administered 0.36 mg / kg (0.5 μmol / kg) of MMAE via tail vein every four days for a total of six doses. The body weight, tumor length (a), and tumor width (b) of the mice were measured and recorded at each injection. Tumor volume (V) was calculated as follows: V = (a×b 2 ) / 2. Tumor volume exceeds 1500 mm 3 The experiment was terminated when the mice lost more than 15% of their body weight or the weight of the mice decreased by 15%. Figure 37-Figure 38 As shown in Figure 2, compared with the Saline group, the tumors in the SM group were effectively inhibited, with an inhibition rate of 92%. At the same time, the weight of the mice was observed, and the results were as follows: Figure 39-40 As shown, there was no significant difference in body weight between the mice in the SM group and the Saline group.

[0181] This example further investigated the inhibitory effect of the MS prepared in Example 2 on pancreatic cancer PDX xenograft tumor models. It was found that compared with the Saline group, the inhibition rate of the MS 7 mg / kg q4d×6 group was 57%, which was significantly lower than that of SM. This shows that the 3-terminal conjugated drug SM of the nucleic acid aptamer can significantly enhance the inhibitory activity of human pancreatic cancer PDX cells and is more suitable as a therapeutic drug against human pancreatic cancer.

[0182] Example 15: Effect of Aptamer-Drug Conjugates on Tumor Inhibition in MDA-MB-468 Breast Cancer Cells

[0183] This example uses the SM prepared in Example 1 for a tumor inhibition experiment in a breast cancer MDA-MB-468 xenograft tumor model. The specific process is as follows:

[0184] Take the breast cancer cell MDA-MB-468 cell tumor-bearing mouse model, the tumor volume is 100-200 mm 3 Fifteen mice were randomly divided into three groups. The Saline group and the SM group were administered with 0.36 mg / kg (0.5 μmol / kg) of MMAE equivalent to the tail vein every four days for a total of three doses. The Paclitaxel group was administered with 10 mg / kg intraperitoneally every four days for a total of three doses. The body weight, tumor length (a) and tumor width (b) of the mice were measured and recorded at each injection. The formula for calculating tumor volume (V) is: V = (a×b 2 ) / 2. Tumor volume exceeds 1500 mm 3 The experimental endpoint was that the mice lost more than 15% of their body weight, and the experiment was terminated by euthanasia. Figure 41-42 As shown in the figure, compared with the Saline group, the inhibition rate of the paclitaxel group on mouse tumors was 60%, and the SM group achieved a 100% objective response rate and complete remission of mouse tumors. Figure 43-44 As shown, there was no significant difference in body weight between the mice in the SM group and the Saline group.

[0185] This example further investigated the inhibitory effect of the MS prepared in Example 2 on a breast cancer xenograft tumor model of MDA-MB-468. It was found that compared with the Saline group, the inhibition rate of the MS 7 mg / kg q4d × 3 group was 89%, which was significantly lower than that of the SM group. SM was able to achieve an inhibition rate of 100%, indicating that SM is particularly suitable for preparing drugs against breast cancer MDA-MB-468.

[0186] This example also examined the inhibitory effects of SD (Sgc8c-Dxd) (prepared in Example 3) and SE (prepared in Example 20) on breast cancer MDA-MB-468 xenograft tumor models, and found that the tumor inhibition rate of the SM group was significantly higher than that of the SD group and the SE group.

[0187] Example 16: Effect of Aptamer-Drug Conjugates on Ovarian Cancer OVCAR3 Tumor Inhibition

[0188] This example uses the SM prepared in Example 1 for a tumor inhibition experiment in an ovarian cancer OVCAR3 xenograft tumor model. The specific process is as follows:

[0189] Ovarian cancer cell OVCAR3 cell-bearing mouse model was used, with tumor volume ranging from 100 to 200 mm 3Nine mice were randomly divided into three groups. The Saline group and the SM group were administered with 0.36 mg / kg (0.5 μmol / kg) of MMAE equivalent to the tail vein every four days for a total of five times. The Paclitaxel group was administered with 10 mg / kg intraperitoneally every four days for a total of five times. The body weight of the mice, the length (a) and the width (b) of the tumor were measured and recorded at each injection. The formula for calculating the tumor volume (V) is: V = (a×b 2 ) / 2. Tumor volume exceeds 1500 mm 3 The experimental endpoint was that the mice lost more than 15% of their body weight, and the experiment was terminated by euthanasia. Figure 45-46 As shown in the figure, compared with the Saline group, the inhibition rate of the paclitaxel group on mouse tumors was 33%, and the inhibition rate of the SM group on mouse tumors was 98.5%. Figure 47-Figure 48 As shown, there was no significant difference in body weight between the mice in the SM group and the Saline group.

[0190] This example further examined the inhibitory effect of MS prepared in Example 2 on an ovarian cancer xenograft tumor model. The results showed that, compared to the Saline group, the inhibition rate of the MS 7 mg / kg q4d x 5 group was 82.5%, lower than that of SM. This indicates that the aptamer 3-terminus-coupled drug SM significantly enhances the inhibitory activity of ovarian cancer OVCAR3 cells and is therefore more suitable as a therapeutic agent for the treatment of ovarian cancer OVCAR3.

[0191] At the same time, this example also investigated the inhibitory effects of SD (Sgc8c-Dxd) (prepared in Example 3) and SE (prepared in Example 20) on the ovarian cancer OVCAR3 xenograft tumor model, and found that the tumor inhibition rate of the SM group was significantly higher than that of the SD group and the SE group.

[0192] Example 17: Effect of Aptamer-Drug Conjugates on Pancreatic Cancer BxPC3 Tumor Inhibition

[0193] This example uses the SM prepared in Example 1 for a tumor inhibition experiment in a pancreatic cancer BxPC3 xenograft tumor model. The specific process is as follows:

[0194] A pancreatic cancer cell BxPC3 cell-bearing mouse model was established with a tumor volume of 100-200 mm 3Nine mice were randomly divided into three groups. The Saline group and the SM group were administered with MMAE equivalent to 0.36 mg / kg (0.5 μmol / kg) via tail vein every four days for a total of five times. The Gemcitabine group was administered with 80 mg / kg via intraperitoneal injection every seven days for a total of three times. The body weight, tumor length (a) and tumor width (b) of the mice were measured and recorded at each injection. The formula for calculating tumor volume (V) is: V = (a×b 2 ) / 2. Tumor volume exceeds 1500 mm 3 The experimental endpoint was that the mice lost more than 15% of their body weight, and the experiment was terminated by euthanasia. Figures 49 and 50 As shown in Figure 2, compared with the Saline group, the gemcitabine group did not inhibit the growth of mouse tumors, while the SM group had an inhibition rate of 87%. At the same time, the weight of the mice was observed, and the results were as follows: Figure 51-52 As shown, there was no significant difference in the body weight of mice in the SM group compared with the Saline group, indicating that SM has good biosafety at this dose.

[0195] This example further investigated the inhibitory effect of the MS prepared in Example 2 on pancreatic cancer BxPC3 xenograft tumor models. It was found that compared with the Saline group, the inhibition rate of the MS 7 mg / kg q4d×5 group was 56%, which was significantly lower than that of the SM group.

[0196] Example 18: Nucleic acid aptamer-drug conjugated SM with a non-cleavable linker coupled to the 3 ends

[0197] In this example, a PTK7 (sgc8c, publicly available sequence) aptamer-drug conjugate (SM) was prepared, with the Mc-MMAE drug conjugated to its 3-terminus. SM was synthesized using a thiolmaleimide chemical reaction, as shown in the following reaction formula:

[0198]

[0199] Among them, the ribbon with thiol group is nucleic acid aptamer, and DMTr is dimethoxytrityl protecting group.

[0200] The preparation process is as follows:

[0201] (1) The preparation process of the thiol-modified PTK7 nucleic acid aptamer aqueous solution is shown in Example 1.

[0202] (2) Preparation of nucleic acid aptamer-drug conjugated SM:

[0203] To a centrifuge tube, add an aqueous solution of a 3'-terminally thiol-modified PTK7 aptamer (1 equivalent) and a mixture of 2-30 equivalents, preferably 3 equivalents, of a maleimidohexanamide-protecting auristatin-type tubulin inhibitor, Mc-MMAE (CAS: 863971-24-8, purchased from Shanghai Haoyuan Biopharmaceutical Technology Co., Ltd.) in acetonitrile / water (1 / 5-3 / 1, preferably 1 / 2). Maintain the reaction at 4-40°C, preferably 25°C, with stirring for 2-24 hours, preferably 12 hours. Purify the reaction using a reverse-phase preparative column and freeze-dry to obtain the PTK7 aptamer-drug conjugate, SM (Sgc8c-Mc-MMAE), with the 3'-terminus conjugated to Mc-MMAE. The yield is approximately 60%. After desalting, the product is lyophilized for later use. SM: Calculated: 13741.1 (Found: 13741).

[0204] Example 19: Effect of 3-terminal coupling with different linkers to construct aptamer-drug conjugates

[0205] This example was constructed using the method provided in Example 1, wherein the linkers on MMAE were cleavable maleimide VC linker SM and non-cleavable maleimidocaproyl linker SM, respectively. The construction method of VcMMAE was as described in Example 1, and the construction method of the non-cleavable maleimidocaproyl linker SM was as described in Example 18. Following the method provided in Example 16, the inhibitory effects of different linker drugs SM and SM on human pancreatic cancer MIA PaCa-2 cells were investigated. The results showed that the PTK7 aptamer-conjugated drug SM constructed using the Vc linker was significantly superior to the non-cleavable linker drug SM, with an IC50 value reduced by more than 30%. This may be because the non-cleavable linker limits the activity of the MMAE drug. Therefore, the most preferred linker is the Vc linker.

[0206] Example 20: Preparation of PTK7-targeted nucleic acid aptamer 3-terminus coupled drug SE

[0207] In this example, a PTK7 (sgc8c, a public sequence) aptamer-drug SE was prepared, with the 3-terminus coupled to the MC-VA-PAB-Exatecan drug. SE was synthesized using a thiolmaleimide chemical reaction, as shown in the following reaction formula:

[0208]

[0209] Among them, the ribbon with thiol group is nucleic acid aptamer, and DMTr is dimethoxytrityl protecting group.

[0210] The preparation process is as follows:

[0211] (1) The preparation process of the thiol-modified PTK7 nucleic acid aptamer aqueous solution is shown in Example 1.

[0212] (2) Preparation of nucleic acid aptamer-drug SE:

[0213] To a centrifuge tube, add 1 equivalent of a 3'-terminally thiol-modified PTK7 aptamer in water and 2-30 equivalents, preferably 3 equivalents, of the DNA topoisomerase I inhibitor exatecan (MC-VA-PAB-Exatecan) with an MC-VA-PAB linker (CAS: 2680543-57-9, purchased from Shanghai Haoyuan Biopharmaceutical Technology Co., Ltd.) in a DMSO / water (1 / 5-3 / 1, preferably 1 / 1) mixture. Maintain the reaction at 4-40°C, preferably 25°C, with stirring for 2-24 hours, preferably 12 hours. Purify the reaction with a reverse-phase preparative column and freeze-dry to obtain the PTK7 aptamer-drug conjugate SE (Sgc8c-EXA) with an exatecan linker at the 3' end in approximately 60% yield. Desalt the solution and freeze-dry it for later use. Mass spectrometry analysis revealed the product SE: Calculated: 13778.1 (Found: 13778).

[0214] Example 21: Effect of Nucleic Acid Aptamer-Drug Conjugated SE on Colorectal Cancer HT-29 Tumor Inhibition

[0215] This example uses the SE prepared in Example 20 for a tumor inhibition experiment in a colorectal cancer HT-29 xenograft tumor model. The specific process is as follows:

[0216] A colorectal cancer cell HT-29 cell-bearing mouse model was established with a tumor volume of 100-200 mm 3 Eight mice were randomly divided into two groups. Saline and SE groups were administered 27.6 mg / kg (2 μmol / kg) via tail vein every four days for a total of five doses. The body weight, tumor length (a), and tumor width (b) of the mice were measured and recorded at each injection. Tumor volume (V) was calculated as follows: V = (a × b 2 ) / 2. Tumor volume exceeds 1500 mm 3 The experimental endpoint was that the mice lost more than 15% of their body weight, and the experiment was terminated by euthanasia. Figure 53-54 As shown in Figure 2, compared with the Saline group, the tumor inhibition rate of the SE group was only 26.7%. At the same time, the weight of the mice was observed, and the results were as follows: Figure 55-56 As shown, there was no significant difference in the body weight of mice in the SE group compared with the Saline group, indicating that SE has good biosafety at this dose.

[0217] Example 22: Effect of Aptamer-Drug Conjugates on Other Tumor Inhibition Effects

[0218] This example uses the SM prepared in Example 1 to perform tumor inhibition experiments on soft tissue sarcoma SW872, osteosarcoma Saos-2, thymic carcinoma Ty-82, and central nervous system tumor ONS-76 cell xenograft models. The specific process is as follows:

[0219] Soft tissue sarcoma SW872, osteosarcoma Saos-2, thymic carcinoma Ty-82, and central neuroblastoma ONS-76 cell-bearing mouse models were selected, with tumor volumes ranging from 100 to 200 mm. 3 Nine mice were randomly divided into three groups. The Saline and SM groups were administered 0.36 mg / kg (0.5 μmol / kg) of MMAE via tail vein every four days for a total of five doses. The body weight, tumor length (a), and tumor width (b) of the mice were measured and recorded at each injection. Tumor volume (V) was calculated as follows: V = (a×b 2 ) / 2. Tumor volume exceeds 1500 mm 3 The experiment was terminated by euthanasia when the mice lost more than 15% or their body weight decreased, as the experimental endpoint. The inhibitory effect of SM on soft tissue sarcoma SW872, osteosarcoma Saos-2, thymic carcinoma Ty-82, and central nervous system tumor ONS-76 cell-bearing mouse models was calculated. This example also employed the same method to investigate the inhibitory effect of the MS prepared in Example 2 on soft tissue sarcoma SW872, osteosarcoma Saos-2, thymic carcinoma Ty-82, and central nervous system tumor ONS-76 xenograft models. The test results are shown in Table 2.

[0220] Table 2. Results of inhibition of tumor cell proliferation by SM and SM

[0221]

[0222] Table 2 shows that, with the exception of soft tissue sarcoma SW872, MS prepared with a PTK7 aptamer conjugated to a 5-terminal drug exhibited significantly better tumor cell proliferation inhibition than SM prepared with a 3-terminal drug conjugated to a PTK7 aptamer, with significant differences. In particular, SM reduced the inhibitory effect by over 34% on thymic carcinoma Ty-82 cells. This suggests that conjugating drugs to the 5-terminal end of aptamers improves the proliferation inhibition of osteosarcoma Saos-2, thymic carcinoma Ty-82, and central neuroblastoma ONS-76 cells. However, for soft tissue sarcoma SW872, there was no significant difference between MS and SM. This suggests that for different tumor types, greater stability of the aptamer-conjugated drug does not necessarily guarantee better tumor inhibition, requiring specific analysis of the specific tumor cell type.

[0223] Example 23: Effect of Aptamer-Drug Conjugates on Scaber Inhibition of Bladder Cancer

[0224] This example uses the SM prepared in Example 1 for bladder instillation experiments in a Scaber bladder cancer xenograft model. The specific process is as follows:

[0225] The mouse bladder was inoculated with 200,000 bladder cancer Scaber cells / 10 μL to establish a tumor-bearing mouse model. The tumor fluorescence intensity reached 10 7 The mice were randomly divided into 6 groups, with 8 mice in each group. Each group received intravesical instillation once a week, with SM doses of 0.25, 0.5, and 1 nmol / kg, and sgc8 and VC-MMAE doses of 1 nmol / kg, for a total of 4 doses. The body weight of the mice and the fluorescence intensity of the tumor site were measured and recorded before each administration. The experiment was terminated when the weight loss exceeded 15%. The experimental results are shown in Figure 2. Figure 57 As shown, compared with the Saline group, the SM group had an inhibition rate of 75-100% on mouse tumors, and the mouse tumors in the SM group at 1 nmol / kg could achieve a 100% objective response rate and complete remission.

[0226] This example further investigated the inhibitory effect of the MS prepared in Example 2 on a bladder cancer Scaber xenograft tumor model. It was found that, compared with the Saline group, at the same concentration, the inhibition rate of the MS group was also 75-100%. This shows that for bladder cancer Scaber cells, there is no significant difference in the inhibitory effect of the aptamer targeting PTK7 coupled to the 3' end compared to the drug coupled to the 5' end.

[0227] Although the present invention is disclosed as above, the present invention is not limited thereto. Any person skilled in the art can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the scope defined by the claims.

Claims

1. A nucleic acid aptamer-coupled drug targeting PTK7, characterized in that: The aptamer-coupled drug comprises a PTK7-targeted aptamer and a linker-containing drug, and the linker-containing drug is coupled to the 3 ends of the aptamer.

2. The nucleic acid aptamer-drug conjugate according to claim 1, characterized in that: The PTK7-targeting nucleic acid aptamer has a sequence as shown in SEQ ID No. 1 in the sequence listing.

3. The nucleic acid aptamer-coupled drug according to claim 2, characterized in that: The drug is the auristatin microtubulin inhibitor MMAE.

4. The nucleic acid aptamer-coupled drug according to claim 3, characterized in that: The linker is a Vc linker, and the linker-containing drug has the following structural formula: 。 5. The nucleic acid aptamer-coupled drug according to claim 4, characterized in that: The structural formula of the aptamer-coupled drug targeting PTK7 is as follows: The ribbon with thiol groups is a nucleic acid aptamer targeting PTK7.

6. Use of a PTK7-targeting aptamer-coupled drug for preparing a reagent for improving plasma stability, characterized in that: The aptamer-coupled drug comprises a PTK7-targeted aptamer and a linker-containing drug, and the linker-containing drug is coupled to the 3 ends of the aptamer.

7. Use of a PTK7-targeting aptamer-coupled drug for preparing a reagent for improving tumor inhibition effect, characterized in that: The aptamer-coupled drug comprises a PTK7-targeted aptamer and a linker-containing drug, and the linker-containing drug is coupled to the 3 ends of the aptamer.

8. The use according to claim 7 or 6, characterized in that The aptamer targeting PTK7 has a sequence as shown in SEQ ID No. 1 in the sequence table; the drug is an auristatin microtubule inhibitor.

9. The use according to claim 8, characterized in that The tumor includes any one or more of colorectal cancer, lung cancer, ovarian cancer, breast cancer, and pancreatic cancer.

10. The use according to claim 7 or 6, characterized in that: The linker is a Vc linker, and the linker-containing drug has the following structural formula: 。 11. The use according to claim 10, characterized in that The structural formula of the aptamer-coupled drug targeting PTK7 is as follows: The ribbon with thiol groups is a nucleic acid aptamer targeting PTK7.

12. Use of a PTK7-targeting aptamer-coupled drug for preparing a reagent for improving tumor inhibition effect, characterized in that: The aptamer-coupled drug comprises a PTK7-targeting aptamer and a linker-containing drug, wherein the linker-containing drug is coupled to the 5-end of the aptamer, and the PTK7-targeting aptamer has a sequence as shown in the sequence table SEQ ID No. 1; the drug is an auristatin microtubule inhibitor MMAE, and the linker is a Vc linker; the tumor comprises any one or more of osteosarcoma, thymic carcinoma, and central neuroblastoma.

13. Use of a PTK7-targeting aptamer-coupled drug for preparing a tumor-inhibiting agent, characterized in that: The aptamer-coupled drug comprises a PTK7-targeting aptamer and a linker-containing drug, wherein the linker-containing drug is coupled to the 3' end or 5' end of the aptamer, and the PTK7-targeting aptamer has a sequence as shown in the sequence table SEQ ID No. 1; the drug is an auristatin microtubule inhibitor MMAE, and the linker is a Vc linker; the tumor comprises soft tissue sarcoma or bladder cancer.

14. A use of sgc8c for preparing a reagent for improving the targeting property of a nucleic acid aptamer-coupled drug targeting PTK7, characterized in that: The sgc8c has a sequence as shown in SEQ ID No. 1 in the sequence listing.

15. Use of MMAE with a Vc linker for preparing a reagent for improving the efficacy of a nucleic acid aptamer-coupled drug targeting PTK7, characterized in that: The drug containing a Vc linker has the structural formula shown below: 。

Images