A universal device for capacitive cell electrical stimulation and its application

Abstract

The present invention discloses a universal device for capacitive cell electrical stimulation and its application, the device comprises an electrical stimulation culture box and a signal source control system; voltage and frequency parameters are inputted through a human-computer interaction module; an input unit outputs the input voltage and frequency parameters to a PID regulator; the PID regulator generates corrected voltage and frequency signals to a direct digital synthesis module to generate a composite signal; a multiplexer module distributes and processes the composite signal under the instruction of a main control module, and divides the composite signal into a plurality of channels; the signals of each channel are respectively sent to the electrical stimulation culture box after filtering and power amplification processing; a detector arranged in the electrical stimulation culture box monitors the real-time voltage and frequency in the electrical stimulation culture box in real time, and feeds back to the feedback unit, the feedback unit compares the detection value with the set value, and outputs feedback adjustment information to the PID controller, so as to realize dynamic adjustment of the voltage and frequency inputted to the electrical stimulation culture box.

Description

Technical Field

[0001] The present invention belongs to the field of cell electrical stimulation, and in particular relates to a universal device for capacitive cell electrical stimulation and an application thereof. Background Art

[0002] In today's rapidly developing biomedical field, the importance of electrobiology is becoming increasingly prominent, which involves the use of electrical signals to regulate and understand various physiological processes of organisms. Exploring the application of electrical stimulation in biomedicine has aroused great interest. However, the theory of the mechanism of electrical stimulation on organisms is still imperfect, and it will take a lot of experiments before it can be applied to actual treatment. Various stimulation parameters need to be set to further explore the impact of electrical stimulation on biological experiments. In order to explore this field in depth, researchers need precise devices to simulate and apply electrical signals.

[0003] As the basic structural and functional unit of organisms, cells have a strict metabolic system to adapt to different environmental conditions and maintain body homeostasis and energy balance. Therefore, in biomedical research, cells are often used as research objects to explore the relationship between pathogenesis and diseases and drugs. The cell electrical stimulation device is the most basic tool to provide electrical stimulation for cell growth. The development of the cell electrical stimulation device provides a favorable tool and a good method for studying the changing mechanism of cell migration, adhesion, differentiation, and metabolic capacity, as well as the influence and mechanism of electrical signals on human tissue growth. The cell electrical stimulation device provides a favorable tool, conditions and a good method for quantitatively and regularly studying the effects of electrical stimulation on cells, so as to further derive the mechanism of action of electricity on cells and even the human body. Therefore, the development of the cell culture electrical stimulation device has important significance and practical value.

[0004] At present, the electrical stimulation methods of common cell culture electrical stimulation devices are mainly divided into: (1) direct electrical stimulation: that is, the positive and negative electrodes are directly placed in the cell culture dish to directly stimulate the cells; (2) capacitive electrical stimulation: a capacitor with parallel electrodes is used to generate an electric field, and the cell culture dish is placed between the parallel electrodes to receive electrical stimulation; (3) electromagnetic electrical stimulation: the cell culture dish is placed in a coil device, the coil generates a magnetic field, and the changing magnetic field generates an electric field in the solution through Faraday's law of induction, thereby electrically stimulating the cells.

[0005] Capacitive electrical stimulation is widely considered to be an ideal electrical stimulation method because of its bionic characteristics and closer to the natural physiological conditions of the human body. Capacitive electrical stimulation is achieved by using the effect of alternating electric fields. It stimulates tissue cells by applying a voltage difference (charges accumulate and release between capacitor electrodes, generating current flow). It conducts current to the target location through a capacitive coupler without direct contact, thereby achieving regulation of cell behavior without damaging the cells.

[0006] However, the electrical stimulation effect of the existing capacitive electrical stimulation devices during use is not ideal, and flexible adjustment of multiple channels cannot be achieved. In addition, there is a lack of real-time monitoring and feedback mechanism for electrical signals, making it difficult to dynamically adjust the output signal according to experimental requirements. Summary of the invention

[0007] In order to overcome the shortcomings of the prior art, the present invention provides a universal device for capacitive cell electrical stimulation, which is equipped with an adjustable high-throughput signal source control system, can output and monitor electrical signals, and automatically adjust the output of electrical signals through a negative feedback mechanism, thereby ensuring the accuracy and stability of electrical stimulation.

[0008] Another object of the present invention is to provide an application of a universal device for capacitive cell electrical stimulation.

[0009] The technical solution of the present invention to solve the above technical problems is:

[0010] A universal device for capacitive cell electrical stimulation includes an electrical stimulation culture box and a signal source control system for providing stimulation signals to the electrical stimulation culture box, wherein the signal source control system includes a human-computer interaction module, a main control module, a direct digital synthesis module, a multiplexer module, a filtering module, a power driving module and a signal filtering and amplification module, wherein:

[0011] The human-computer interaction module is used for the operator to input voltage and frequency parameters;

[0012] The main control module includes an input unit, a PID regulator, a feedback unit and an analog-to-digital converter, wherein:

[0013] The input unit is used to receive the voltage and frequency parameters input by the operator, and output the voltage and frequency parameters to the PID regulator;

[0014] The PID regulator is used to adjust the PID parameters according to the set values ​​to generate corrected voltage and frequency signals; the corrected voltage and frequency signals are processed and transmitted to the direct digital synthesis module;

[0015] The direct digital synthesis module is used to process the corrected voltage and frequency signals to generate a composite signal containing a mixture of multiple waveforms;

[0016] The multiplexer module is used to distribute and process the generated composite signal according to the control instruction of the main control module, and divide the composite signal into multiple channels according to the preset output parameters; and extract the signal in each channel to obtain the required signal characteristics;

[0017] The filtering module is used to filter the signals of each channel and then output them to the power driving module;

[0018] The power driving module is used to amplify the power of the signal and transmit it to the electrical stimulation culture box;

[0019] A detector is provided in the electrical stimulation culture box, and the detector is used to monitor the voltage and frequency in the electrical stimulation culture box in real time, and transmit the detected voltage and frequency information to the signal filtering and amplifying module. The signal filtering and amplifying module purifies the data information, and converts the analog signal into a digital signal through the analog-to-digital converter and outputs it to the feedback unit. The feedback unit compares the detected value with the set value, and outputs feedback adjustment information to the PID controller, so as to realize dynamic adjustment of the voltage and frequency input to the electrical stimulation culture box.

[0020] As a preferred solution of the present invention, the filtering module includes a filtering circuit arranged in each channel, and the filtering circuit includes a first-order high-pass filter and a second-order low-pass filter, wherein the first-order high-pass filter is used to remove the DC bias in the output signal of the direct digital synthesis module; the second-order low-pass filter is used to eliminate high-frequency noise and stray components in the signal; the power driving module includes a power amplifier circuit arranged in each channel.

[0021] As a preferred embodiment of the present invention, the electrical stimulation culture box is a capacitive electrical stimulation culture box, which includes a base and a top cover arranged on the base, wherein the base is provided with a plurality of groups of mounting positions for placing culture dishes; an upper electrode assembly is arranged above the mounting position, and a lower electrode assembly is arranged below the mounting position.

[0022] As a preferred embodiment of the present invention, the upper electrode assembly includes an upper electrode plate, an upper electrode sheet arranged in the upper electrode plate and an upper PCB circuit board, wherein the upper electrode plate is provided with a first mounting groove for installing the upper electrode sheet and a second mounting groove for installing the upper PCB circuit board, wherein the first mounting grooves are multiple groups, the multiple groups of first mounting grooves are arranged in an array, and correspond one-to-one with the multiple groups of mounting positions; each group of first mounting grooves vertically penetrates the upper and lower sides of the upper electrode plate; the second mounting groove extends along the length direction of the upper electrode plate; a first wiring hole is provided on the side of the base; the first wiring hole is connected with the second mounting groove; the upper electrode sheet is installed in the first mounting groove, and a glass sheet is provided at the bottom of the upper electrode sheet; the glass sheet is adhered to the bottom of the upper electrode sheet through electrode gel; the top of the upper electrode sheet is connected to the upper PCB circuit board through a wire.

[0023] As a preferred solution of the present invention, two groups of arch bridge type handles are provided on the upper side of the upper electrode plate.

[0024] As a preferred solution of the present invention, the lower electrode assembly includes a lower electrode sheet and a lower PCB circuit board arranged on the base, wherein the base is provided with a third mounting groove for installing the lower electrode sheet and a fourth mounting groove for installing the lower PCB circuit board, wherein the third mounting grooves are multiple groups, and the multiple groups of third mounting grooves correspond one-to-one to the multiple groups of first mounting grooves; the fourth mounting groove extends along the length direction of the base; a second wiring hole is provided on the side of the base; the second wiring hole is connected to the fourth mounting groove; the lower electrode sheet is installed in the third mounting groove, and the bottom of the lower electrode sheet is connected to the lower PCB circuit board through a wire.

[0025] As a preferred solution of the present invention, gas exchange channels are symmetrically arranged on both sides of the base.

[0026] As a preferred embodiment of the present invention, the capacitive electrical stimulation culture box also includes a fixing component for fixing the culture dish placed on the mounting position, the fixing component includes a positioning plate and a positioning member for limiting the positioning plate in the horizontal and vertical directions, wherein the positioning plate is provided with a plurality of groups of positioning grooves; the plurality of groups of positioning grooves correspond one-to-one to the plurality of groups of first mounting grooves or the plurality of groups of third mounting grooves; the inner diameter of each group of positioning grooves is equal to the outer diameter of the culture dish.

[0027] As a preferred solution of the present invention, support columns for supporting the upper electrode plate are arranged around the base.

[0028] The capacitive cell electrical stimulation universal device of the present invention is used in electrical signal stimulation processing and detection of cells.

[0029] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0030] 1. The universal device for capacitive cell electrical stimulation of the present invention is equipped with an adjustable high-throughput signal source control system, which can output and monitor electrical signals and automatically adjust the output of electrical signals through a negative feedback mechanism, thereby ensuring the accuracy and stability of electrical stimulation.

[0031] 2. The multiplexer module in the universal device for capacitive cell electrical stimulation of the present invention allocates different signals to each channel by flexibly switching channels. Its efficient channel switching capability ensures rapid response and adaptation to diverse electrical stimulation requirements. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1It is a structural block diagram of the signal source control system in the universal device for capacitive cell electrical stimulation of the present invention.

[0033] Figure 2 It is a schematic diagram of the structure of the electric stimulation culture box in the universal device for capacitive cell electric stimulation of the present invention.

[0034] Figure 3 It is a schematic structural diagram of the electric stimulation culture box in the universal device for capacitive cell electric stimulation of the present invention (without the top cover).

[0035] Figure 4 and Figure 5 Schematic diagram of the structure of the upper electrode assembly from two different perspectives.

[0036] Figure 6 It is a schematic diagram of the structure of the base and the lower electrode assembly.

[0037] Figure 7 A schematic diagram of the structure of the fixed component.

[0038] Figure 8 A schematic diagram of the structure of the base.

[0039] Fig. 9 It is a schematic diagram of the structure of the buckle.

[0040] Fig.10 This is a graph showing the q-PCR experimental results of RAW264.7 cells in Example 2 at different voltages.

[0041] Fig.11 This is a graph showing the q-PCR experimental results of MC3T3-E-1 cells at different voltages.

[0042] Fig.12 This is the q-PCR experimental results of the RAW264.7 cell inflammation model. DETAILED DESCRIPTION

[0043] The present invention is further described in detail below in conjunction with embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0044] Example 1

[0045] The universal device for capacitive cell electrical stimulation of the present invention is composed of an electrical stimulation culture box and a signal source control system for providing stimulation signals to the electrical stimulation culture box, wherein the signal source control system includes a human-computer interaction module, a main control module, a direct digital synthesis module, a multiplexer module, a filtering module, a power driving module and a signal filtering and amplification module.

[0046] See also Figure 1 , the human-computer interaction module is used for the operator to input voltage and frequency parameters;

[0047] In this embodiment, the human-machine interaction module (i.e., human-machine interface HMI) serves as a key interaction bridge between the system and the user, allowing the operator to conveniently set key parameters such as voltage and frequency; through the human-machine interface HMI, the user can not only manage the switch status of each functional module and accurately control the duration of electrical stimulation, but also monitor the changes in electrical signals in the culture box in real time, thereby ensuring the accuracy and efficiency of the experimental process, while improving the convenience of user operation and optimizing the experimental process.

[0048] See also Figure 1 The main control module is mainly responsible for receiving and analyzing preset electrical signals, and outputting precisely corrected electrical signals, which are transmitted to the electrical stimulation culture box after filtering and amplification. At the same time, the main control module is also used to control the channel selection and switching of the multiplexer module. The main control module integrates a negative feedback regulation mechanism, which can monitor the electrical signal strength in the electrical stimulation culture box in real time. By comparing the real-time signal value with the preset value, the system output can be adjusted to ensure the accuracy and stability of the electrical signal output.

[0049] In this embodiment, the main control module includes an input unit, a PID regulator, a feedback unit and an analog-to-digital converter; wherein the input unit is used to receive the voltage and frequency parameters input by the operator and output the control parameters to the PID regulator; the PID regulator adjusts the PID parameters according to the set values ​​to generate corrected voltage and frequency signals; the corrected voltage and frequency signals are transmitted to the direct digital synthesis module after processing; the direct digital synthesis module is used to process the corrected voltage and frequency signals to generate a composite signal containing a mixture of multiple waveforms; the multiplexer module is used to distribute and process the generated composite signal, and divide the composite signal into multiple channels according to preset output parameters; the desired signal characteristics are obtained by selectively extracting the signal in each channel; the filtering module is used to filter the signals of each channel and then output them to the power driving module; the power driving module is used to amplify the power of the signal to meet the preset voltage requirements and transmit it to the electrical stimulation culture box.

[0050] See also Figure 1 The direct digital synthesis module (i.e., DDS module) generates a variety of adjustable waveform signals, such as sine wave, triangle wave, and square wave, according to preset voltage and frequency parameters, supports precise frequency adjustment and fast switching, and can output aliased waveform signals for the subsequent multiplexer module (i.e., MUX module) to select the required signal channel.

[0051] In this embodiment, the DDS module adopts the AD9910 chip produced by Analog Devices, which has high-resolution and high-precision frequency synthesis capabilities; the AD9910 chip provides a clock signal through an external 40MHz active crystal oscillator, and performs precise control according to the frequency and amplitude setting values ​​transmitted by the main control module through the SPI interface; the complementary current signal output by the AD9910 chip is converted into a voltage signal through a 50-ohm precision sampling resistor to adapt to subsequent amplification and filtering circuits; in addition, the AD9910 chip is powered by 3.3V and 1.8V analog and digital power supplies to ensure high-precision waveform generation and output under low power consumption conditions, meeting the system's signal control requirements.

[0052] See also Figure 1 The multiplexer module outputs the aliased signal generated by the direct digital synthesis module in a branched manner according to the instructions of the main control module to achieve high-throughput signal distribution; wherein the specific parameters of the electrical stimulation signal can be customized according to experimental requirements, and the multiplexer module allocates different electrical signals to each channel by flexibly switching channels, and its efficient channel switching capability ensures rapid response and adaptation to diversified electrical stimulation requirements.

[0053] See also Figure 1 Under the coordination of the main control module, the direct digital synthesis module is used in conjunction with the multiplexer module, the filter module and the power drive module. After the electric signal is filtered and amplified, the output electric signal meets the preset requirements, thereby ensuring the stable transmission and processing of the electric signal. Finally, the direct digital synthesis module and the multiplexer module provide the system with flexible signal control and efficient multi-channel signal separation, which is suitable for complex signal output scenarios.

[0054] See also Figure 1 A detector (i.e., a sensor) is provided in the electrical stimulation culture box, and the detector is used to monitor the voltage and frequency in the electrical stimulation culture box in real time, and transmit the detected data information to the signal filtering and amplifying module, and the signal filtering and amplifying module purifies the data information (such as filtering and amplifying), and converts the analog signal into a digital signal through the analog-to-digital converter and outputs it to the feedback unit, and the feedback unit compares the detected value with the set value, and outputs feedback information to the PID controller, and the PID controller dynamically adjusts the voltage and frequency input to the electrical stimulation culture box through the built-in PID algorithm.

[0055] In this embodiment, the signal filtering and amplification module is a key module in the negative feedback regulation process, which is specifically responsible for processing the electrical signals collected by the sensor. The signal filtering and amplification module removes noise and interference through the signal filtering function to improve the signal-to-noise ratio of the signal. At the same time, the signal filtering and amplification module effectively amplifies the weak electrical signal to enhance the signal strength, thereby ensuring its reliability and accuracy during the transmission process. In addition, the signal filtering and amplification module accurately adjusts the signal and quickly transmits the processed data to the main control module, thereby ensuring the high performance and stability of the entire system.

[0056] See also Figure 1 , the output signal of the direct digital synthesis module may be affected by digital and analog noise, resulting in harmonics, stray components and high-frequency noise in the electrical signal; in order to improve the signal quality, it is necessary to effectively filter out these undesirable components. Therefore, by setting a filtering module, the filtering module includes a filtering circuit arranged in each channel, and the filtering circuit includes a first-order high-pass filter and a second-order low-pass filter, wherein the first-order high-pass filter is used to remove the DC bias in the output signal of the direct digital synthesis module, and the second-order low-pass filter is used to weaken or eliminate the high-frequency noise and stray components in the signal to improve the signal-to-noise ratio and achieve a more stable signal output; similarly, the power driving module includes a power amplifier circuit arranged in each channel; after passing through the power amplifier circuit corresponding to each channel, the electrical signal is further power amplified to reach the required voltage level.

[0057] See also Figure 2-Figure 9 The electric stimulation culture box is a capacitive electric stimulation culture box, which is mainly used in conjunction with a commercial culture dish and is equipped with a sensor inside to collect electrical signals; the electric stimulation culture box includes a base 2 and a top cover 1 arranged on the base 2, wherein the base 2 is provided with a plurality of groups of mounting positions 206 for placing the culture dish; an upper electrode assembly is arranged above the mounting position 206, and a lower electrode assembly is arranged below the mounting position 206.

[0058] See also Figure 2-Figure 9 The size of the top cover 1 is 142±0.05mm×84±0.05mm, and the thickness is about 2mm; the lower edge of the top cover 1 adopts a chimeric design so as to be combined with the base 2 to form a complete overall structure.

[0059] See also Figure 2-Figure 9In the stimulation method based on capacitive coupling, in order to apply an electric field in the culture dish, the parallel plate capacitor mode design is adopted in this embodiment, so that the culture dish becomes a part of the capacitor, so that the electric field can be effectively applied to the cells; wherein, the key to the design of the parallel plate capacitor mode is to embed electrode sheets, which constitute the two plates of the capacitor and generate an electric field by applying voltage, wherein the material, size and layout of the electrode sheets in the culture dish are important design considerations, which directly affect the distribution and uniformity of the electric field and the potential impact on the cells.

[0060] See also Figure 2-Figure 9 The upper electrode assembly includes an upper electrode plate 4, an upper electrode sheet 7 arranged in the upper electrode plate 4 and an upper PCB circuit board, wherein the upper electrode plate 4 is provided with a first mounting groove 401 for mounting the upper electrode sheet 7 and a second mounting groove 402 for mounting the upper PCB circuit board, wherein the first mounting groove 401 is a plurality of groups, and the plurality of groups of first mounting grooves 401 are arranged in an array; each group of first mounting grooves 401 vertically penetrates the upper and lower sides of the upper electrode plate 4; the second mounting groove 402 extends along the length direction of the upper electrode plate 4; a first wiring hole 202 is provided on the side of the base 2; the first wiring hole 202 is connected with the second mounting groove 402; the upper electrode sheet 7 is installed in the first mounting groove 401, and a glass sheet is provided at the bottom of the upper electrode sheet 7; the glass sheet is attached to the bottom of the upper electrode sheet 7 through electrode gel; the upper end of the upper electrode sheet 7 is connected to the upper PCB circuit board through a wire.

[0061] In this embodiment, the size of the upper electrode plate 4 is 135±0.05mm×87.5±0.05mm, and the overall thickness is about 15mm; in order to achieve capacitive coupling stimulation, the first mounting groove 401 is designed as an array layout, that is, 6 holes are set directly above the upper electrode plate 4 to place the circular copper upper electrode sheet 7; the upper hole diameter of the hole is 29±0.05mm, the lower hole diameter is 22±0.025mm, and the bottom width is about 26±0.025mm. A circular copper upper electrode sheet 7 with a diameter of 25mm and a thickness of 1.6±0.05mm is placed in the hole.

[0062] In addition, a glass sheet mounting hole is designed at the bottom of the upper electrode plate 4, and the size parameters of the glass sheet mounting hole are: the upper aperture is 27±0.025mm, the lower aperture is 22±0.025mm, and the depth is 1±0.025mm. It is used to place a glass sheet with a diameter of 25mm and a thickness of 0.16±0.02mm to improve the capacitive coupling efficiency; a rectangular second mounting groove 402 is also made on the top of the upper electrode, and its size parameters are 128.88±0.5mm ×7.8±0.5mm, and a depth of 3±0.5mm, for placing an upper PCB circuit board with a size of 128.88±0.1mm×6.6±0.01mm and a thickness of 1.6±0.01mm; the upper side of the circular copper upper electrode sheet 7 is connected to the upper PCB circuit board through a wire, and the lower side is bonded to the glass sheet with electrode gel, and pressurized by a 3D printed hollow screw 6 to eliminate the air between the circular copper upper electrode sheet 7 and the glass sheet, so as to further improve the coupling efficiency.

[0063] See also Figure 2-Figure 9 In this embodiment, two pairs of arch-bridge handles 5 with dimensions of 38.99±0.05mm×5±0.05mm×11±0.05mm are also designed to facilitate the lifting of the upper electrode plate 4.

[0064] See also Figure 2-Figure 9 The lower electrode assembly includes a lower electrode sheet 8 and a lower PCB circuit board arranged on the base 2, wherein the base 2 is provided with a third mounting groove for mounting the lower electrode sheet 8 and a fourth mounting groove 205 for mounting the lower PCB circuit board, wherein the third mounting grooves are multiple groups, and the multiple groups of third mounting grooves correspond one-to-one to the multiple groups of first mounting grooves 401; the fourth mounting groove 205 extends along the length direction of the base 2; a second wiring hole 203 is provided on the side of the base 2; the second wiring hole 203 is connected to the fourth mounting groove 205; the lower electrode sheet 8 is installed in the third mounting groove, and the bottom of the lower electrode sheet 8 is connected to the lower PCB circuit board through a wire.

[0065] To achieve capacitive coupling stimulation, a circular copper lower electrode sheet 8 of the same material is also placed under the culture dish; the corresponding circular copper upper electrode sheet 7 and the circular copper lower electrode sheet 8 together form a parallel plate capacitor, in which the cells are located inside the culture dish. When a stimulation signal is applied to the parallel plate capacitor, an electric field is generated in the culture dish, which acts on the cells in the culture dish, thereby stimulating them to perform biological activities.

[0066] In this embodiment, the size of the base 2 is 142±0.05mm×94±0.05mm×37±0.05mm, the bottom thickness is 6mm, and the wall thickness of the four sides is 2mm; the bottom of the base 2 is constructed with 6 holes (i.e., the third mounting grooves) corresponding to the first mounting groove 401 on the upper electrode plate 4; the upper aperture of the hole is 33.5±0.02mm, the lower aperture is 25.2±0.025mm, and the groove depth between the upper and lower apertures is 2mm, which is used to place a 3.5cm universal confocal cell culture dish with a specification of 20mm; the groove depth of the lower aperture is 2mm, which is used to place a copper electrode sheet of the same specification opposite to the upper electrode plate 4 to form a capacitive electric field. At the same time, a fourth rectangular mounting groove 205 with a size of 128.88±0.05mm×7.8±0.05mm and a depth of 3±0.05mm is designed in the base 2, which is used to place a lower PCB circuit board with a size of 128.88±0.01mm×6.6±0.01mm and a thickness of 1.6±0.1mm. The bottom of the circular copper lower electrode sheet 8 is connected to the lower PCB circuit board through a wire.

[0067] See also Figure 2-Figure 9 Gas exchange channels 201 are symmetrically arranged on both sides of the base 2, and the size of the gas exchange channels 201 is 110±0.05mm×2±0.05mm, so as to facilitate gas exchange inside and outside the electric stimulation culture box, for example, to clear the carbon dioxide generated by cell activities.

[0068] See also Figure 2-Figure 9 The four walls of the base 2 are designed with embedded grooves to connect with the top cover 1 to form an overall electrical stimulation device.

[0069] See also Figure 2-Figure 9 Four support columns 204 are designed around the base 2 , and the size (i.e., length, width, and height) of each support column 204 is 5±0.05mm×5±0.05mm×17±0.05mm, and its function is to support the upper electrode plate 4 .

[0070] See also Figure 2-Figure 9 The electrical stimulation culture box also includes a fixing component for fixing the culture dish, and the fixing component includes a positioning plate 9 and a positioning member 10 for limiting the positioning plate 9 in the horizontal and vertical directions, wherein a plurality of groups of positioning grooves 901 are provided on the positioning plate 9; the plurality of groups of positioning grooves 901 correspond one-to-one to the plurality of groups of first mounting grooves 401 or the plurality of groups of third mounting grooves; the inner diameter of each group of positioning grooves 901 is equal to the outer diameter of the culture dish.

[0071] In this embodiment, in order to fix the culture dish, the positioning member 10 includes a rotatable buckle arranged on the base 2, the buckle is rotatably connected to the base 2, and the positioning plate 9 is provided with an avoidance hole for avoiding the buckle; when the culture dish needs to be positioned, the positioning plate 9 is placed on the base 2, the size of the positioning plate 9 can be set to be consistent with the inner cavity size of the base 2, and a positioning groove 901 is provided at a corresponding position to the support column 204; before the positioning plate 9 is placed into the base 2, it is necessary to adjust the position of the buckle so that it is located below the avoidance hole, and when the positioning plate 9 is placed into the base 2, the buckle is rotated so that the buckle is staggered with the avoidance groove, so that the buckle is pressed against the positioning plate 9, and the positioning plate 9 is vertically limited; at the same time, since the size of the positioning plate 9 is consistent with the inner cavity size of the base 2, the positioning plate 9 will not move horizontally; and the culture dish required for the experiment is fixed in the positioning groove 901 of the positioning plate 9.

[0072] In addition, in order to facilitate the removal of the positioning plate 9 , two handles 11 are provided on the positioning plate 9 ; when the experiment is completed, the buckle is rotated to the avoidance groove, and then the positioning plate 9 is removed by the two handles 11 .

[0073] The capacitive cell electrical stimulation universal device of the present invention is equipped with an adjustable high-throughput signal source control system, which can output and monitor electrical signals, and automatically adjust the output of electrical signals through a negative feedback mechanism to ensure the accuracy and stability of electrical stimulation. In addition, the capacitive cell electrical stimulation universal device of the present invention is compatible with commercially available cell culture dishes, and does not require personalized customization, thereby significantly improving the convenience of experimental operation and the versatility of the device and the convenience of long-term use, reducing the cost of the experiment. In addition, the capacitive cell electrical stimulation universal device of the present invention adopts an array electrode design, supports the simultaneous conduct of multiple groups of experiments, can meet the needs of multiple groups of control experiments and meet the needs of high-throughput experiments, and further enhances the flexibility and efficiency of the experiment. Finally, based on the capacitive electrical stimulation technology, the capacitive cell electrical stimulation universal device of the present invention performs cell electrical stimulation experiments in a closed environment, which can effectively avoid the interference of external pollution on the experiment and improve the reliability of the experimental results.

[0074] The working principle of the universal device for capacitive cell electrical stimulation of the present invention is:

[0075] First, a culture dish is placed in a capacitive electrical stimulation culture box, and then an operator inputs and sets voltage and frequency parameters through a human-computer interaction module; after receiving the voltage and frequency parameters input by the operator, the input unit outputs the voltage and frequency parameters to a PID regulator; the PID regulator adjusts the PID parameters according to the set values ​​to adjust the voltage and frequency, thereby generating corrected voltage and frequency signals; the corrected voltage and frequency signals are processed and transmitted to a direct digital synthesis module; the corrected voltage and frequency signals are processed by the direct digital synthesis module to generate a composite signal containing multiple waveforms; then the generated composite signal is distributed and processed by an analog multiplexer, and the composite signal is divided into multiple channels according to preset output parameters; the signal in each channel is selectively extracted to obtain the required signal characteristics; then the signal of each channel is filtered and processed by a filtering module, and then output to a power driving module; the power driving module is used to amplify the power of the signal to meet the preset voltage requirements, and the signal is transmitted to the electrical stimulation culture box to perform an electrical stimulation experiment on the cells in the electrical stimulation culture box;

[0076] In the above process, the detector arranged in the electric stimulation culture box can monitor the voltage and frequency in the electric stimulation culture box in real time, and transmit the detected data information to the signal filtering and amplification module, the signal filtering and amplification module purifies the data information, and converts the analog signal into a digital signal through an analog-to-digital converter and outputs it to the feedback unit, the feedback unit compares the detected value with the set value, and outputs feedback information to the PID controller, and the PID controller dynamically adjusts the voltage and frequency input to the electric stimulation culture box through the built-in PID algorithm.

[0077] Example 2

[0078] This embodiment uses the universal device for capacitive cell electrical stimulation of embodiment 1 to detect whether the expression of Ptgs2 and iNOS genes in RAW264.7 cells is related to voltage; specifically, the following steps are included:

[0079] Step S1: RAW264.7 cell culture;

[0080] RAW264.7 cells were taken and resuspended in high-glucose DMEM medium containing 10% (mass percentage) South American serum and 1% (mass percentage) penicillin-streptomycin. , and cultured in a 37°C constant temperature incubator until the cell confluence reached 80%-90%. The cells were then collected and plated at 4×10 5The commercial 20 mm 3.5 cm confocal cell culture dish was inoculated with a density of 10 cells / mL, and the same culture medium was used without adding any inducer. After the cells were cultured to a confluence of 80%-90%, subsequent molecular detection and related experimental analysis were performed at different time points according to experimental requirements.

[0081] Step S2: Electrical stimulation cell experiment;

[0082] The above 6 culture dishes were transferred to the electric stimulation culture box, and the electric stimulation experiment was carried out in 3 groups. The 3 channels were set as follows: "10Hz, 2V", "10Hz, 5V", and "10Hz, 9V". The electric stimulation time was set to 1h, and then the electric stimulation was carried out. During the electric stimulation process, the detector always detected the output signal in the electric stimulation culture box to ensure that the actual output met the preset requirements.

[0083] Step S3: total RNA extraction;

[0084] Total RNA of cells after electrical stimulation was extracted according to TRNzolUniversal Total RNA Extraction Reagent (DP424) of Tiangen Biochemical Technology (Beijing) Co., Ltd.; 1 mL Trizol was added to each well of the 6-well plate to lyse the cells and repeatedly blown with a pipette tip for 5 minutes at room temperature. The lysate was transferred to a 1.5 mL centrifuge tube, 200 μL chloroform was added, the tube lid was tightly closed, vortexed and allowed to stand at room temperature for 3 minutes, and centrifuged at 4°C, 12000 g / min for 15 minutes. The upper aqueous phase liquid was transferred to a new 1.5 mL centrifuge tube, 500 μL isopropanol was added, vortexed and allowed to stand at room temperature for 10 minutes, and centrifuged at 4°C, 12000 g / min for 10 minutes. The supernatant was aspirated with a pipette, discarded, and the white precipitate at the bottom was retained. 1 mL 75% (volume percentage) ethanol (prepared with DEPC water) was added, the white precipitate was gently flicked by hand, and then centrifuged at 7500 g / min for 5 minutes at 4°C. Discard the supernatant, dry at room temperature for 15 minutes, add 30-40 μL DEPC water to re-dissolve, and store the RNA in a -80°C refrigerator or use it directly.

[0085] Step S4: reverse transcription of total RNA;

[0086] Use a reverse transcription kit (TaKaRa, catalog number RR047A) to reverse transcribe the extracted 1000ng total RNA into cDNA according to the kit's operating procedures. The specific process is as follows:

[0087] After the RNA concentration was determined, the volume of RNA and DEPC water needed to be added was calculated based on the amount of 500 ng of total RNA added to 10 μL of reverse transcription system;

[0088] (1) Add DEPC water, total RNA and 5× PrimeScriptTM RT Master Mix (TaKaRa, Catalog No. RR047A) to the PCR tube in sequence and mix well;

[0089] (2) Perform reverse transcription amplification on a PCR instrument according to the procedure of 37°C for 15 min, 85°C for 5 s, and storage at 4°C;

[0090] (3) The amplified cDNA is diluted 30-50 times with sterile triple-distilled water and used for fluorescence quantitative PCR amplification, or stored at -20℃ for a long time.

[0091] Step S5: Fluorescence quantitative PCR amplification (Q-PCR);

[0092] Refer to the kit instructions (TaKaRa, catalog number RR820A) and use real-time fluorescence quantitative PCR technology to perform Q-PCR experiments with Gapdh as the internal reference gene to detect the expression level of the gene. The specific process is as follows:

[0093] (1) Prepare the detection primers, sterile triple-distilled water, 96-well PCR plate, and fluorescent quantitative reagent before the experiment;

[0094] (2) Assigning specific locations of reaction products in a 96-well PCR plate according to the number of genes to be detected;

[0095] (3) Prepare the reaction solution according to the ratio of 2 replicate wells for each sample of each gene to be detected: 20 μL reaction system contains 2 μL cDNA template, 10 μL 2×SYBR® Premix Ex TaqTM II (TAKARA) reagent, 1 μL upstream primer (10 μM), 1 μL downstream primer (10 μM), and 6 μL triple distilled water;

[0096] (4) After adding all the reaction solutions to the corresponding wells, seal the 96-well PCR plate with a special sealing film and centrifuge at 2500 rpm for 3 min;

[0097] (5) After centrifugation, the samples were tested on the BIO-RAD CFX96 TouchTM fluorescent quantitative PCR detection system. The reaction procedure was as follows: A. pre-denaturation at 95°C for 30 sec; B. PCR reaction: 95°C for 5 sec, 60°C for 30 sec, plate reading, 40 cycles; C. curve fitting and plate reading;

[0098] (6) After the reaction is completed, use the system's own analysis software to analyze the data, exclude the values ​​with a CT value difference greater than 0.5 in the two replicate wells, and calculate the relative expression level of each test gene based on the internal reference gene. The Q-PCR primer list is as follows:

[0099] Mouse iNOS F:TCCCAGCAATGGGCAGACTCR:GGTGGGACAGCTTCTGGTCG Mouse Ptgs2 F:CCTGGGTTCACCCGAGGACTR:TGCAGGTTCTCAGGGATGTGAG Mouse Gapdh F:TGTGTCCGTCGTGGATCTGAR:CCTGCTTCACCACCTTCTTGA

[0100] from Fig.10 According to the experimental results, the expression of Ptgs2 and iNOS genes in RAW264.7 cells gradually increased with the increase of voltage, showing dependence on voltage; this indicates that voltage changes have a significant regulatory effect on the expression of these two genes. Ptgs2 and iNOS genes are recognized as electrical signal response genes reported in the literature. The above data show that the universal device for capacitive cell electrical stimulation of the present invention can successfully give RAW264.7 cells electrical signal stimulation, which also shows that the universal device for capacitive cell electrical stimulation of the present invention can achieve an ideal cell power supply effect.

[0101] Example 3

[0102] This embodiment uses the universal device for capacitive cell electrical stimulation of embodiment 1 to detect whether the expression of Runx2, ALP and OCN genes of MC3T3-E-1 cells is related to voltage; specifically, the following steps are included:

[0103] Step S1: MC3T3-E-1 cell culture;

[0104] MC3T3-E-1 cells were taken and resuspended in α-MEM medium containing 10% (mass percentage) South American serum and 1% (mass percentage) penicillin-streptomycin. , and cultured in a 37°C constant temperature incubator until the cell confluence reached 80%-90%. The cells were then collected and plated at 4×10 5 The commercial 20 mm 3.5 cm confocal cell culture dish was inoculated with a density of 1.5 cells / mL, and the same culture medium was used without adding any inducer. After the cells were cultured to a confluence of 80%-90%, subsequent molecular detection and related experimental analysis were performed at different time points according to experimental requirements.

[0105] Step S2: Electrical stimulation cell experiment;

[0106] The above 6 culture dishes were transferred to the electric stimulation culture box, and the electric stimulation experiment was carried out in 3 groups. The 3 channels were set as "10Hz, 2V", "10Hz, 5V", and "10Hz, 9V". The electric stimulation time was set to 1h, and then the electric stimulation was carried out. During the electric stimulation process, the detector always detected the output signal in the culture box to ensure that the actual output met the preset requirements.

[0107] Step S3: total RNA extraction;

[0108] See Example 2 for specific experimental operations;

[0109] Step S4: reverse transcription of total RNA;

[0110] See Example 2 for specific experimental operations;

[0111] Step S5: Fluorescence quantitative PCR amplification (Q-PCR);

[0112] The specific experimental procedures of (1)-(5) are shown in Example 2, the difference here lies in the different primers.

[0113] (6) The Q-PCR primer list is as follows:

[0114] Mouse ALP F:GCACCTGCCTTACCAACTCTR:CTGGCCCTTAAGGATTCGGG Mouse OCN F:CTGACCTCACAGATCCCAAGCR:TGGTCTGATAGCTCGTCACAAG Mouse Runx2 F:TTCAACGATCTGAGATTTGTGGGR:GGATGAGGAATGCGCCCTA Mouse Gapdh F:TGTGTCCGTCGTGGATCTGAR:CCTGCTTCACCACCTTCTTGA

[0115] from Fig.11 According to the experimental results, the expression of Runx2, ALP and OCN genes in MC3T3-E-1 cells gradually increased with the increase of voltage, showing dependence on voltage. The above data show that the use of the universal device for capacitive cell electrical stimulation of the present invention to stimulate MC3T3-E1 cells with electrical signals can upregulate the expression of the above three genes, thereby facilitating osteogenic differentiation.

[0116] Example 4

[0117] This embodiment uses the universal device for capacitive cell electrical stimulation of embodiment 1 to detect whether the expression levels of genes TNF-α, IL-1β and IL-6 related to inflammation caused by lipopolysaccharide (LPS) are related to voltage; specifically, the following steps are included:

[0118] Step S1: LPS-induced inflammation model in RAW264.7 cells:

[0119] After RAW264.7 cells were pipetted off the culture flask, the final cell concentration was adjusted to 4 × 10 5 / ml, add 2 ml of cell suspension to a commercial 20mm 3.5cm confocal cell culture dish; culture until the cell confluence reaches 70%-80%, then remove the culture medium, gently wash the cells once with serum-free DMEM, and add LPS to a final concentration of 1μg / ml.

[0120] Step S2: Electrical stimulation cell experiment;

[0121] The above culture dish was transferred to the electric stimulation culture box, and the electric stimulation experiment was carried out in 3 groups, namely, a blank control group, an LPS model group, and an LPS+ES model group. The three channels were set to "10Hz, 5V", and the electric stimulation time was set to 1h, followed by electric stimulation. During the electric stimulation process, the device always detected the output signal in the culture box to ensure that the actual output met the preset requirements.

[0122] Step S3: total RNA extraction;

[0123] See Example 2 for specific experimental operations;

[0124] Step S4: reverse transcription of total RNA;

[0125] See Example 2 for specific experimental operations;

[0126] Step S5: Fluorescence quantitative PCR amplification (Q-PCR);

[0127] (1) - (5) The specific experimental procedures are shown in Example 2, the difference here is that the primers are different;

[0128] (6) After the reaction is completed, use the system's own analysis software to analyze the data, exclude the values ​​with a CT value difference greater than 0.5 in the two replicate wells, and calculate the relative expression level of each test gene based on the internal reference gene. The Q-PCR primer list is as follows:

[0129] Mouse TNF-α F:CAAAATTCGAGTGACAAGCCTGR:GAGATCCATGCCGTTGGC Mouse IL-1β F:ATGCCACCTTTTGACAGTGATR:TGCGAGATTTGAAGCTGGAT Mouse IL-6 F:TCCATCCAGTTGCCTTCTTGR:GAAGTCTCCTCTCCGGACTT Mouse Gapdh F:TGTGTCCGTCGTGGATCTGAR:CCTGCTTCACCACCTTCTTGA

[0130] from Fig.12 It can be seen that LPS leads to upregulation of the expression of inflammation-related genes TNF-α, IL-1β and IL-6, while under the synergistic effect of electrical stimulation (ES), the expression levels of these inflammatory genes are significantly downregulated. The above data show that the use of the capacitive cell electrical stimulation universal device of the present invention to stimulate RAW264.7 cells with electrical signals can inhibit the LPS-induced inflammatory response of RAW264.7.

[0131] The above is a preferred embodiment of the present invention, but the embodiment of the present invention is not limited to the above content. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A universal device for capacitive cell electrical stimulation, comprising an electrical stimulation culture box and a signal source control system for providing stimulation signals to the electrical stimulation culture box, characterized in that: The signal source control system includes a human-computer interaction module, a main control module, a direct digital synthesis module, a multiplexer module, a filter module, a power drive module and a signal filtering and amplification module, wherein: The human-computer interaction module is used for the operator to input voltage and frequency parameters; The main control module includes an input unit, a PID regulator, a feedback unit and an analog-to-digital converter, wherein: The input unit is used to receive the voltage and frequency parameters input by the operator, and output the voltage and frequency parameters to the PID regulator; The PID regulator is used to adjust the PID parameters according to the set values ​​to generate corrected voltage and frequency signals; the corrected voltage and frequency signals are processed and transmitted to the direct digital synthesis module; The direct digital synthesis module is used to process the corrected voltage and frequency signals to generate a composite signal containing a mixture of multiple waveforms; The multiplexer module is used to distribute and process the generated composite signal according to the control instruction of the main control module, and divide the composite signal into multiple channels according to the preset output parameters; and extract the signal in each channel to obtain the required signal characteristics; The filtering module is used to filter the signals of each channel and then output them to the power driving module; The power driving module is used to amplify the power of the signal and transmit it to the electrical stimulation culture box, and the power driving module includes a power amplification circuit arranged in each channel; A detector is provided in the electrical stimulation culture box, and the detector is used to monitor the voltage and frequency in the electrical stimulation culture box in real time, and transmit the detected voltage and frequency information to the signal filtering and amplifying module, and the signal filtering and amplifying module purifies the data information, and converts the analog signal into a digital signal through the analog-to-digital converter and outputs it to the feedback unit, and the feedback unit compares the detected value with the set value, and outputs feedback adjustment information to the PID controller, so as to realize dynamic adjustment of the voltage and frequency input to the electrical stimulation culture box; The electric stimulation culture box is a capacitive electric stimulation culture box, which includes a base and a top cover arranged on the base, wherein the base is provided with a plurality of mounting positions for placing culture dishes; an upper electrode assembly is arranged above the mounting positions, and a lower electrode assembly is arranged below the mounting positions, wherein: The upper electrode assembly comprises an upper electrode plate, an upper electrode sheet arranged in the upper electrode plate and an upper PCB circuit board, wherein the upper electrode plate is provided with a first mounting groove for mounting the upper electrode sheet and a second mounting groove for mounting the upper PCB circuit board, wherein the first mounting grooves are in a plurality of groups, the plurality of groups of first mounting grooves are arranged in an array, and correspond one to one with the plurality of groups of mounting positions; each group of first mounting grooves vertically penetrates the upper and lower sides of the upper electrode plate; the second mounting grooves extend along the length direction of the upper electrode plate; a first wiring hole is provided on the side of the base; the first wiring hole is connected with the second mounting groove; the upper electrode sheet is installed in the first mounting groove, and a glass sheet is provided at the bottom of the upper electrode sheet; the glass sheet is attached to the bottom of the upper electrode sheet through electrode gel; the top of the upper electrode sheet is connected to the upper PCB circuit board through a wire; The lower electrode assembly includes a lower electrode sheet and a lower PCB circuit board arranged on the base, wherein the base is provided with a third mounting groove for mounting the lower electrode sheet and a fourth mounting groove for mounting the lower PCB circuit board, wherein the third mounting grooves are multiple groups, and the multiple groups of third mounting grooves correspond one-to-one to the multiple groups of first mounting grooves; the fourth mounting groove extends along the length direction of the base; a second wiring hole is provided on the side of the base; the second wiring hole is connected to the fourth mounting groove; the lower electrode sheet is installed in the third mounting groove, and the bottom of the lower electrode sheet is connected to the lower PCB circuit board through a wire.

2. The universal device for capacitive cell electrical stimulation according to claim 1, characterized in that: The filtering module includes a filtering circuit arranged in each channel, and the filtering circuit includes a first-order high-pass filter and a second-order low-pass filter, wherein the first-order high-pass filter is used to remove the DC bias in the output signal of the direct digital synthesis module; and the second-order low-pass filter is used to eliminate high-frequency noise and stray components in the signal.

3. The universal device for capacitive cell electrical stimulation according to claim 1, characterized in that: Two groups of arch bridge type handles are arranged on the upper side of the upper electrode plate.

4. The universal device for capacitive cell electrical stimulation according to claim 1, characterized in that: Gas exchange channels are symmetrically arranged on both sides of the base.

5. The universal device for capacitive cell electrical stimulation according to claim 1, characterized in that: The capacitive electrical stimulation culture box also includes a fixing component for fixing the culture dish placed on the mounting position, the fixing component includes a positioning plate and a positioning member for limiting the positioning plate in the horizontal and vertical directions, wherein a plurality of groups of positioning grooves are arranged on the positioning plate; the plurality of groups of positioning grooves correspond one-to-one to the plurality of groups of first mounting grooves or the plurality of groups of third mounting grooves; the inner diameter of each group of positioning grooves is equal to the outer diameter of the culture dish.

6. The universal device for capacitive cell electrical stimulation according to claim 1, characterized in that: Support columns for supporting the upper electrode plate are arranged around the base.

7. Use of the universal device for capacitive cell electrical stimulation according to any one of claims 1 to 6 in electrical signal stimulation processing and detection of cells.

Images