SiRNA for treating androgenetic alopecia, nano preparation and preparation method thereof

Abstract

The invention relates to siRNA for treating androgenetic alopecia, a nano preparation and a preparation method of the siRNA. The siRNA comprises a positive-sense strand and an antisense strand, the positive-sense strand is as shown in SEQ ID NO. 1, and the antisense strand is as shown in SEQ ID NO. 2. The siRNA disclosed by the invention can be used for efficiently and quickly inhibiting the expression of an androgen receptor in vivo and in vitro. When the medicine containing the siRNA is applied to the surface of the alopecia skin, the treatment effect can be quickly achieved, the hair growth speed is increased, and the hair regeneration time of the alopecia part is shorter.

Description

Technical Field

[0001] The present invention belongs to the technical field of nucleic acid drugs, and in particular relates to a siRNA for treating androgenic alopecia, a nano preparation and a preparation method thereof. Background Art

[0002] Androgenic alopecia is the most common type of hair loss in clinical practice. In my country, the total prevalence of males is 21.3%, and the prevalence of females is 6.0%, and the prevalence is even higher among Caucasians. As a genetic disease, the local scalp hair follicles of patients with androgenic alopecia are more sensitive to androgens (mainly dihydrotestosterone). Under the action of androgens, the hair follicles are miniaturized, the hair shafts become thinner and shorter, and the clinical manifestations are sparse and thinning hair. Although androgenic alopecia does not affect the life and health of patients, it will cause great mental distress. At present, the number of people with hair loss in China has exceeded 250 million, and the age of hair loss is 20 years earlier than that of the previous generation, showing a clear trend of younger age. Therefore, the demand for simple and effective treatments is also increasing.

[0003] At present, the treatments for androgenic alopecia include surgical treatment (such as hair follicle transplantation, laser irradiation) and drug treatment. Compared with surgical treatment, drug treatment has less economic burden on patients and is easier to operate. Clinically, the main drugs for the treatment of androgenic alopecia are minoxidil, finasteride, flutamide, bicalutamide, spironolactone, etc., and minoxidil and finasteride are the most commonly used. The mechanism by which minoxidil promotes hair growth is still unclear. It mainly shortens the resting phase of hair growth and transitions to the early stage of hair growth earlier to increase hair length and diameter. It starts to take effect after about 2 months of medication and reaches its maximum effect in 4 months. Different adverse reactions may occur depending on the method of administration of minoxidil. Topical application of minoxidil may cause irritant dermatitis, contact dermatitis, etc. Oral low-dose minoxidil may cause excessive hair growth on the face or other parts due to systemic distribution problems. Finasteride can reduce serum dihydrotestosterone levels by inhibiting 5α-reductase. However, patients treated with oral finasteride may experience erectile dysfunction, decreased libido, ejaculation disorders, and a higher risk of depression. Topical use of finasteride can cause mild or moderate skin reactions.

[0004] Small interfering RNA (siRNA) is a short double-stranded RNA molecule used to mediate RNA interference in mammalian cells. It can bind to messenger RNA (mRNA) of a specific sequence and degrade it, making it untranslatable, in order to regulate the expression of the target gene. Compared with small molecule therapeutic drugs and monoclonal antibody drugs, siRNA has inherent advantages because siRNA performs its function by completely base pairing with mRNA, while small molecule and monoclonal antibody drugs need to recognize the complex spatial conformation of proteins to exert their effects. Due to sequence specificity, any target gene can be targeted by the corresponding siRNA. This advantage gives the siRNA model a shorter development time and a wider therapeutic field than small molecule or antibody drugs. For androgenic alopecia, blocking the binding of androgens to the patient's scalp hair follicles can prevent the atrophy and degeneration of hair follicles, thereby inhibiting hair loss.

[0005] Since siRNA is unstable, prone to enzymatic and non-enzymatic degradation, and has a negative charge and is difficult to enter cells, there is a problem of delivery difficulties in siRNA therapy. It is necessary to design a suitable nanocarrier as a protective shell to deliver siRNA into cells to effectively play a role. Lipid nanoparticles (LNP) are lipid vesicles with a uniform lipid core. They are widely used in the delivery of nucleic acid drugs because they can isolate nucleic acid degradation caused by the environment through encapsulation. Cationic lipids have a permanently positively charged head group that can adsorb negatively charged siRNA and have affinity with the cell membrane to mediate entry into cells.

[0006] Currently, there is a lack of siRNA drugs in this field that can quickly and efficiently promote hair regeneration. Summary of the invention

[0007] Based on this, the purpose of the present invention is to improve a siRNA for treating androgenic alopecia, wherein the siRNA can significantly inhibit the expression of androgen receptor gene and can quickly and efficiently promote hair regeneration.

[0008] The first aspect of the present invention is to provide a siRNA for inhibiting the expression of human androgen receptor, wherein the siRNA comprises a sense strand and an antisense strand, wherein the sense strand is shown as SEQ ID NO.1, and the antisense strand is shown as SEQ ID NO.2.

[0009] The second aspect of the present invention is to provide a nanoformulation for inhibiting androgen receptor expression, which is composed of an agent for inhibiting androgen receptor expression encapsulated by lipid nanoparticles, and the agent for inhibiting androgen receptor expression includes the siRNA as described above.

[0010] In some embodiments, the lipid nanoparticles are prepared from raw materials including DOTAP, lecithin and cholesterol.

[0011] In some embodiments, the mass ratio of DOTAP, lecithin and cholesterol is 5:(1-3):(2-4); preferably, the mass ratio of DOTAP, lecithin and cholesterol is 5:(1-2):(3-4); and / or,

[0012] The mass ratio of the siRNA to DOTAP is 1:(8-15).

[0013] The third aspect of the present invention is to provide a method for preparing the nanoformulation as described above, comprising the following steps: (1) dissolving the raw material for preparing the lipid nanoparticles in a solvent to obtain an organic phase; (2) dissolving the siRNA in a solvent to obtain an aqueous phase; and (3) stirring the aqueous phase and slowly dripping the organic phase into the aqueous phase while stirring.

[0014] In some embodiments, the solvent in step (1) is anhydrous ethanol.

[0015] In some embodiments, the solvent in step (2) is a 20 mM to 30 mM sodium acetate aqueous solution or a 20 mM to 30 mM sodium citrate aqueous solution.

[0016] The fourth aspect of the present invention is to provide the use of the siRNA or the nanoformulation as described above in the preparation of a drug for treating androgenic alopecia.

[0017] The fifth aspect of the present invention is to provide a drug for treating androgenic alopecia, the drug comprising an active ingredient and a pharmaceutically acceptable carrier; the active ingredient includes the siRNA as described above and / or the nanoformulation as described above.

[0018] In some embodiments, the drug is in the form of a gel.

[0019] In some embodiments, the gel comprises the nanoformulation and sodium hyaluronate.

[0020] In some embodiments, the relative molecular weight of the sodium hyaluronate is 8×10 5 ~13×10 5 .

[0021] The present invention obtains a siRNA for inhibiting androgen receptor expression through a large number of studies and screenings. The siRNA can effectively and quickly inhibit the expression of androgen receptor subunit 1 (AR-1) and subunit 2 (AR-2) both in vivo and in vitro.

[0022] Furthermore, the present invention also provides a nanoformulation that can effectively deliver the siRNA, the nanoformulation is composed of lipid nanoparticles encapsulating the siRNA, the nanoformulation is prepared by suitable raw materials, has a suitable particle size and low Zeta potential, so that it is very easy to be taken up by skin hair follicle cells, and has high biological safety and no obvious side effects. Moreover, when the nanoformulation is applied on the surface of hair loss skin, the siRNA encapsulated inside can quickly exert a therapeutic effect, effectively shorten the time of hair regeneration in the hair loss area, increase the hair growth rate, and increase the length of regenerated hair. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The inhibitory effects of four siRNAs on the mRNA expression levels of androgen receptor subunit 1 (AR-1) and subunit 2 (AR-2) in human hair follicle dermal papilla cells.

[0024] Figure 2 The particle size and Zeta potential of lipid nanoparticles prepared with different formulations in Example 2.

[0025] Figure 3 The inhibitory effects of siRNA-LNP-A and siRNA-LNP-B on the mRNA expression levels of androgen receptor subunit 1 (AR-1) and subunit 2 (AR-2) in human hair follicle dermal papilla cells.

[0026] Figure 4 These are the results of the cell safety investigation of siRNA-LNP-A and siRNA-LNP-B.

[0027] Figure 5 The results show the changes of storage modulus and loss modulus of gels prepared with different contents of sodium hyaluronate as a function of amplitude.

[0028] Figure 6 Sample graph of the gel prepared with 3% sodium hyaluronate and the results of viscosity change with shear rate.

[0029] Figure 7 These are the skin retention test results of DiR-LNP / Gel and DiR-LNP.

[0030] Figure 8 The therapeutic effects of siRNA-LNP / GelA and siRNA-LNP / GelB on androgenic alopecia. DETAILED DESCRIPTION

[0031] In order to facilitate the understanding of the present invention, the present invention will be described more fully below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0032] The experimental methods in the following examples without specifying specific conditions are usually carried out under conventional conditions or conditions recommended by the manufacturers. The various commonly used chemical reagents used in the examples are all commercially available products.

[0033] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those commonly understood by those skilled in the art to which the present invention belongs. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The term "and / or" used in the present invention includes any and all combinations of one or more of the related listed items.

[0034] In addition, as used in the present invention, the term "or" is an inclusive "or" symbol and is equivalent to the term "and / or", unless the context clearly dictates otherwise. The term "based on" is not exclusive and allows for being based on other factors not described, unless the context clearly dictates otherwise. In addition, throughout the specification, the meanings of "a", "an", and "the" include plural referents. The meaning of "in..." includes "in..." and "on...".

[0035] For androgenic alopecia, blocking the binding of androgens to the scalp hair follicles of patients can prevent the hair follicles from shrinking and degenerating, thereby inhibiting hair loss. The androgen receptor mediates the binding process, and is mainly mediated by androgen receptor subunit-1 (AR-1), assisted by androgen receptor subunit-2 (AR-2). Therefore, the present invention designs siRNA for the mRNA sequences of AR-1 and AR-2, which can bind to and mediate the degradation of AR-1 and AR-2 mRNA through sequence specificity, downregulate the expression of androgen receptor, and reduce the sensitivity of the patient's scalp hair follicles to androgens.

[0036] Some embodiments of the present invention relate to a siRNA for inhibiting the expression of human androgen receptor, wherein the siRNA comprises a sense strand and an antisense strand, wherein the sense strand is shown in SEQ ID NO. 1, and the antisense strand is shown in SEQ ID NO. 2. The siRNA is obtained through a large number of studies and screenings, and can efficiently and rapidly inhibit the expression of androgen receptor subunit 1 (AR-1) and subunit 2 (AR-2) both in vivo and in vitro.

[0037] Some embodiments of the present invention relate to a nanoformulation, which is composed of an agent for inhibiting androgen receptor expression encapsulated by lipid nanoparticles, wherein the agent for inhibiting androgen receptor expression includes the siRNA as described above.

[0038] In some embodiments, the lipid nanoparticles are prepared from raw materials including DOTAP, lecithin and cholesterol.

[0039] In some embodiments, the mass ratio of DOTAP, lecithin and cholesterol is 5:(1-3):(2-4); preferably, the mass ratio of DOTAP, lecithin and cholesterol is 5:(1-2):(3-4); more preferably, the mass ratio of DOTAP, lecithin and cholesterol is 5:1:4.

[0040] Some embodiments of the present invention relate to a method for preparing the above-mentioned nanoformulation, comprising the following steps: (1) dissolving the raw material for preparing the lipid nanoparticles in a solvent to obtain an organic phase; (2) dissolving the siRNA in a solvent to obtain an aqueous phase; (3) stirring the aqueous phase and slowly dripping the organic phase into the aqueous phase while stirring.

[0041] In some embodiments, the solvent in step (1) is anhydrous ethanol. The raw materials for preparing the lipid nanoparticles are weighed as needed, added to the solvent, and fully dissolved and mixed to obtain the organic phase.

[0042] In some embodiments, the solvent in step (2) is a 20 mM to 30 mM sodium acetate aqueous solution or a 20 mM to 30 mM sodium citrate aqueous solution. Weigh the siRNA and add it to the solvent, fully dissolve and mix to obtain the aqueous phase.

[0043] Take the above organic phase and aqueous phase as needed, slowly drip the organic phase into the aqueous phase while stirring it, and continue stirring and incubating for a period of time after the dripping is completed, for example, 20min to 60min, preferably 20min to 40min, and more preferably 30min.

[0044] Some embodiments of the present invention relate to a drug for treating androgenic alopecia, wherein the drug comprises an active ingredient and a pharmaceutically acceptable carrier; the active ingredient comprises the siRNA as described above and / or the nanoformulation as described above.

[0045] In some embodiments, the drug is in the form of a gel.

[0046] In some embodiments, the drug comprises the nanoformulation and sodium hyaluronate. The nanoformulation and sodium hyaluronate can be prepared into a gel according to conventional methods in the art. For example, the preparation method of the gel comprises the following steps: slowly dripping the organic phase into the aqueous phase while stirring the aqueous phase, and continuing to stir and incubate for a period of time after the dripping is completed, such as 20min to 60min, preferably 20min to 40min, and more preferably 30min; then adding hyaluronic acid, dissolving it, and stirring it to make it gel-like, to obtain.

[0047] In some embodiments, the mass percentage of hyaluronic acid in the gel is 2% to 6%.

[0048] In some embodiments, the relative molecular weight of the sodium hyaluronate is 8×10 5 ~13×10 5 .

[0049] The present invention is further described in detail below with reference to specific embodiments.

[0050] Example 1 Androgen receptor siRNA down-regulates the gene expression level of human androgen receptor in human hair follicle dermal papilla cells

[0051] 1. Construction and synthesis of siRNA sequences

[0052] A large number of siRNAs were designed based on the mRNA sequence of subunit 1 (AR-1) (NM_000044.6→NP_000035.2 androgen receptor isoform 1) and subunit 2 (AR-2) (NM_001011645.3→NP_001011645.1 androgen receptor isoform 2) of human androgen receptor (AR androgen receptor [Homo sapiens (human)]). This example only lists the siRNA of the present invention (siRNA-A) and three control siRNA sequences therein:

[0053] siRNA-A: sense strand (5′-3′)GCUAAAGACUCGGAGGAAG, SEQ ID NO.1;

[0054] Antisense strand (5′-3′) CUUCCUCCGAGUCUUUAGC, SEQ ID NO. 2;

[0055] siRNA-B: positive strand (5′-3′) GUUCACUUUUGACCUGCUAAU, SEQ ID NO.3:

[0056] Antisense strand (5′-3′) AUUAGCAGGUCAAAAGUGAAC, SEQ ID NO. 4;

[0057] siRNA-C: positive strand (5′-3′) GCUCAAGGAUGGAAGUGCA, SEQ ID NO. 5;

[0058] Antisense strand (5′-3′) UGCACUUCCAUCCUUGAGC, SEQ ID NO. 6;

[0059] siRNA-D: positive strand (5′-3′) GCCAUGCAACUCCUUCA, SEQ ID NO. 7;

[0060] Antisense strand (5′-3′) UGAAGGAGUUGCAUGGUGC, SEQ ID NO.8.

[0061] The designed siRNA was synthesized by Genema Gene Company, and two Ts were added to the 3' end.

[0062] 2. Verification of the effect of siRNA sequence

[0063] (1) Human hair follicle papilla cells (HFDPCs) in the logarithmic growth phase were digested with trypsin digestion solution to prepare a single cell suspension, which was mixed evenly. 5 The cells were seeded into 6-well plates at a density of 10 cells / well and cultured overnight at 5% CO2 and 37°C to allow them to adhere to the plate.

[0064] (2) siRNA-A to siRNA-D were transferred into human hair follicle dermal papilla cells using Lipofectamine 3000 transfection reagent. The specific operation was as follows: 5 μL of Lipo3000 reagent was diluted with 125 μL of serum-free DMEM medium. Similarly, 5 μL of siRNA was diluted with 125 μL of serum-free DMEM medium. The diluted Lipo3000 and siRNA were mixed by pipetting at a ratio of 1:1, incubated at room temperature for 5 to 10 minutes, and added to human hair follicle dermal papilla cells at a volume of 250 μL per well. The cells were cultured for 24 hours at 5% CO2 and 37°C. 1 mL of Trizol reagent was added to each well to repeatedly pipette and break the cells for the subsequent RNA extraction step, and the mRNA expression levels of androgen receptor subunit 1 (AR-1) and subunit 2 (AR-2) were detected by RT-qPCR. The RT-qPCR detection primers include detection primers for AR-1 and AR-2, wherein the AR-1 detection primers include: upstream primer: (5′-3′) CAGCAGCAGCAGCAAGAGACTAG, SEQ ID NO.9; downstream primer: (5′-3′) CCTCATCCAGGACCAGGTAGCC, SEQ ID NO.10; AR-2 detection primers include: upstream primer: (5′-3′) GGACGACCAGATGGCTGTCATTC, SEQ ID NO.11; downstream primer: (5′-3′) GCGAAGTAGAGCATCCTGGAGTTG,

[0065] SEQ ID NO. 12. Detection instrument: LightCycler 480II fluorescence quantitative PCR instrument (Roche, Switzerland), detection reagents used were Evo M-MLV RT Reagent Kit and SYBR Green Pro Taq HS kit (AG Scientific, USA), and the operation steps were strictly carried out according to the instructions.

[0066] (3) Experimental results Figure 1 ) showed that among the four siRNA sequences, siRNA-A and siRNA-B were significantly better than siRNA-C and siRNA-D in inhibiting the gene expression of AR-1 and AR-2 in human hair follicle dermal papilla cells, and could significantly downregulate the gene expression levels of AR-1 and AR-2 in human hair follicle dermal papilla cells. Among them, siRNA-A had a better downregulation effect on the mRNA of human androgen receptor subunit-1 than siRNA-B. This experiment confirmed that siRNA-A and siRNA-B can downregulate the gene expression of human androgen receptor at the cellular level.

[0067] Example 2 Prescription Screening of androgen receptor siRNA-loaded lipid nanoparticles siRNA-LNP

[0068] In this example, the raw materials for preparing siRNA-LNP are optimized, and the siRNA used in the optimization process is siRNA-A.

[0069] (1) Screening of raw materials

[0070] The corresponding components were calculated and weighed at a mass ratio of DOTAP: lecithin: DOPE (dioleoylphosphatidylethanolamine): cholesterol of 4:2:2:1, 5:1:0:4, and 3:2:3:1, and dissolved in anhydrous ethanol (organic phase). The corresponding siRNA was calculated and taken at a mass ratio of DOTAP: siRNA of 15:1 and 8:1, and dissolved in 25 mM sodium acetate buffer at a pH of 4.85. The siRNA solution (aqueous phase) was placed on a magnetic stirring table, and anhydrous ethanol in which the lipid components were dissolved was slowly dripped while stirring at a speed of 1000 rpm. The volume ratio of the aqueous phase to the organic phase was 3:1. After continuing to stir and incubate for 30 minutes, the siRNA-LNP was collected, filtered through a 0.22 μm polycarbonate membrane 5 times, and the particle size, PDI and Zeta potential were measured using a Malvern particle size analyzer.

[0071] The results are shown in Table 1. When the mass ratio of DOTAP: lecithin: DOPE: cholesterol is 5:1:0:4 and the mass ratio of DOTAP: siRNA is 8:1, the average particle size of siRNA-LNP is 339.1nm. The particle size between 300 and 400nm is conducive to the penetration of particles into hair follicles; the particle stability is good: the average Zeta potential is 5.3mV, and the toxicity to normal cells caused by the trace positive charge is low, and it is conducive to the uptake of hair follicle cells. When the mass ratio of DOTAP: lecithin: DOPE: cholesterol containing DOTAP and DOPE is 4:2:2:1, although the average particle size of the prepared siRNA-LNP is between 300 and 400nm and the stability is good, its average Zeta potential is too large and the toxicity to cells is high. When the mass ratio of DOTAP: lecithin: DOPE: cholesterol containing DOTAP and DOPE is 3:2:3:1, the stability of the prepared LNP is significantly deteriorated, and precipitation is precipitated after being placed.

[0072] For the formula group with a mass ratio of DOTAP: lecithin: DOPE: cholesterol of 5:1:0:4, this example also studied the mass ratio of DOTAP to siRNA. The results show that when the mass ratio of DOTAP to siRNA is (8-15):1, the average particle size, average Zeta potential and stability of the prepared siRNA-LNP are all good. However, when the mass ratio of DOTAP to siRNA is higher than 15:1, the amount of siRNA encapsulated does not meet the treatment requirements; when the mass ratio of DOTAP to siRNA is lower than 8:1, the zeta potential of the lipid nanoparticles is difficult to reach a positive charge, that is, the carrier is difficult to load siRNA.

[0073] Table 1

[0074]

[0075]

[0076] (2) The mass ratio of DOTAP, lecithin and cholesterol was studied.

[0077] The mass ratio of DOTAP: lecithin: cholesterol was 5:1:4, 6:0:4, 8:2:0, 2:4:4, 4:3:3, and the corresponding components were calculated and weighed and dissolved in anhydrous ethanol. The mass ratio of DOTAP: siRNA was 8:1, and the corresponding siRNA was calculated and taken, dissolved in 25 mM sodium acetate buffer at pH 4.85. The preparation method of siRNA-LNP for each prescription was the same as above. The preparation method of blank LNP (without siRNA) for each prescription was the same as that of siRNA-LNP, except that an equal volume of 25 mM sodium acetate buffer at pH 4.85 was used as the aqueous phase. The blank LNP and siRNA-LNP of each prescription were collected, and the particle size, PDI and Zeta potential were measured.

[0078] The experimental results are shown in Table 2 and Figure 2As shown in the data, the single siRNA has a particle size of about 310nm and carries more negative charge. The particle size of the blank LNPs in each formulation increased significantly after encapsulating siRNA. Among them, the siRNA-LNP particle size of the formulations with a mass ratio of DOTAP: lecithin: cholesterol of 5:1:4, 6:0:4 and 4:3:3 is between 300 and 400nm, which is conducive to its uptake by hair follicle cells and is suitable for local administration of androgen receptor siRNA-LNP on the scalp. However, the siRNA-LNP prepared by the 6:0:4 and 4:3:3 formulations has a higher Zeta potential and greater biological toxicity; and the particle size of the siRNA-LNP prepared by the 8:2:0 and 2:4:4 formulations is not between 300 and 400nm, which is not conducive to its uptake by skin hair follicle cells. When the mass ratio of DOTAP: lecithin: cholesterol is 5:1:4, the particle size of the prepared siRNA-LNP is between 300 and 400 nm, with good stability, low Zeta potential, and still carries a trace positive charge, with low cytotoxicity.

[0079] Table 2

[0080]

[0081] According to the mass ratio of DOTAP: lecithin: cholesterol (5:1:4) obtained by screening, the mass ratios of 5:2:3 and 5:3:2 were also tested. The results showed that when the mass ratio of DOTAP: lecithin: cholesterol was 5:2:3 and 5:3:2, the prepared siRNA-LNP also had a suitable particle size, Zeta potential and good stability. This shows that the lipid material obtained by combining DOTAP, lecithin and cholesterol in a mass ratio of 5: (1-3): (2-4) is suitable for preparing siRNA-LNP that is easily taken up by skin hair follicle cells.

[0082] Example 3 Effect of androgen receptor siRNA-LNP on androgen receptor gene expression at the cellular level

[0083] (1) Human hair follicle papilla cells (HFDPCs) in the logarithmic growth phase were digested with trypsin digestion solution to prepare a single cell suspension, which was mixed evenly. 5 The cells were seeded into 6-well plates at a density of 10 cells / well and cultured overnight at 5% CO2 and 37°C to allow them to adhere to the plate.

[0084] (2) Prepare siRNA-LNP-A and siRNA-LNP-B with a mass ratio of DOTAP: cholesterol: lecithin of 5:4:1 and a mass ratio of DOTAP: siRNA of 8:1, and use NC-siRNA (provided by Jima Gene) as a control. The preparation method is the same as above. Add 40 μL of siRNA-LNP-A and siRNA-LNP-B with a siRNA concentration of 2.5 μM to a 6-well plate, respectively, so that the final concentration of the two siRNA-LNPs in each well is 50 nM, and incubate with HFDPC for 24 hours under 5% CO2 and 37°C. Add 1 mL of Trizol reagent to each well to repeatedly blow and break the cells for the subsequent RNA extraction step, and detect the mRNA expression levels of AR-1 and AR-2 by RT-qPCR, and the detection method is the same as Example 1.

[0085] (3) Experimental results Figure 3 ) showed that siRNA-LNP-A and siRNA-LNP-B carrying two sequences of androgen receptor siRNA could significantly downregulate the gene expression levels of AR-1 and AR-2 in human hair follicle dermal papilla cells, confirming the successful preparation of siRNA-LNP, and that siRNA-LNP-A and siRNA-LNP-B had a significant downregulatory effect on the gene expression of human androgen receptor at the cellular level.

[0086] Example 4 Cellular Safety Study of Androgen Receptor siRNA-LNP

[0087] (1) Human hair follicle papilla cells (HFDPCs) in the logarithmic growth phase were digested with trypsin to prepare a single cell suspension and mixed evenly. 4 The cells were seeded into 96-well plates at a density of 10 cells / well and cultured overnight at 5% CO2 and 37°C to allow them to adhere to the plate.

[0088] (2) Prepare siRNA-LNP-A and siRNA-LNP-B with a mass ratio of DOTAP: cholesterol: lecithin of 5:4:1 and a mass ratio of DOTAP: siRNA of 8:1, and the preparation method is the same as above. siRNA-LNP-A and siRNA-LNP-B were added to a 96-well plate at a final concentration of 1nM, 5nM, 10nM, 20nM, 30nM, 40nM, 50nM, 60nM, 70nM, 80nM, 90nM and 100nM per well, respectively, and incubated with HFDPC for 24h, with a total system of 200μL in each well.

[0089] (3) Add 20 μL of 5 mg / mL MTT solution to each well, incubate in the dark for 4 h, discard the culture supernatant, add 150 μL DMSO to each well to dissolve the formazan crystals, measure the absorbance of each well at a wavelength of 490 nm using an enzyme reader, and calculate the cell survival rate of HFDPCs. The calculation formula is as follows:

[0090]

[0091] (4) Experimental results Figure 4 ) showed that siRNA-LNP-A and siRNA-LNP-B had no obvious toxicity to HFDPC cells within the concentration range of 100 nM, and the survival rate of HFDPC cells was more than 80%, which proved the good cell safety of the siRNA-LNP of the present invention.

[0092] Example 5 Screening of hyaluronic acid content of androgen receptor siRNA-LNP gel siRNA-LNP / Gel

[0093] In this example, siRNA-LNP was prepared into a gel, and the siRNA used in the preparation process was siRNA-A, and the method was as follows:

[0094] (1) Prepare siRNA-LNP with a mass ratio of DOTAP: cholesterol: lecithin of 5:4:1 and a mass ratio of DOTAP: siRNA of 8:1, the preparation method is the same as above. Calculate and weigh the corresponding sodium hyaluronate powder (purchased from Shandong Freda Company, product number: 0906262, molecular weight 8×10 5 ~13×10 5 ) is mixed with siRNA-LNP so that the mass percentage of hyaluronic acid (HA) in the whole raw materials is 2%, 3%, 4%, 5% and 6%, and dissolved and stirred to make it into a gel state to obtain siRNA-LNP / Gel.

[0095] (2) Stress scanning was performed on siRNA-LNP / Gel with various HA contents using Anton Paar rotational rheometer. The measurement interval was set to 0.200 mm, the temperature was set to 37°C, the strain amplitude was set to 0.01%-100%, the change law was "logarithmic change", and the frequency was constant at 10 rad / s. The changes in the storage modulus and energy loss modulus of the samples with the amplitude were obtained.

[0096] Experimental results ( Figure 5) showed that the storage modulus (G') of siRNA-LNP / Gel with various HA contents was greater than the loss modulus (G") at a strain amplitude of 0.01%, indicating that they can form stable gels. The G' of siRNA-LNP / Gel with 4%, 5% and 6% HA contents was always greater than G" in the strain range of 0.01%-100%, indicating that the siRNA-LNP / Gel with 4%, 5% and 6% HA contents had better mechanical properties; for siRNA-LNP / Gel with 2% and 3% HA contents, the G' of siRNA-LNP / Gel with 2% and 3% HA contents was greater than G" in the strain range of 0.01%-60 Within the strain range of %, the G' of the gel is always greater than G", indicating that it has good elasticity and is in a gel state. When the strain increases to 100%, G' gradually decreases and G" gradually increases. When the G" of the gel is greater than G', siRNA-LNP / Gel gradually loses its elasticity and viscosity dominates. Therefore, 2% and 3% HA gels have certain viscosity and fluidity. Based on the G' value of the currently commercially available hydrogels for skin application being between 200 and 300 Pa, siRNA-LNP / Gel with 3% HA content was selected for subsequent experiments.

[0097] The shear rate of siRNA-LNP / Gel with a HA content of 3% was scanned by Anton Paar rotational rheometer. The temperature was set to 37°C, the shear rate was 0.1-100 / s, and the change law was "logarithmic change". The change results of sample viscosity with shear rate were obtained.

[0098] Experimental results ( Figure 6 ) showed that siRNA-LNP / Gel with HA content of 3% was white and opaque, with moderate consistency and good gel forming properties. The shear rate scanning results showed that siRNA-LNP / Gel with 3% HA of a certain viscosity had the property of shear thinning, that is, the viscosity decreased with application, which was conducive to diffusion on the skin.

[0099] Example 6 Androgen receptor siRNA-LNP / Gel improves the skin retention performance of siRNA-LNP

[0100] (1) Prepare LNP / Gel with a mass ratio of DOTAP: cholesterol: lecithin of 5:4:1 and a HA content of 3%. The preparation method is the same as above. DiR dye with a final concentration of 10 μg / mL is mixed evenly with LNP / Gel and LNP for fluorescent labeling to obtain DiR-LNP / Gel and DiR-LNP.

[0101] (2) C57BL / 6 mice aged 6 to 8 weeks were randomly divided into two groups after removing the back hair. DiR-LNP / Gel and DiR-LNP were evenly applied to the back skin of the mice, respectively. After incubation in the dark for 30 min, the residual DiR-LNP / Gel and DiR-LNP on the back of the mice were wiped off, and the residual fluorescence intensity on the back of the mice was observed using small animal live imaging.

[0102] Experimental results ( Figure 7 ) showed that the fluorescence on the back of mice in the DiR-LNP / Gel group was significantly stronger than that in the DiR-LNP group, that is, after incubation for 30 minutes, compared with LNP in liquid form, LNP / Gel in gel form enhanced the retention of DiR on the back skin of mice, indicating that preparing siRNA-LNP into siRNA-LNP / Gel containing 3% HA can significantly improve the skin retention of siRNA.

[0103] Example 7 Androgen receptor siRNA-LNP / Gel for the treatment of androgenic alopecia

[0104] The design of the siRNA of the present invention selects the gene sequence fragments that overlap with the androgen receptors of humans and mice, which can simultaneously target and inhibit the androgen receptor genes of humans and mice. Therefore, this example uses a mouse model to study the effect of siRNA-LNP / Gel in treating androgenic alopecia.

[0105] (1) 6-8 week old male C57BL / 6 mice were randomly divided into healthy group, model group, siRNA-LNP / GelA treatment group, siRNA-LNP / GelB treatment group, minoxidil treatment group, and finasteride treatment group. The hair on the back of the mice was removed with a depilatory cream, and the same designated area was marked with a marker. A 0.1% dihydrotestosterone solution was prepared with anhydrous ethanol. Except for the healthy group, 500 μL of 0.1% dihydrotestosterone was applied to the mice in the other groups with a cotton swab.

[0106] (2) Drug administration was performed on days 1, 4, 7, 10, 13, 16, and 19 after modeling. Except for the healthy group, mice in other groups were first smeared with 500 μL of 0.1% dihydrotestosterone on the marked designated area with a cotton swab. After 30 minutes, when the dihydrotestosterone was completely absorbed, drugs were administered in sequence according to the grouping. The siRNA-LNP / GelA group and the siRNA-LNP / GelB group were smeared with 500 μL of gel on the marked designated area with a cotton swab. The minoxidil group was smeared with 500 μL of 2% minoxidil ointment on the marked designated area with a cotton swab. The finasteride group was gavaged with 200 μL of finasteride solution (diluted to 1 mg / kg per mouse).

[0107] (3) Records were taken on days 1, 4, 7, 10, 13, 16, 19, and 22 after modeling. Before administration, the hair growth on the back of each mouse was photographed to record hair growth and coverage. Hair was randomly plucked from three locations on the back and the average hair length was recorded and calculated using a vernier caliper.

[0108] The experimental results showed that both siRNA-LNP / GelA and siRNA-LNP / GelB had a certain effect in promoting hair growth in mice. Specifically, the hair growth rate, hair length and hair coverage of mice were close to those of the healthy group, and the effects were better than those of the positive control drugs minoxidil and finasteride groups, and far higher than the model group.

[0109] According to the back photographs of mice every 3 days ( Figure 8 ) It can be seen that the siRNA-LNP / GelA treatment group grew obvious hair on the back as early as the 13th day, which was faster than the siRNA-LNP / GelB treatment group (16th day), the healthy group (16th day), the minoxidil group (16th day), the finasteride group (19th day) and the model group (19th day). The length of the new hair was measured and counted with a vernier caliper. The results showed that at the end of the experiment, the average hair length of the mice in the siRNA-LNP / GelA treatment group reached 10mm, and the average hair length of the mice in the siRNA-LNP / GelB treatment group was 9.5mm. Both groups were longer than the healthy group (8mm), the minoxidil group (7mm), the finasteride group (5.5mm) and the model group (4mm). According to the photographic records, the coverage rate of new hair at the end of the experiment was calculated. The results showed that the hair coverage rate of the siRNA-LNP / GelA treatment group reached 90%, and the hair coverage rate of the siRNA-LNP / GelB treatment group reached 92%, which was close to the healthy group (93%), and higher than the minoxidil group (82%), finasteride group (60%) and model group (36%). The coverage rate calculation formula is as follows:

[0110]

[0111] Therefore, siRNA-LNP / GelA and siRNA-LNP / GelB have certain advantages in treating androgenic alopecia, and are superior to positive drugs minoxidil and finasteride in promoting the speed, length and hair coverage of mouse hair growth, confirming that androgen receptor siRNA-LNP / Gel has the effect of inhibiting the stimulation of androgens on skin hair follicles and promoting hair growth.

[0112] Compared with siRNA-LNP / GelB, siRNA-LNP / GelA can increase the speed of hair regeneration in the hair loss area. On the 13th day, hair grew significantly on the back of the mice, while the siRNA-LNP / GelB treatment group did not grow until the 16th day; and at the end of the experiment, the average hair length of the mice in the siRNA-LNP / GelA treatment group was also greater than that in the siRNA-LNP / GelB treatment group. Although siRNA-B also has a good inhibitory effect on the androgen receptor gene in in vitro experiments, when it is prepared into siRNA-LNP / GelB and applied on the skin surface for treatment, the time required to promote hair regeneration in the hair loss area is significantly longer than siRNA-LNP / GelA. This shows that when applied on the skin surface of hair loss, siRNA-A can play a therapeutic role more quickly, shorten the time of hair regeneration in the hair loss area, and better promote hair growth.

[0113] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A siRNA for inhibiting androgen receptor expression, characterized in that: The siRNA comprises a sense strand and an antisense strand, the sense strand is shown as SEQ ID NO.1, and the antisense strand is shown as SEQ ID NO.

2.

2. A nanoformulation for inhibiting androgen receptor expression, characterized in that: The invention is composed of an agent for inhibiting androgen receptor expression encapsulated by lipid nanoparticles, wherein the agent for inhibiting androgen receptor expression comprises the siRNA as claimed in claim 1.

3. The nanoformulation according to claim 2, characterized in that The lipid nanoparticles are prepared from raw materials including DOTAP, lecithin and cholesterol.

4. The nanoformulation according to claim 3, characterized in that The mass ratio of DOTAP, lecithin and cholesterol is 5:(1-3):(2-4); preferably, the mass ratio of DOTAP, lecithin and cholesterol is 5:(1-2):(3-4); and / or, The mass ratio of the siRNA to DOTAP is 1:(8-15).

5. The method for preparing the nanoformulation according to any one of claims 2 to 4, characterized in that: The following steps are involved: (1) dissolving the raw material for preparing the lipid nanoparticles in a solvent to obtain an organic phase; (2) dissolving the siRNA in a solvent to obtain an aqueous phase; (3) stirring the aqueous phase and slowly dripping the organic phase into the aqueous phase while stirring.

6. The method for preparing the nanoformulation according to claim 5, characterized in that: The solvent in step (1) is anhydrous ethanol; and / or The solvent in step (2) is a 20 mM to 30 mM sodium acetate aqueous solution or a 20 mM to 30 mM sodium citrate aqueous solution.

7. Use of the siRNA according to claim 1 or the nanoformulation according to any one of claims 2 to 4 in the preparation of a drug for treating androgenic alopecia.

8. A drug for treating androgenic alopecia, characterized in that: The drug comprises an active ingredient and a pharmaceutically acceptable carrier; the active ingredient comprises the siRNA according to claim 1 and / or the nanoformulation according to any one of claims 2 to 4.

9. The drug according to claim 8, characterized in that The dosage form of the drug is a gel.

10. The drug according to claim 9, characterized in that The gel comprises the nano preparation and sodium hyaluronate.

Images