A recombinant expression vector for increasing protein expression and its application

Abstract

The present invention belongs to the field of biotechnology, and relates to a recombinant expression vector and its application for increasing protein expression. It comprises a CMV-CMV double promoter, and the CMV-CMV double promoter is composed of two CMV promoters with the same sequence connected in the same direction; wherein the CMV-CMV double promoter jointly starts the expression of downstream target gene, and the interval between the CMV-CMV double promoters is 0-60bp. The recombinant expression vector (promoter tandem shared expression frame) containing double CMV promoters prepared by the present invention increases the expression amount by 43% compared with the original vector (only one CMV promoter). In the case of promoter tandem shared expression frame, the interval between promoters has a certain effect on the expression amount. The present invention designs expression vectors with different intervals (between double CMV promoters), and finds that the expression amount peaks at the intervals of 0bp and 40bp of the tandem promoters, and the activation efficiency is the highest. It provides a direction for further transfection and domestication to obtain recombinant cells with high expression of target proteins.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to a recombinant expression vector for improving protein expression and application thereof. Background Art

[0002] With the development of genetic engineering technology, the number and types of recombinant proteins produced by genetic engineering are constantly increasing, and have become an important part of the pharmaceutical industry. The expression systems of recombinant drug proteins mainly include prokaryotic systems such as E. coli, and eukaryotic systems such as yeast, mammalian cell 293, CHO cells, etc. E. coli is suitable for expressing proteins with small molecular weight and relatively simple structure, while the yeast expression system is suitable for expressing proteins with large molecular weight, complex structure and less glycosylation. Structural or glycosylation modification is very important for the activity of human therapeutic proteins. Therefore, industrial research and development and production often use mammalian cells 293, CHO cells, etc.

[0003] There are two types of recombinant protein expression: transient expression and stable expression. In the transient expression state, the exogenous gene introduced into the cell does not integrate with the host cell chromosome DNA, and the target protein can be obtained in a short time. It also has the advantages of strong versatility. In the early stage of research and development, time is a key factor. Although the protein expression level obtained by stable transfection is high, the construction cycle is long and the cost is high, so it is not suitable. However, in transient expression, since the exogenous genes in the cells will be lost as the cells divide, the expression of the target protein can only be maintained for a few days to more than ten days, and there is a disadvantage of low expression. So how to increase the expression level of transient transfection and obtain more recombinant proteins for efficacy and formulation research in the shortest time and at the lowest cost has become an urgent problem to be solved.

[0004] At present, there are two main methods to improve the transient expression of humanized cell recombinant cells. One is to optimize the cell growth environment and transfection conditions, including 1. Select cells in the appropriate state, such as density, viability, generation, etc. 2. Appropriate DNA concentration and transfection reagent concentration. 3. Adjust the culture medium reagent formula, etc. However, the above conventional methods have defects such as instability and low repeatability. Another method is to improve the expression of the target protein by improving and optimizing the expression system, such as 1. Optimizing the host cell line, reducing cell apoptosis, and cell rejection of exogenous proteins. 2. Optimizing the expression system, such as setting up an episome maintenance system, a strong promoter / enhancer, and a protein transactivation system in the plasmid, but how all these elements should be combined and integrated into the expression vector to form a stable expression system is still a technical problem that needs to be solved.

[0005] The components of an effective mammalian cell expression vector include promoter, enhancer, polyA sequence, selection marker, replication origin, target gene and enhancer. Promoter is an important regulatory element of gene expression. It is a DNA regulatory sequence that can be specifically recognized and bound by RNA polymerase and can correctly and effectively initiate transcription. It is generally located in the 5′ upstream region of the target gene. Commonly used promoters for producing mammalian cell recombinant proteins include human cytomegalovirus early promoter (CMV) and simian vacuolating virus early promoter (SV40). Among them, CMV promoter is often used in the construction of mammalian cell recombinant protein expression vectors, but it is susceptible to epigenetic silencing, resulting in the expression level gradually decaying as the cell culture time increases. Summary of the invention

[0006] At present, little is known about the predictability and combinability of promoters in different genetic backgrounds. Generally speaking, if there are two promoters in the same direction upstream of a target gene, the promoter closer to the ATG of the expressed gene generally works. However, sometimes the expression amount will change when the two promoters have antagonistic or synergistic effects. Existing studies have shown that different numbers of promoters in series lead to increased activity. However, so far, there has been no research on the expression effect of the dual promoter CMV under different combinations. Therefore, this is also a direction for vector promoter modification. The purpose of the present invention is to modify the dual CMV promoter to enhance the expression of exogenous genes.

[0007] In order to achieve the above object, the present invention designs and discloses the following technical solutions:

[0008] The first aspect of the present invention discloses a recombinant expression vector for increasing protein expression, comprising a CMV-CMV double promoter, wherein the CMV-CMV double promoter is composed of two CMV promoters with the same sequence connected in the same direction;

[0009] The CMV-CMV dual promoters jointly promote the expression of downstream target genes, and the interval between the CMV-CMV dual promoters is 0-60bp.

[0010] Preferably, the interval between the CMV-CMV dual promoters is preferably 0 or 40 bp.

[0011] Wherein, the recombinant expression vector contains the following elements:

[0012] Origin of replication, prokaryotic selection marker, eukaryotic selection marker, transcription promoter, transcription termination signal, multiple cloning site for inserting foreign genes, CMV-CMV dual promoter and polyA tailing signal derived from SV40.

[0013] The multiple cloning site for inserting foreign genes includes Pac I, Xba I and Not I sites.

[0014] The eukaryotic selection marker gene is a glutamine synthetase gene.

[0015] The second aspect of the present invention discloses the use of the above-mentioned recombinant expression vector for increasing protein expression in the preparation of a recombinant plasmid. The recombinant plasmid also includes a target gene.

[0016] The third aspect of the present invention discloses the use of the above-mentioned recombinant expression vector for increasing protein expression or the above-mentioned plasmid in preparing a recombinant cell line.

[0017] Preferably, the recombinant cell line highly expresses the protein of the target gene.

[0018] Compared with the prior art, the present invention has the following advantages:

[0019] Compared with the original vector (containing only one CMV promoter), the recombinant expression vector containing double CMV promoters (promoters in tandem sharing the expression frame) prepared by the present invention has an expression amount increased by 43%.

[0020] In the case of promoters in series sharing the same expression frame, the spacing between promoters has a certain influence on the expression amount. The present invention designs expression vectors with different spacings (between two CMV promoters) and finds that the expression amount peaks at 0 bp and 40 bp between the tandem promoters, and the promoter efficiency is the highest. This provides a direction for further transfection and domestication to obtain recombinant cells with high expression of target proteins. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the existing methods and experiments, the following is a brief introduction to the drawings required for use in the embodiments. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without paying creative work.

[0022] Figure 1 This is a schematic diagram of the construction of the basic vector mEGFP-CMV-V02 in Example 1.

[0023] Figure 2 This is a schematic diagram of the construction of the destination vector aV02-CMV-CMV in Example 1.

[0024] Figure 3 This is a schematic diagram of the construction of the destination vector bV02-CMV-CMV in Example 1.

[0025] Figure 4This is a schematic diagram of the construction of the destination vector cV02-CMV-CMV in Example 1.

[0026] Figure 5 This is the colony PCR identification diagram of the plasmid constructed in Example 1.

[0027] Figure 6 This is the colony PCR identification diagram of the plasmid constructed in Example 2.

[0028] Figure 7 This is a schematic diagram of the construction of the destination vector V02-CMV-042-CMV-042 in Example 2.

[0029] Figure 8 This is a schematic diagram of the construction of the destination vector V02-CMV-CMV-042 in Example 2.

[0030] Fig. 9 This is a schematic diagram of the expression level of the target protein at different intervals of the double CMV promoter in the plasmid V02-CMV-CMV-042-20 constructed in Example 3. DETAILED DESCRIPTION

[0031] The technical scheme of the present invention is described in detail below in conjunction with the accompanying drawings and embodiments, but the present invention is not limited to the scope of the embodiments. The experimental methods and techniques in the following embodiments without specifying specific conditions are usually carried out according to conventional conditions in the field or according to the conditions recommended by the manufacturer.

[0032] Example 1

[0033] First, we explored the connection direction and composition of the dual promoter. We explored three options as follows:

[0034] The two promoters are connected in tandem in the same direction to jointly initiate the expression of downstream genes: the interval between the aV02-CMV-CMV promoters is 80 bp.

[0035] The two promoters initiate gene expression separately, and the expression frames have the same orientation: the terminator of the first expression frame of bV02-CMV-CMV is 673 bp away from the next CMV promoter.

[0036] The two promoters respectively start gene expression, and the expression frames are in opposite directions: the distance between the cV02-CMV-CMV reverse promoters is 501bp. Figure 1-4 As shown, the specific construction process is as follows:

[0037] (1) Basic vector mEGFP-CMV-V02

[0038] The basic vector mEGFP-CMV-V02 was constructed, and the corresponding primers for introducing restriction sites were designed (Table 1). After PCR (Table 2), EFGP-HindIII-EcoRI and OPM-V02 were double-digested with restriction endonucleases HindIII and EcoRI (Table 3). After recovery, enzyme ligation was performed (Table 4) to obtain the basic vector ( Figure 1 )

[0039] Table 1 Primer information for constructing basic vector

[0040]

[0041] Table 2 PCR system and procedure

[0042]

[0043] Table 3 OPM-V02 double enzyme digestion system

[0044]

[0045] Table 4 Enzyme-linked system

[0046]

[0047] (2) Construction of target vectors aV02-CMV-CMV, bV02-CMV-CMV, and cV02-CMV-CMV

[0048] Construct the target vectors aV02-CMV-CMV, bV02-CMV-CMV, cV02-CMV-CMV, such as Figure 2-4 As shown, the corresponding primers for introducing restriction sites were designed (Table 5), and the amplified fragments were double-digested with restriction endonucleases corresponding to the amplified fragments after PCR (Table 6) (Table 7), and then enzyme ligation (Table 8) was performed after recovery and then transformation and plating, and colony PCR identification was performed ( Figure 5 ), select positive clones and send them for sequencing identification. Run the plasmid gel to identify and obtain the target vector.

[0049] Table 5 Primer information for constructing the target vector

[0050]

[0051] Table 6 PCR system and procedure

[0052]

[0053] Table 7 Double enzyme digestion system

[0054]

[0055] Table 8 Enzyme-linked system

[0056]

[0057] Enzyme-linked product conversion identification

[0058] After transformation into DH5α competent cells, culture on the plate for 12 - 16 h. Pick several clones on the plate for colony PCR identification ( Figure 5 ), if the clone is correct, a band of the corresponding fragment length should appear, and the positive clone colonies should be selected for sequencing identification. See Table 9 for colony PCR primers and sequencing primers.

[0059] Figure 5 Among the sequences 1-8: aV02-CMV-CMV (2150 bp), 5 was selected for testing, and finally 5 was selected;

[0060] No. 9-16: bV02-CMV-CMV (1161bp) selected 12, 14, and 15 for testing, and finally selected No. 14;

[0061] No. 17-32: cV02-CMV-CMV (1841bp) 30 and 32 were selected for testing, and finally No. 32 was selected;

[0062] M: 250bp DNA Ladder

[0063] Table 9 Sequencing primers

[0064] Primer name sequence EGFP-F TCCGCCATGCCCGAAGGCTA (SEQ ID NO: 17) EGFP-R GTACTCCAGCTTGTGCCCCA (SEQ ID NO: 18) a-CX-F TTGGCTATTGGCCATTGCAT (SEQ ID NO: 19) a-CX-R CTGCTCGCCTACCGCCAGCA (SEQ ID NO: 20) b-CX-F CGCCGATAGAGATGGCGATA (SEQ ID NO: 21) A-CMV-XbaI-R ACTAAACGTCTAGAAGCTCTGCTTATATAGACCTCC (SEQ ID NO: 22) OPM-F CCACCAGACATAATAGCTGA (SEQ ID NO: 23) OPM-R2 CTGCAGGTCGCGGCCGCCAGACATG (SEQ ID NO: 24)

[0065] Fluorescence expression detection

[0066] 1. Flow cytometry detection of GFP (model BD Cytoflex)

[0067] 1E6 cells were placed in a 1.5 mL EP tube and resuspended in 500 uL PBS. The total number of live cells and GFP-positive cells were measured using a flow cytometer, and the GFP-positive rate was calculated, which was the transfection efficiency.

[0068] 2. Read the GFP fluorescence value with an enzyme-labeled instrument (Electrode Labeled Instrument M5 Molecular Devices Spectramax M5)

[0069] step:

[0070] Collect the cell supernatant by centrifugation, add 180uL PBS to a black opaque 96-well plate, then take 20uL of cell supernatant and add it to the plate, mix well and wait for testing. Open the microplate reader control software, set the measurement mode to fluorescence intensity measurement, the excitation wavelength is 405nm, and the absorption wavelength is 488nm. Select the detection area corresponding to the plate. Run the reading and save the result. According to the fluorescence intensity value of the sample * the dilution multiple, calculate the actual fluorescence intensity value of the final sample, which is the fluorescence expression.

[0071] Table 10: Fluorescence expression detection results and calculation of transfection efficiency and expression level

[0072] Transfection efficiency Fluorescence expression Single cell expression level (fluorescence expression level / transfection efficiency) / Control aV02-CMV-CMV 36.12 9.83E+04 2721 1.9% bV02-CMV-CMV 32.23 1.00E+05 3102 16% cV02-CMV-CMV 30.34 6.80E+04 2241 -16% V02-CMV (control) 41.21 1.10E+05 2669

[0073] in conclusion

[0074] The type B promoter connection mode (two promoters initiate gene expression separately, and the expression frames have the same direction) has the highest activation efficiency and increases the expression level by 16%.

[0075] The a-type promoter connection mode (two promoters connected in series in the same direction to jointly initiate the expression of downstream genes, with an interval of 80bp between the promoters) had no obvious effect on the expression level.

[0076] The C-type promoter connection mode (two promoters start gene expression separately, and the expression frames are in opposite directions. The distance between the reverse promoters is 501bp) has no effect of enhancing expression.

[0077] Example 2

[0078] Based on the results of different combinations of dual promoters, the present invention further explored and compared the effects of tandem promoters on expression. At the same time, before the promoters were connected to exogenous proteins, the promoter efficiency was compared by detecting the protein expression.

[0079] Experimental methods Vector construction

[0080] (1) Construction of basic vector V02-42

[0081] Construct the basic vector V02-42, design the corresponding primers for introducing restriction sites (Table 11), and double-digest 42-HindIII-EcoRI and OPM-V02 with restriction endonucleases HindIII and EcoRI after PCR (Table 12) (Table 13). After recovery, perform enzyme ligation (Table 14) to obtain the basic vector.

[0082] Table 11 Primer information for constructing basic vector

[0083]

[0084] Table 12 PCR system and procedure

[0085]

[0086] Table 13 OPM-V02 double enzyme digestion system

[0087]

[0088] Table 14 Enzyme-linked system

[0089]

[0090] (2) Construction of the destination vector V02-CMV-042-CMV-042 ( Figure 7 )、V02-CMV-CMV-042( Figure 8 )

[0091] Construct the target vectors V02-CMV-CMV-42 and V02-CMV-42-CMV-42, design the corresponding primers for introducing restriction sites (Table 15), and then double-digest the amplified fragments with restriction endonucleases corresponding to the amplified fragments after PCR (Table 16) (Table 17). After recovery, perform enzyme ligation (Table 18), transform the plates, and perform colony PCR identification ( Figure 6 ), select positive clones and send them for sequencing identification. Run the plasmid gel to identify and obtain the target vector.

[0092] Table 15 Primer information for constructing the target vector

[0093]

[0094] Table 16 PCR system and procedure

[0095]

[0096] Table 17 Double enzyme digestion system

[0097]

[0098] Table 18 Enzyme-linked system

[0099]

[0100] Enzyme-linked product conversion identification

[0101] After transformation into DH5α competent cells, culture for 12-16 h. Pick several clones on the recombination reaction transformation plate for colony PCR identification ( Figure 6 ), if the clone is correct, a band of the corresponding fragment length should appear, and the positive clone colonies should be selected for sequencing identification. See Table 19 for colony PCR primers and sequencing primers.

[0102] Figure 6 Middle: Sequence No. 1-8: 42-CMV-CMV-V02 (1512bp), select 6, 7, 8 for testing, and select No. 7;

[0103] 9-16: 42-CMV-42-CMV-V02 (1512bp), select 10, 15, and 16 for testing, and select 10;

[0104] M: 250bp DNA Ladder.

[0105] Table 19 Sequencing primers

[0106] Primer name sequence OPM-F CCACCAGACATAATAGCTGA (SEQ ID NO: 35) OPM-R2 CTGCAGGTCGCGGCCGCCAGACATG (SEQ ID NO: 36) CMV sequencing—R TCTATGGAGGTCAAAACAGC (SEQ ID NO: 37) 2CMV Sequencing-R AATAACTAGTCAATAATCAATGTCTCTAGA (SEQ ID NO: 38)

[0107] The results of transient expression detection are as follows Day 6 (42 is the number of the exogenous protein, the protein has an Fc tag, and Cdex is used for quantification).

[0108] Table 20

[0109] Plasmid name Vector Description Transient expression measured IgG (mg / L) V02-42 OPM original vector, CMV promoter is followed by the target gene 042 protein expression sequence, and a stop codon is added to the end of the expression sequence 332 V02-CMV-CMV-42 A CMV promoter was inserted before the CMV promoter of the V02-42 plasmid, and the two promoters were separated by 38 bp. The expression of the target gene 042 was regulated by the two promoters at the same time. 461 V02-CMV-42-CMV-42 A CMV promoter and target gene 042 are inserted before the V02-42 plasmid CMV, and a stop codon is placed after the target gene. The two regulatory units are separated by 32 bp. The expression of target gene 042 is regulated by two promoters respectively. 418

[0110] Example 3 Comparison of the effects of the spacing between tandem promoters on expression levels.

[0111] The following new plasmids were designed and constructed based on the original plasmid V02-CMV-CMV-42:

[0112] V02-CMV-CMV-042-20

[0113] The two CMV promoter spacer sequences are 20 bp, and the sequence is: CGTTGTATCCATATCATAAT (SEQ ID NO: 39).

[0114] V02-CMV-CMV-042-40

[0115] Two CMV promoter spacer sequences of 40 bp, the sequence is:

[0116] TCTAGAGCCATTGCATACGTTGTATCCATATCATAATATG (SEQ ID NO: 40).

[0117] V02-CMV-CMV-042-60

[0118] Two CMV promoter spacer sequences of 60 bp, the sequence is:

[0119] TCTAGAGCCATTGCATACGTTGTATCCATATCATAATATGTACATTTATATTGGCTCATG (SEQ ID NO: 41).

[0120] V02-CMV-CMV-042-80

[0121] Two CMV promoter spacer sequences of 80 bp, the sequence is:

[0122] TCTAGAGCATTGCATACGTTGTATCCATATCATAATATGTACATTTATATTGGCTCATGTCCAACATTACCGCCATGTT (SEQ ID NO: 42).

[0123] The above plasmids were constructed and sequenced by a gene synthesis company.

[0124] After verification, transient transfection was performed and the expression level was detected using Cdex (Day 6). The transfection and testing methods were the same as before.

[0125] Table 21

[0126] Plasmid name Vector Description Transient expression measured IgG (mg / L) V02-42 OPM original vector, a CMV promoter, a PARTII source plasmid 332 V02-CMV-CMV-042 Two CMV promoter spacer sequences of 38 bp, from the PARTII source plasmid 461 V02-CMV-CMV-042-0 Two CMV promoter spacer sequences 0 bp 472 V02-CMV-CMV-042-20 Two CMV promoter spacer sequences 20 bp 459 V02-CMV-CMV-042-40 Two CMV promoter spacer sequences 40 bp 472 V02-CMV-CMV-042-60 Two CMV promoter spacer sequences 60 bp 465 V02-CMV-CMV-042-80 Two CMV promoter spacer sequences 80 bp 423

[0127] Conclusion and Significance

[0128] 1. V02-CMV-CMV-42 (promoter tandem shared expression frame), compared with the original vector V02-42 (only one CMV promoter), the expression level increased by 43%.

[0129] The expression level of V02-CMV-42-CMV-42 (promoter independently initiates expression, with independent expression frames) and the original vector V02-42 (only one CMV promoter) increased by 25.9%. The data is consistent with the PARTI b-type promoter (expression level increased by 16%). Therefore, promoters in tandem with a shared expression frame have greater application advantages.

[0130] 2. When promoters are tandem and share a common expression frame, the spacing between promoters has a certain effect on the expression level. The expression level peaks when the spacing between tandem promoters is 0 bp and 40 bp ( Fig. 9 ), with the highest promoter efficiency. The expression level gradually decreased with the increase of the interval. The 80bp interval sequence of the two CMV promoters has been reduced to the expression level close to that of V02-CMV-42-CMV-42 (promoter independently promotes expression and has an independent expression frame). However, it is still higher than the original vector. The difference in data with the PARTI a type promoter (expression level increased by 1.9%) may be due to the relatively low sensitivity of fluorescence expression detection.

[0131] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A recombinant expression vector for increasing protein expression, characterized in that: It comprises a CMV-CMV double promoter, wherein the CMV-CMV double promoter is composed of two CMV promoters with the same sequence connected in the same direction; The CMV-CMV dual promoter jointly initiates the expression of downstream target genes. The interval between the CMV-CMV double promoter is 40 bp.

2. The recombinant expression vector for increasing protein expression according to claim 1, characterized in that: The recombinant expression vector contains the following elements: Origin of replication, prokaryotic selection marker, eukaryotic selection marker, transcription promoter, transcription termination signal, multiple cloning site for inserting foreign genes, CMV-CMV dual promoter and polyA tailing signal derived from SV40.

3. The recombinant expression vector for increasing protein expression according to claim 2, characterized in that: The multiple cloning site for inserting foreign genes includes Pac I, Xba I and Not I sites.

4. The recombinant expression vector for increasing protein expression according to claim 2, characterized in that: The eukaryotic selection marker gene is a glutamine synthetase gene.

5. Use of the recombinant expression vector for increasing protein expression according to any one of claims 1 to 4 in preparing a recombinant plasmid.

6. The use according to claim 5, characterized in that: The recombinant plasmid also includes the target gene.

7. Use of the recombinant expression vector for increasing protein expression according to any one of claims 1 to 4 in preparing a recombinant cell line.

8. The use according to claim 7, characterized in that: The recombinant cell line highly expresses the protein of the target gene.

Images