Vector for overexpressing UCP2 gene and application thereof

Abstract

The invention discloses a vector for overexpressing a UCP2 gene and application thereof, and relates to the technical field of biological medicines.The gene capable of protecting RPE cell mitochondria is screened out, and the gene is supplemented through adenovirus treatment, so that death of RPE cells can be effectively prevented, occurrence and progress of dry AMD are inhibited, and the application of the UCP2 gene is promoted. The invention provides a new target and a treatment strategy for the treatment of dry AMD, and has a good clinical application prospect.

Description

Technical Field

[0001] The present invention relates to the technical field of biomedicine, and in particular to a vector for overexpressing a UCP2 gene and an application thereof. Background Art

[0002] Age-related macular degeneration (AMD) is a common eye disease that mainly affects the elderly. AMD causes the macula in the center of the retina to degenerate, which affects central vision. AMD is usually divided into two types: dry and wet. Dry AMD is the most common form, with a slower course, characterized by the degeneration of macular cells and atrophy of the pigment epithelium. There is currently a lack of treatment drugs and methods.

[0003] Retinal pigment epithelium (RPE) cells play an important role in the health and function of the eye, especially in the occurrence and development of AMD, the degeneration of RPE cells is a key factor. Among them, mitochondrial imbalance and damage are particularly important in RPE cell degeneration, which has a profound impact on the occurrence and progression of AMD. RPE cells are highly dependent on mitochondria to maintain their energy metabolism and a variety of key functions. After mitochondrial damage, RPE cell function is weakened, leading to the formation of subretinal deposits (such as retinal macular deposits), hindering the exchange of nutrients, accelerating the death of RPE cells and atrophy of the macular area. Therefore, protecting mitochondrial function and reducing mitochondrial damage have become important research directions for the treatment of AMD, and the development of new therapies that protect mitochondria has good clinical application prospects in the treatment of dry AMD.

[0004] UCP2 (Uncoupling Protein 2) is a protein of the inner membrane of mitochondria with a molecular weight of approximately 33.4 dDa. UCP2 plays an important role in energy metabolism, glucose and lipid metabolism, neuroprotection, and immune regulation, but its role in dry AMD is still unclear. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide a vector for overexpressing the UCP2 gene and its use in preparing a drug for preventing and / or treating dry AMD, thereby providing a new target and treatment strategy for the treatment of dry AMD.

[0006] The technical problem to be solved by the present invention is achieved by adopting the following technical solutions:

[0007] The first object of the present invention is to provide a vector for overexpressing the UCP2 gene, comprising at least one of the sequences shown in SEQ ID NO.1 and SEQ ID NO.2.

[0008] Furthermore, the vector is a viral vector or a plasmid vector. Furthermore, the viral vector is an adenoviral vector.

[0009] The second object of the present invention is to provide use of the vector for overexpressing the UCP2 gene in the preparation of a drug for preventing and / or treating dry AMD.

[0010] The third object of the present invention is to provide a pharmaceutical composition for preventing and / or treating dry AMD, comprising the vector for overexpressing the UCP2 gene.

[0011] Furthermore, the vector is a viral vector or a plasmid vector. Furthermore, the viral vector is an adenoviral vector.

[0012] The fourth object of the present invention is to provide a pharmaceutical preparation for preventing and / or treating dry AMD, comprising the vector for overexpressing the UCP2 gene.

[0013] Furthermore, the pharmaceutical preparation is an oral preparation, an injectable preparation or an ophthalmic preparation.

[0014] Furthermore, the ophthalmic preparation is eye drops, eye ointment, eye spray, eye gel, eye patch, intraocular injection, eye microspheres, eye implants, periocular injection or ophthalmic sustained-release preparation.

[0015] The beneficial effect of the present invention is that the present invention screens out a gene that can protect the mitochondria of RPE cells, and by using adenovirus therapy to supplement the gene, the death of RPE cells can be effectively prevented, thereby inhibiting the occurrence and progression of dry AMD, providing a new target and treatment strategy for the treatment of dry AMD, and having good clinical application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 To discover the key mitochondrial genes in the occurrence of dry AMD through joint analysis and screening; among them, Figure 1 A represents five candidate target genes screened by combined analysis of AMD patient transcriptome data, RPE cell injury transcriptome data, and mitochondrial gene library; Figure 1 B shows the expression of the five genes screened in AMD patients and RPE cell damage; Figure 1 C is the expression of UCP2 and PTCD1 detected in RPE cell injury by qRT-PCR; Figure 1D is the expression of UCP2 and internal reference protein α-Tubulin after RPE cell injury verified by Western blot;

[0017] Figure 2 To verify the role of UCP2 in RPE injury using an in vitro cell model; A is the expression of UCP2 detected by WB after overexpression of UCP2; B is the result of increased RPE cell activity after overexpression of UCP2;

[0018] Figure 3 The effect of UCP2 overexpression adenovirus on restoring fundus structure and retinal function in dry AMD model; A is the fundus observation of mouse model, OCT results show retinal thickness; B is the measurement of retinal thickness of each group of mice; C is the electroretinogram (ERG) detection of visual electrophysiological changes in mice; D is the quantification and comparison of a and b wave amplitudes of each group of mice. *p<0.05, **p<0.01, ***p<0.001. DETAILED DESCRIPTION

[0019] In order to make the technical means, creative features, objectives and effects achieved by the present invention easy to understand, the present invention is further described below in conjunction with specific embodiments and diagrams.

[0020] 1. NaIO3-induced RPE cell model: ARPE-19 cells (ARPE-19 cells are a human retinal pigment epithelial cell line that is widely used to study the pathogenesis of retinal diseases) were inoculated into a cell culture dish and pre-cultured in an incubator at 37°C and 5% CO2 for 24 hours to allow the cells to adhere to the wall and recover. A certain concentration of NaIO3 was added according to the experimental requirements and incubated for 24 hours before conducting subsequent experiments.

[0021] 2. RNA extraction: 6Add 1mL TRIZOL reagent to each cell. For cell samples, gently pipette the cell mixture to ensure that the cells are fully lysed. Incubate the lysed sample at room temperature for 5 minutes to ensure that the cells are completely lysed. Centrifuge at 12000rpm for 15 minutes at 4℃. Carefully transfer the upper aqueous phase to a new centrifuge tube, avoiding touching the middle layer and organic layer. Add an equal amount of isopropanol to the aqueous phase. Mix gently and incubate at room temperature for 10 minutes to promote RNA precipitation. Centrifuge at 12000rpm for 10 minutes at 4℃ to precipitate RNA. Carefully aspirate the supernatant and retain the RNA precipitate. Add 1mL cold 75% ethanol and mix gently to wash the RNA precipitate. Centrifuge at 7500rpm for 5 minutes at 4℃. Aspirate the ethanol and try to absorb the remaining ethanol. Avoid exposing the RNA precipitate to air for too long to prevent RNA degradation. Air-dry the RNA precipitate at room temperature for 5-10 minutes until the ethanol is completely evaporated, add 20-50μL RNase-free water, and gently pipette to mix to fully dissolve the RNA. Store at -80℃ until used.

[0022] 3. RNA reverse transcription:

[0023] 1) Measure the RNA concentration using a UV spectrophotometer and perform reverse transcription based on 500 ng to 1 μg of total RNA.

[0024] 2) Add an appropriate amount of primers (usually 0.5 μg Oligo(dT) or 1 μL random primers) according to the instructions, add a dNTP mixture with a final concentration of 0.5 mM, and make up to 10 μL with RNase-free water.

[0025] 3) Primer annealing: Incubate the mixture at 65°C for 5 minutes to allow the primers to bind to the RNA template. Immediately after incubation, place the centrifuge tube on ice to cool the primers to stably bind to the RNA.

[0026] 4) Prepare the reverse transcription reaction system: Add the following components to the annealed mixture:

[0027] Reagents Volume(uL) RNA samples 10 5× reaction buffer 4 RNase inhibitors 1 Reverse transcriptase 1 RNase-free water 4 Final volume 20

[0028] 5) Reverse transcription reaction

[0029] The mixture is subjected to reverse transcription reaction at an appropriate temperature. The typical steps are as follows:

[0030] Incubate at 42°C for 1 hour to synthesize cDNA. Terminate the reverse transcription reaction and inactivate the reverse transcriptase by heating to 70°C for 10 minutes. Store cDNA at -20°C until use and dilute 10-fold.

[0031] 6) qRT-PCR reaction

[0032] The base sequence used for qRT-PCR detection of UCP2 is as follows:

[0033] Forward Primer F: CTGTGCTGAGCTGGTGACCTATG

[0034] Reverse Primer R: AGGCAGAAGTGAAGTGGCAAGG

[0035] PCR reaction system

[0036] Reagents Volume(uL) 2XSYBR reaction buffer 5 cDNA 3 Primer (F+R) 2 Final volume 10

[0037] Reaction conditions: 95°C / 10 min, 95°C / 30 s, 60°C / 30 s, 72°C / 30 s, 40 cycles; 72°C / 10 min.

[0038] After the reaction is completed, the gene expression level is calculated according to the formula: 2 -ΔΔCt , where ΔΔCt = (average Ct value of the target gene in the experimental group - average Ct value of the reference gene GAPDH in the experimental group) - (average Ct value of the target gene in the control group - average Ct value of the reference gene GAPDH in the control group).

[0039] 7) Western Blot experiment

[0040] (1) Sample preparation: Lyse cells with RIPA lysis buffer, extract proteins, and quantify protein concentration using the BCA method to ensure that the amount of protein loaded into the gel is consistent.

[0041] (2) SDS-PAGE electrophoresis: Usually 10% polyacrylamide gel is used. The protein sample is mixed with the loading buffer, heated and denatured, and then loaded into the lane of the gel at a constant voltage of 100 V for 60 min.

[0042] (3) Transfer: The separated proteins were transferred from the gel to the PVDF membrane using the wet transfer method at a current of 200 mA for 100 min.

[0043] (4) Blocking: Soak the membrane in blocking solution (5% skimmed milk powder) and incubate at room temperature for 1 h.

[0044] (5) Antibody incubation: Incubate the membrane with the primary antibody specific for the target protein (UCP2 Antibody: Abclonal, A4178; α-Tubulin antibody: CST, 2144) at 4°C overnight. Wash the membrane: Wash the membrane three times with TBST, 5 min each time. Secondary antibody incubation: Add the secondary antibody (Abclonal, A4178) that binds to the primary antibody and incubate at room temperature for 1 h. Wash the membrane three times with TBST, 5 min each time.

[0045] (6) Development and detection: Add chemiluminescent substrate (ECL) to the membrane and use a chemiluminescent imaging system to capture the luminescent signal and display the target protein band.

[0046] 8) CCK-8 (Cell Counting Kit-8) detection

[0047] (1) Cells were evenly inoculated into a 96-well plate, with 3,000 to 5,000 cells per well in a volume of 100 μL, and then pre-cultured in an incubator at 37° C. and 5% CO 2 for 24 h to allow the cells to adhere and recover.

[0048] (2) Add different concentrations of NaIO3 (5 mM, 10 mM) and continue culturing in an incubator at 37°C and 5% CO2 for 24 h.

[0049] (3) Add 10 μL of CCK-8 reagent (MCE, HY-K0301) to each well and continue incubating in a 37°C, 5% CO2 incubator for 1 to 2 hours.

[0050] (4) After incubation, use a microplate reader to measure the absorbance (OD value) of each well at a wavelength of 450 nm.

[0051] 9) Construction of animal models

[0052] Six-week-old wild-type male mice were selected and divided into a normal control group and a NaIO3-treated group. The experimental mice were treated with a single intraperitoneal injection of NaIO3 at a dose of 25 or 50 mg / kg, and the control group was injected with an equal amount of normal saline. Two weeks after the injection, the changes in the fundus images and ERG of the mice were observed.

[0053] 10) Fundus color photography

[0054] (1) Anesthesia: The mice were weighed and anesthetized by intraperitoneal injection of 45 mg / kg sodium pentobarbital.

[0055] (2) Mydriasis: Instill 1% tropicamide eye drops to dilate the pupil.

[0056] (3) Observation and photography: Place the mouse on a platform and use the Micron III fundus imaging system to observe and take color fundus photographs and fundus fluorescence photographs. The filter used by Micron III for taking color fundus photographs is between 450nm and 680nm; the blue light excitation filter used for taking autofluorescence photographs is between 440nm and 485nm. After the photography is completed, place the mouse on a 37℃ constant temperature pad to recover.

[0057] 11) Electroretinogram (ERG) test

[0058] Prepare a flash stimulator, amplifier and animal test platform. Use dim red light for illumination in a dark room. The mouse is deeply anesthetized by intraperitoneal injection, then fixed and mydriasis is performed. Fix the mouse in front of the animal test platform, with both eyes at the same height and fully exposed. Connect the electrodes to the mouse's tail and neck skin. Adjust the angle of the gold ring electrode so that it lightly touches the top center of the cornea. Connect the positive electrode of channel one to the right eye, and the positive electrode of channel two to the left eye. Ensure that the two gold ring electrodes contact the same position of the positive end of the center of the cornea of ​​both eyes at the same angle and in the same way. Push the mouse into the flash stimulation ball together with the animal test platform. The mouse's eyes should be fully exposed to the flash stimulation ball, and start the program to record data.

[0059] 12) Construction of AAV virus

[0060] (1) Culture 293T cells in a 10 cm dish for virus packaging. Fresh cell culture medium should be replaced 4 h before plasmid transfection.

[0061] (2) When the cell confluence was 70-90%, the transfection plasmids pAAV2-UCP2, pAAV-RC, and pHelper were mixed and mixed with 500 μL serum-free opti-MEM medium and then allowed to stand for 5 min.

[0062] (3) Mix the transfection reagent with 500 μL serum-free opti-MEM medium and let it stand for 5 min.

[0063] (4) Gently add the transfection reagent mixture dropwise into the DNA mixture, let it stand for a few seconds, then gently mix it and let it stand at room temperature for 15 minutes.

[0064] (5) Add the mixture dropwise into the cell culture dish and mix gently. Replace with fresh cell culture medium after 6 hours. When the cell culture medium turns yellow, replace the medium and collect the supernatant. 72 hours after transfection, use 600 μL PBS to gently blow off the adherent cells in the dish and store them in a -80°C refrigerator to purify and concentrate the virus.

[0065] 13) Intraocular injection of AAV virus

[0066] Grouping: control group, NaIO3+AAV-NC group, NaIO3+AAV-UCP2 group. The mice were intraperitoneally injected with anesthetics, and the eyes were anesthetized and the pupils were dilated. After 5 minutes, the anesthetized mice were placed on their side under the microscope with their eyes facing up and their heads placed on gauze to keep the corneal limbus horizontal for microscopic observation. A 30G needle was used to slowly inject into the subretinal area through the corneoscleral limbus (AAV 5.7×10 8vg). After the injection, antibiotic eye drops and antibiotic eye ointment were applied to the mouse's eyes to prevent infection. The mouse was placed on a 37°C heating pad to recover.

[0067] 14) SPSS 21.0 software was used for statistical analysis. One-way analysis of variance was performed for independent samples. Analysis of variance was used to compare the three groups of data. Homogeneity of variance was also analyzed. *p<0.05, **p<0.01, ***p<0.001 were considered statistically significant.

[0068] Example 1

[0069] This example relates to the expression of UCP2 gene in eyeball tissues and ARPE-19 cells of AMD patients.

[0070] Two transcriptome sequencing datasets of AMD patients (GSE29801 and GSE135092) were downloaded from the GEO (GENE EXPRESSION OMNIBUS) database for bioinformatics analysis. Among them, the GSE29801 dataset includes 96 healthy controls and 67 AMD patients. GSE135092 includes 217 healthy controls and 49 AMD samples. ARPE-19 cells were treated with 10mMNaIO3-induced damage for 24 hours before RNA sequencing analysis. The threshold for differential gene screening was Fold Change>1.2 and p<0.05. qPCR and WB were used for verification.

[0071] from Figure 1 It can be seen that after screening, only the mitochondrial gene UCP2 was significantly downregulated in AMD patients and during ARPE-19 cell damage.

[0072] Example 2

[0073] This example involves detecting the effect of overexpressing UCP2 on the cell activity of RPE cells.

[0074] The UCP2 plasmid was transfected into ARPE-19 cells, and the overexpression of UCP2 was observed by CCK-8 experiment.

[0075] from Figure 2 It can be seen that under the condition of different concentrations of NaIO3 treatment, the cell activity after overexpression of UCP2 was significantly increased compared with the control group, which shows that UCP2 can enhance the cell activity of RPE cells.

[0076] Example 3

[0077] This example relates to the therapeutic effect of adenovirus overexpressing UCP2 in an animal model of dry AMD.

[0078] NaIO3 was used to construct a dry AMD mouse model, and the mice were injected with UCP2 adenovirus into the vitreous and divided into control group, NaIO3 group, NaIO3+AAV-empty group, and NaIO3+AAV-UCP2 group. The fundus images and retinal electrophysiology of the mice were observed after 2 weeks.

[0079] Depend on Figure 3 The fundus photographs in A show that NaIO3 leads to an increase in the area of ​​retinal pigment loss, while the UCP2 adenovirus treatment group can restore the area of ​​retinal pigment. Figure 3 The OCT images in A and Figure 3 B. Retinal thickness results show that the total retinal thickness in the NaIO3 group was significantly reduced, while overexpression of UCP2 could restore the thickness. Figure 3 C and Figure 3 D shows that the decreased a and b wave amplitudes in the NaIO3-treated group can be restored by overexpression of UCP2, and the damage to the retinal function of mice can be repaired.

[0080] SEQ ID NO.1:

[0081] ATGGTTGGGTTCAAGGCCACAGATGTGCCCCCTACTGCCACTGTGAAGTTTCTTGGGGCTGGCACAGCTGCCTGCATCGCAGATCTCATCACCTTTCCTCTGGATACTGCTAAAGTCCGGTTACAGATCCAAGGAGAAAGTCAGGGGCCAGTGCGCGCTACAGCCAGCGCCCAGTACCGCGGTGTGATGGGCACCATTCTGACCATGGTGCGTACTGAGGGCCCCCGAAGCCTCTACAATGGGCTGGTTGCCGGCCTGCAGCGCCAAATGAGCTTTGCCTCTGTCCGCATCGGCCTGTATGATTCTGTCAAACAGTTCTACACCAAGGGCTCTGAGCATGCCAGCATTGGGAGCCGCCTCCTAGCAGGCAGCACCACAGGTGCCCTGGCTGTGGCTGTGGCCCAGCCCACGGATGTGGTAAAGGTCCGATTCCAAGCTCAGGCCCGGGCTGGAGGTGGTCGGAGATACCAAAGCACCGTCAATGCCTACAAGACCATTGCCCGAGAGGAAGGGTTCCGGGGCCTCTGGAAAGGGACCTCTCCCAATGTTGCTCGTAATGCCATTGTCAACTGTGCTGAGCTGGTGACCTATGACCTCATCAAGGATGCCCTCCTGAAAGCCAACCTCATGACAGATGACCTCCCTTGCCACTTCACTTCTGCCTTTGGGGCAGGCTTCTGCACCACTGTCATCGCCTCCCCTGTAGACGTGGTCAAGACGAGATACATGAACTCTGCCCTGGGCCAGTACAGTAGCGCTGGCCACTGTGCCCTTACCATGCTCCAGAAGGAGGGGCCCCGAGCCTTCTACAAAGGGTTCATGCCCTCCTTTCTCCGCTTGGGTTCCTGGAACGTGGTGATGTTCGTCACCTATGAGCAGCTGAAACGAGCCCTCATGGCTGCCTGCACTTCCCGAGAGGCTCCCTTCTGA

[0082] SEQ ID NO.2:

[0083] ATGGTTGGTTTCAAGGCCACAGATGTGCCCCCAACAGCCACTGTGAAGTTCCTGGGGGCTGGGACAGCTGCCTGCATTGCAGATCTCATCACTTTCCCTCTGGATACCGCCAAGGTCCGGCTGCAGATCCAAGGGGAGAGTCAAGGGCTAGTGCGCACCGCAGCCAGCGCCCAGTACCGTGGCGTTCTGGGTACCATCCTAACCATGGTGCGCACTGAGGGTCCACGCAGCCTCTACAATGGGCTGGTCGCCGGCCTGCAGCGCCAGATGAGCTTTGCCTCCGTCCGCATTGGCCTCTACGACTCTGTCAAACAGTTCTACACCAAGGGCTCAGAGCATGCAGGCATCGGGAGCCGCCTCCTGGCAGGTAGCACCACAGGTGCCCTGGCCGTGGCTGTAGCCCAGCCTACAGATGTGGTAAAGGTCCGCTTCCAGGCTCAGGCCCGGGCTGGTGGTGGTCGGAGATACCAGAGCACTGTCGAAGCCTACAAGACCATTGCACGAGAGGAAGGGATCCGGGGCCTCTGGAAAGGGACTTCTCCCAATGTTGCCCGTAATGCCATTGTCAACTGTGCTGAGCTGGTGACCTATGACCTCATCAAAGATACTCTCCTGAAAGCCAACCTCATGACAGATGACCTCCCTTGCCACTTCACTTCTGCCTTCGGGGCCGGCTTCTGCACCACCGTCATCGCCTCCCCTGTTGATGTGGTCAAGACGAGATACATGAACTCTGCCTTGGGCCAGTACCACAGCGCAGGTCACTGTGCCCTTACCATGCTCCGGAAGGAGGGACCCCGCGCCTTCTACAAGGGGTTCATGCCTTCCTTTCTCCGCTTGGGATCCTGGAACGTAGTGATGTTTGTCACCTATGAGCAGCTCAAAAGAGCCCTAATGGCTGCCTACCAATCTCGGGAGGCACCTTTCTGA

[0084] The above shows and describes the basic principles and main features of the present invention and the advantages of the present invention. It should be understood by those skilled in the art that the present invention is not limited to the above embodiments. The above embodiments and descriptions are only for explaining the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention may have various changes and improvements, which fall within the scope of the present invention to be protected. The scope of protection of the present invention is defined by the attached claims and their equivalents.

Claims

1. A vector for overexpressing the UCP2 gene, characterized in that: The vector comprises at least one of the sequences shown in SEQ ID NO.1 and SEQ ID NO.

2.

2. The vector for overexpressing the UCP2 gene according to claim 1, characterized in that: The vector is a viral vector or a plasmid vector.

3. The vector for overexpressing the UCP2 gene according to claim 2, characterized in that: The viral vector is an adenoviral vector.

4. Use of the vector for overexpressing UCP2 gene according to any one of claims 1 to 3 in the preparation of a medicament for preventing and / or treating dry AMD.

5. A pharmaceutical composition for preventing and / or treating dry AMD, characterized in that: The pharmaceutical composition comprises the vector for overexpressing the UCP2 gene according to any one of claims 1 to 3.

6. A pharmaceutical preparation for preventing and / or treating dry AMD, characterized in that: The pharmaceutical preparation comprises the vector for overexpressing the UCP2 gene according to any one of claims 1 to 3.

7. The pharmaceutical preparation for preventing and / or treating dry AMD according to claim 6, characterized in that: The pharmaceutical preparation is an oral preparation, an injection preparation or an ophthalmic preparation.

8. The pharmaceutical preparation for preventing and / or treating dry AMD according to claim 7, characterized in that: The ophthalmic preparation is eye drops, eye ointment, eye spray, eye gel, eye patch, intraocular injection, eye microsphere, eye implant, periocular injection or ophthalmic sustained-release preparation.

Images