CRISPR / Cas12a mediated cascade thrombin signal amplification detection method

Abstract

The method comprises the following steps: preparing a spherical nucleic acid probe and functionalized magnetic particles, incubating the functionalized magnetic particles and thrombin, adding the spherical nucleic acid probe to prepare a thrombin detection solution, adding a CRIPSR / Cas12a system and a reporter probe into the thrombin detection solution, and detecting the thrombin sensitivity by using the CRISPR / Cas12a mediated cascade amplifier. Carrying out target identification and signal conversion, collecting a fluorescence signal, and establishing a linear relationship between the fluorescence intensity and the thrombin concentration. The acDNA and Apt15 modified gold nanoparticles, the Apt29 modified magnetic particles and the thrombin act to form a sandwich structure, hundreds of acDNAs are modified on the surfaces of the gold nanoparticles, primary amplification of signals is achieved, the acDNA activates the enzymatic activity of Cas12a protein, divides a fluorophore and a quenching group, enhances the strength of fluorescence signals and further amplifies thrombin signals.

Description

Technical Field

[0001] The present invention relates to a CRISPR / Cas12a-mediated cascade thrombin signal amplification detection method, and belongs to the field of bioanalytical chemistry and sensor technology. Background Art

[0002] Thrombin is a multifunctional serine protease that can convert fibrinogen into fibrin and plays an important role in the coagulation cascade. It is an important marker for coagulation disorders and various pathological processes. The role of thrombin in physiological processes depends on its concentration. In normal coagulation, the concentration of thrombin in the blood usually ranges from nanomolar (nM) to low micromolar (μM) levels. However, in patients with coagulation disorders, this concentration may be as low as picomolar (pM) levels. An imbalance in its concentration may lead to a variety of diseases, including thrombosis, Alzheimer's disease, atherosclerosis, and liver disease. Therefore, it is crucial to develop a highly sensitive and selective thrombin detection method. Traditional immunoassay methods, such as enzyme activity method and enzyme-linked immunosorbent assay, have limitations such as large antigen and sample volume, long reaction time, and high cost.

[0003] Nucleic acid aptamers are effective functional nucleic acid probes that can recognize target molecules such as thrombin with high specificity. They have the advantages of small size, easy modification, and good stability, and are often used in biosensors. 15 and Apt 29 It is a commonly used aptamer that can bind to different sites of thrombin. In recent years, sandwich-type assays based on aptamers (such as SERS, fluorescence, colorimetry, etc.) have been widely used in thrombin detection, but these methods usually face problems such as poor detection limit, long measurement time, and complex sample preparation.

[0004] The CRISPR / Cas system is an adaptive immune system of bacteria and archaea that can specifically cleave target nucleic acids. In particular, the "trans-cleavage" activity exhibited by LbCas12a after binding to target DNA makes it a powerful tool in signal amplification. For example, Zhu et al. 29 The aptamer is linked to a Cas12a activation DNA sequence (Apt 29 -acDNA), Apt 15 The aptamer is modified on the substrate, and thrombin induces Apt 29 -acDNA -Thrombin-Apt 15The formation of a sandwich structure, so after washing and adding the CRIPSR / Cas12a system, the acDNA in the sandwich structure will activate the trans-cleavage activity of Cas12a, and then cut the substrate to achieve signal amplification and output of thrombin [Analytical Chimica Acta 2024, 1287, 342106]. However, in the above experiment, one thrombin can only form one sandwich structure and link one acDNA, resulting in limited signal amplification. Summary of the invention

[0005] The technical problem to be solved by the present invention is to overcome the shortcomings of the prior art and provide a CRISPR / Cas12a-mediated cascade thrombin signal amplification detection method, by combining CRISPR / Cas12a activation DNA (acDNA) and thrombin aptamer Apt 15 They are co-modified on the surface of gold nanoparticles. Hundreds of acDNAs can be modified on the surface of one gold particle, realizing the primary signal amplification of thrombin. Then acDNA activates the enzymatic activity of Cas12a in the CRISPR / Cas12a system, cuts FQ-DNA, separates its fluorescent group and quenching group, and enhances the fluorescence signal, thereby realizing secondary signal amplification.

[0006] The present invention provides a method for sensitive detection of thrombin using a CRISPR / Cas12a-mediated cascade signal amplification aptamer sensor, comprising the following steps: Step 1: Preparation of spherical nucleic acid probes: 15 Co-modified with acDNA on gold nanoparticles (AuNPs) to prepare spherical nucleic acid probe AuNPs-Apt 15 / acDNA; Step 2: Preparation of functionalized magnetic particles: 29 Modified onto magnetic particles to prepare magnetic particles-Apt 29 ; Step 3: Thrombin detection: Modify the aptamer Apt 29 The magnetic particles were mixed with different concentrations of thrombin to capture the target protein thrombin, and then AuNPs-Apt 15 / acDNA spherical nucleic acid probe and incubate to form a sandwich structure of magnetic particles / thrombin / gold nanoparticles; Step 4, prepare the CRIPSR / Cas12a system, mix the crRNA and Cas12a protein corresponding to the specific acDNA in a buffer solution to prepare the CRIPSR / Cas12a system; Step 5: Thrombin signal output and secondary signal amplification: adding the CRIPSR / Cas12a system of step 4 and the reporter probe FQ-ssDNA double-labeled with a fluorescent group and a quenching group to the detection solution of step 3 for target recognition and signal conversion; Step 6: Collect the fluorescence signal of the solution in step 5 and establish a linear relationship between the fluorescence intensity and the thrombin concentration.

[0007] The present invention provides a thrombin detection method using CRISPR / Cas12a to realize signal cascade amplification, wherein CRISPR / Cas12a activation DNA (acDNA) and thrombin aptamer Apt 15 The thrombin aptamer Apt 29 Modified on the surface of magnetic particles. When thrombin is present, gold particles and magnetic particles will form a sandwich structure due to the recognition of aptamers. Compared with the prior art, the surface of a gold particle of the present invention can be modified with hundreds of acDNAs, thereby achieving primary signal amplification; after the subsequent addition of the CRISPR / Cas12a system, these acDNAs will activate the enzyme activity of Cas12a, and then FQ-DNA can be cut, so that the F and Q groups are separated, causing the fluorescent signal to be enhanced, thereby achieving secondary signal amplification. At the same time, the present invention uses magnetic particles as a supporting material, and since the reaction occurs in a solution, it overcomes the problem of slow reaction caused by the diffusion-limited kinetics caused by aptamers and thrombin on solid substrates.

[0008] The technical solution further optimized as the present invention is as follows: In step 1, the particle size of gold nanoparticles AuNPs is 13 nm and they are modified by citric acid. The preparation method thereof is based on the literature [Liu J, Lu Y. Nature protocols, 2006, 1(1): 246-252.]; acDNA and Apt are prepared. 15 Two DNA chains, the total amount of fixed AuNPs and modified DNA (acDNA+Apt 15 ) was unchanged at 1:500, and the acDNA and Apt 15 The relative amount of AuNPs covered with different acDNA and Apt was prepared according to the literature [Hao Y, Li Y, Song L, et al. JACS, 2021, 143(8): 3065-3069.] 15 Amount of spherical nucleic acid, specifically Apt in spherical nucleic acid probe 15 The molar ratio to acDNA is 1:0.5 to 1:3.

[0009] In step 2, the magnetic particles are washed, resuspended, and then magnetically separated for 2 minutes, the supernatant is removed, and the magnetic particles are washed with 100ul 25mM MES (PH=5), and cultured for 10 minutes under sufficient mixing, and repeated 3 times; Add aptamer Apt 29 Add 10 μl of 25 mM (pH=5) MES solution to the washed magnetic particles, mix well, and incubate at room temperature for 30 min; add 30 μl of 100 mg / mL EDC and mix well; add 10 μl of 25 mM (pH=5) MES solution to a final volume of 100 μl and incubate at room temperature for 5 h; Apt is bound to the phosphodiesterase through carboxyl-amino interactions. 29 The thrombin aptamer was immobilized on the surface of magnetic particles. After magnetic separation, the supernatant was removed and resuspended in 100 ul PBST (containing 0.05% Tween 20) buffer, and 5 ul SuperBlock (PBS) buffer was added for blocking for 30 min; washed 4 times with 100 ul PBST buffer, and finally resuspended in 400 ul PBST buffer and stored at 4°C for future use.

[0010] In step 2, 0.07 pM to 700 pM Apt is modified per mg of magnetic particles. 29 .

[0011] In step 3, the modified nucleic acid aptamer Apt 29 Add different concentrations of target protein thrombin to the magnetic particles for incubation, magnetic separation, remove the supernatant, and then mix the obtained precipitate with the particles with different Apt prepared in step 1. 15 Incubate with spherical nucleic acid probes with a molar ratio of acDNA to form magnetic microparticles / thrombin / AuNPs-Apt 15 / acDNA sandwich structure.

[0012] In step 4, the CRIPSR / Cas12a system was prepared, the Cas12a protein was purchased from Suzhou Nearshore Protein Technology Co., Ltd., the buffer solution was 10×NEB Buffer™ r2.1, purchased from New England BioLabs (USA); the molar ratio of crRNA to Cas12a protein was 15:10.

[0013] In step 5, the CRIPSR / Cas12a system and DNA (FQ-DNA) doubly labeled with a fluorescent group F and a quenching group Q are added to the solution forming the magnetic particle / thrombin / AuNPs-Apt15 / acDNA sandwich structure for cutting, incubation for 60 minutes, and target recognition and signal output are performed.

[0014] In step 6, the thrombin is detected by measuring the intensity change of the fluorescence signal using a fluorescence spectrophotometer. The fluorescence spectrophotometer used is model FL-8500 purchased from PerkinElmer in the United States.

[0015] Preferably, the sequence of the acDNA is SH-AAT ATG TCA TTA TGT GCT GCC ATA TCT ACTTCA GAA ACT.

[0016] Compared with the prior art, the present invention adopts acDNA and Apt 15 Co-modified gold nanoparticles with Apt 29 The modified magnetic particles and thrombin work together to form a sandwich structure, allowing the surface of the gold nanoparticles to be modified with hundreds of acDNAs, without the limitation that one thrombin can only link to one acRNA, thus achieving primary signal amplification. Hundreds of acDNAs activate the enzymatic activity of the Cas12a protein in the CRISPR / Cas12a system, split the fluorescent group and the quenching group, enhance the intensity of the fluorescent signal, and further amplify the thrombin signal.

[0017] Compared with previous methods, the advantage of the present invention is that a large number of detection adapters and activation acDNA of the CRISPR / Cas12a system are co-modified on the surface of nanoparticles, achieving efficient amplification of target signals without amplification and additional enzymes, improving detection stability, simplifying operation, and reducing experimental costs. It is worth noting that the present invention also utilizes the cis activity of Cas12a. After identifying the target, the co-modified active DNA is partially released from the surface of the nanoparticles through the cis-cleavage process, increasing the reaction space of the remaining active DNA, so that the released active DNA / crRNA / Cas12a complex can more effectively cut the reporter DNA in the solution. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 It is a schematic diagram of the thrombin detection process in the present invention.

[0019] Figure 2 This is a schematic diagram of the response of the spherical nucleic acid probes prepared under different conditions in the present invention to thrombin.

[0020] Figure 3 This is a fluorescence response curve diagram of thrombin detection in the present invention.

[0021] Figure 4 This is a diagram showing the selectivity of the detection method of the present invention for thrombin detection. DETAILED DESCRIPTION

[0022] The technical solution of the present invention is further described in detail below in conjunction with the accompanying drawings: This embodiment is implemented on the premise of the technical solution of the present invention, and a detailed implementation method and specific operation process are given, but the protection authority of the present invention is not limited to the following embodiments. Example 1

[0023] A fluorescent sensing method for detecting thrombin based on the CRISPR / Cas12a system connected to a sandwich aptamer, such as Figure 1 As shown, the following steps are included: (1) Synthesis of AuNPs with a particle size of 13 nm using sodium citrate reduction method AuNPs were synthesized according to the reference [Liu J, Lu Y. Nature protocols, 2006, 1(1): 246-252.] 0.5 mL of 50 mM HAuCl4 solution was placed in 24.5 mL of ultrapure water, and the solution was stirred at 140°C. After condensation reflux began, 2.5 mL of 38.8 mM trisodium citrate solution was quickly added. The color of the solution changed from light yellow to dark red. After continuing to reflux for 20 min, the solution was taken out and cooled to obtain an AuNPs solution with an AuNPs concentration of about 10 nM. The synthesized nanoparticles AuNPs were stored at 4°C for later use.

[0024] (2) Preparation of AuNPs-Apt by butanol rapid dehydration method 15 / acDNA spherical nucleic acid probe AuNPs-Apt was prepared according to the reference [Hao Y, Li Y, Song L, et al. JACS, 2021, 143(8): 3065-3069.] 15 / acDNA spherical nucleic acid probe. The specific preparation process of the spherical nucleic acid probe is as follows: 15 First, 9.5ul of 10uM thiol-modified Apt 15 19ul 10uM sulfhydryl-modified acDNA was mixed with 30mM TCEP at a concentration ratio of 1:200 and reduced with slight shaking at room temperature for 30min to reduce the formation of disulfide bonds. 15 Mix well with acDNA and add to 56 uL 10 nM AuNPs. Take it as a whole, add 761 uL n-butanol and 169 uL 0.5xTBE buffer in a volume ratio of 1:9:2, mix quickly, vortex centrifuge for 5 seconds, and take the lower layer of solution to get AuNPs-Apt. 15 / acDNA mixture. 15 The sequences of acDNA are shown in Table 1.

[0025] AuNPs-Apt 15 The 50 μL / acDNA mixture was added to 200 μL 10 mM HEPES (pH = 7.6), centrifuged at room temperature for 10 min, the supernatant was removed, and the cell suspension was washed three times with 200 μL 10 mM HEPES buffer to remove free Apt. 15 and acDNA, and then the obtained AuNPs-Apt 15 The mixture of AuNPs / acDNA was mixed at a volume ratio of 1:20 and then blocked. The mixture was centrifuged at room temperature for 8 min, the supernatant was removed, and finally dispersed in 140 ul of HEPES buffer to obtain 2 nM AuNPs-Apt 15 / acDNA spherical probe solution, stored at 4°C until use.

[0026] Other Apt 15 AuNPs-Apt:acDNA molar ratio 15 / acDNA preparation process is the same as above, but the Apt 15 This example prepared Apt 15 :acDNA=1:0.5, 1:1, 1:2, 1:3 four spherical nucleic acid probes.

[0027] (3) Functionalized magnetic particles-Apt 29 Preparation The magnetic particles (Dynabeads M-270 Carboxylic Acid, purchased from Thermo Fisher Scientific, US) were resuspended, and 100ul was transferred to a 500ul anti-adsorption centrifuge tube; magnetic separation was performed for 2min, the supernatant was removed, and the magnetic particles were washed with 100ul 25mM MES (PH=5), and incubated for 10min with sufficient mixing, and this step was repeated 3 times; 60ul 35uM Apt 29 Add the washed magnetic particles, mix well, and slowly tilt and rotate at room temperature for 30 min; take out the sealed EDC from the refrigerator in advance and restore it to room temperature for use; add 30ul of 100 mg / mL EDC (prepared in cold 100 mM pH=5 MES, prepared immediately before use), mix well; add 10ul of 25 mM pH=5 MES solution to a final volume of 100ul, and slowly tilt and rotate at room temperature for 5h; Apt is bound through carboxyl-amino interaction 29Thrombin aptamer was fixed on the surface of magnetic particles. After magnetic separation, the supernatant was removed and resuspended in 100ul PBST (containing 0.05% Tween 20) buffer. 5ul SuperBlock (PBS) buffer was added for blocking for 30min. The cells were washed 4 times with 100ul PBST buffer and finally resuspended in 400ul PBST buffer and stored at 4℃ for future use. Apt 29 The sequences are shown in Table 1. 0.07 pM to 700 pM Apt can be modified on each mg of magnetic particles 29 .

[0028] (4) Magnetic particles / thrombin / Au NPs-Apt 15 / Formation of acDNA sandwich structure Dissolve thrombin in binding buffer to prepare thrombin solutions with concentrations of 0 nM, 1 nM, 2 nM, 5 nM, and 10 nM. Add 29 ul of 0.1% BSA to a 500 ul anti-adsorption centrifuge tube, then add 7 ul of the diluted thrombin solution and 4 ul of the magnetic microparticles modified in step (3) - Apt 29 , mix well, at this time the magnetic particles will capture the thrombin in the solution, gently shake and incubate at room temperature for 30 minutes; remove the supernatant by magnetic separation, wash the magnetic particles twice with 50ul washing buffer to remove the free thrombin in the solution. Then resuspend it in 16.8ul binding buffer and mix with 16.8ul 2nmol / L four AuNPs-Apt prepared in step (2) 15 / acDNA spherical nucleic acid probe solutions were mixed and incubated at room temperature for 30 minutes. At this time, the thrombin protein and the nucleic acid aptamer specifically combined to form magnetic particles / thrombin / AuNPs-Apt 15 After the reaction is completed, the magnetic complex is separated from the unbound AuNPs-Apt 15 The mixture solution of dapoxetine / acDNA was separated, and the magnetic particles were washed three times with 50ul washing buffer, including binding buffer (50mM Tris-HCl, 100mM NaCl, 5mM KCl, 5mM MgCl2, pH=7.4); washing buffer (10mMTris-HCl, 1mM NaCl, 1mM EDTA, pH=7.5).

[0029] (5) Preparation of CRIPSR / Cas12a system Add 2.6 uL crRNA (10 uM), 29 uL 10xNEBBuffer™ r2.1 buffer and 236 uL ultrapure water to 22.5 uL Cas12a protein (1.67 uM) and mix well to prepare the Cas-crRNA system. The sequence of crRNA is shown in Table 1.

[0030] Table 1 Primer Sequence (5'-3') crRNA UAAUUUCUACUAAGUGUAGAUUGAAGUAGAUAUGGCAGCAC <![CDATA[Apt 15 ]]> GGT TGG TGT GGT TGGTTT TTT GGG TTT AAC ATG-SH <![CDATA[Apt 29 ]]> <![CDATA[NH2-AGT CCG TGG TAG GGC AGG TTG GGG TGA CT]]> acDNA SH-AAT ATG TCA TTA TGT GCT GCC ATA TCT ACT TCA GAA ACT FQ-ssDNA <![CDATA[FAM-CTCTCT-BHQ1]]> (6) Thrombin signal output and secondary signal amplification, take 20uL CRIPSR / Cas12a system and 4uL 10xNEB buffer and add them to 33.6ul HEPES buffer, then add 2.4ul (5uM) FQ-ssDNA double-labeled with fluorescent group and quenching group, mix well, and add them to the washed magnetic complex. At this time, the acDNA modified on the gold nanoparticles will trigger the non-specific trans-cleavage activity of Cas12a, non-specifically cleave FQ-ssDNA, causing the fluorescent group and the quenching group to separate, thereby leading to fluorescence recovery (the final concentrations of Cas12a protein, crRNA and FQ-ssDNA are 52.5nM, 35nM, and 200nM, respectively). The sequence of FQ-ssDNA is shown in Table 1.

[0031] (7) The relationship between the intensity change of the fluorescence signal and the concentration of thrombin can be measured by a fluorescence spectrophotometer to obtain the detection range and detection limit of thrombin. The excitation wavelength is 450nm and the emission wavelength is 490-560nm. Figure 2 The response of the prepared spherical nucleic acid probes with different ratios to 20 nM thrombin is shown in the figure. 15 : When acDNA=1:2, the response signal is the largest. Figure 3 This is the response curve of the probe designed under optimal conditions to thrombin. It can be seen from the figure that with the increase of thrombin concentration, the fluorescence signal gradually increases, which verifies the feasibility of CRISPR / Cas12a-mediated cascade signal amplification aptamer sensor for thrombin detection.

[0032] (8) Selective testing The steps used in the selective experiment are the same as those for thrombin, but in step (4), thrombin is replaced by bovine serum albumin (BSA), hemoglobin (HE), human serum albumin (HSA), lysozyme (Ly), immunoglobulin (LgG), and thrombin (Thr). Figure 4 As shown, the designed probe has no obvious response to other substances, indicating that it has good selectivity and specificity for thrombin detection.

[0033] The above description is only a specific implementation of the present invention, but the protection scope of the present invention is not limited thereto. Any person familiar with the technology can understand and think of any changes or substitutions within the technical scope disclosed by the present invention, which should be included in the scope of the present invention. Therefore, the protection scope of the present invention should be based on the protection scope of the claims.

Claims

1. A CRISPR / Cas12a-mediated cascade thrombin signal amplification detection method, characterized in that: The following steps are involved: Step 1: Preparation of spherical nucleic acid probes. 15 Co-modification with acDNA on gold nanoparticles to prepare spherical nucleic acid probe AuNPs-Apt 15 / acDNA; Step 2: Preparation of functionalized magnetic particles: 29 Modified onto magnetic particles to prepare magnetic particles-Apt 29 ; Step 3: Thrombin detection: Modify the aptamer Apt 29 The magnetic particles were mixed with different concentrations of thrombin to capture the target protein thrombin, and then AuNPs-Apt 15 / acDNA spherical nucleic acid probe and incubate to form a sandwich structure of magnetic particles / thrombin / gold nanoparticles; Step 4, prepare the CRIPSR / Cas12a system, mix the crRNA and Cas12a protein corresponding to the acDNA in a buffer solution to prepare the CRIPSR / Cas12a system; Step 5: Thrombin signal output and secondary signal amplification: adding the CRIPSR / Cas12a system of step 4 and the reporter probe FQ-ssDNA double-labeled with a fluorescent group and a quenching group to the detection solution of step 3 for target recognition and signal conversion; Step 6: Collect the fluorescence signal of the solution in step 5 and establish a linear relationship between the fluorescence intensity and the thrombin concentration.

2. The CRISPR / Cas12a-mediated cascade thrombin signal amplification detection method according to claim 1, characterized in that: In step 1, the particle size of the gold nanoparticles AuNPs is 13 nm and is modified by citric acid; the spherical nucleic acid probe Apt 15 The molar ratio to acDNA is 1:0.5 to 1:

3.

3. The CRISPR / Cas12a-mediated cascade thrombin signal amplification detection method according to claim 2, characterized in that: In step 2, the magnetic particles are washed, resuspended, and then magnetically separated for 2 minutes, the supernatant is removed, and the magnetic particles are washed with 100ul 25mM MES, and cultured for 10 minutes under sufficient mixing, and repeated 3 times; Add aptamer Apt 29 Add 30 ul 100 mg / mL EDC to the washed magnetic particles, mix well, and incubate at room temperature for 30 min; add 10 ul 25 mM MES solution, the final volume is 100 ul, and incubate at room temperature for 5 h; magnetic separation, remove the supernatant, resuspend in 100 ul PBST buffer, add 5 ul SuperBlock buffer for blocking treatment for 30 min; wash 4 times with 100 ul PBST buffer, and finally resuspend in 400 ul PBST buffer and store at 4°C for use.

4. The CRISPR / Cas12a-mediated cascade thrombin signal amplification detection method according to claim 3, characterized in that: In step 2, 0.07 pM to 700 pM Apt is modified per mg of magnetic particles. 29 .

5. The CRISPR / Cas12a-mediated cascade thrombin signal amplification detection method according to claim 4, characterized in that: In step 3, the modified nucleic acid aptamer Apt 29 Add different concentrations of target protein thrombin to the magnetic particles for incubation, magnetic separation, remove the supernatant, and then mix the obtained precipitate with the particles with different Apt prepared in step 1. 15 The spherical nucleic acid probe was incubated with a molar ratio of acDNA to form a magnetic particle / thrombin / AuNPs-Apt15 / acDNA sandwich structure.

6. The CRISPR / Cas12a-mediated cascade thrombin signal amplification detection method according to claim 5, characterized in that In step 4, the CRIPSR / Cas12a system was prepared, the Cas12a protein was purchased from Suzhou Nearshore Protein Technology Co., Ltd., the buffer solution was 10×NEB Buffer™ r2.1, purchased from New England BioLabs (USA); the molar ratio of crRNA to Cas12a protein was 15:

10.

7. The CRISPR / Cas12a-mediated cascade thrombin signal amplification detection method according to claim 6, characterized in that: In the step 5, the CRIPSR / Cas12a system and the DNA double-labeled with the fluorescent group F and the quenching group Q are added to the solution forming the magnetic particle / thrombin / AuNPs-Apt15 / acDNA sandwich structure for cutting, incubation for 60 minutes, and target recognition and signal output are performed.

8. The CRISPR / Cas12a-mediated cascade thrombin signal amplification detection method according to claim 7, characterized in that: In step 6, the thrombin is detected by measuring the intensity change of the fluorescence signal using a fluorescence spectrophotometer. The fluorescence spectrophotometer used is model FL-8500 purchased from PerkinElmer in the United States.

9. The CRISPR / Cas12a-mediated cascade thrombin signal amplification detection method according to claim 1, characterized in that: The sequence of the acDNA is SH-AAT ATG TCA TTA TGT GCT GCC ATA TCT ACT TCA GAA ACT.

Images