Primer probe combination, kit, method and application for detecting leprosy bacter

Abstract

The invention relates to a primer probe combination, a kit, a method and application for detecting leprosy bacilli. The primer probe combination comprises six primers and a fluorescent probe combination. The combination of the six primers and the fluorescent probe has the advantages of high sensitivity and specificity when being used for detecting the leprosy bacilli, and the problem of false positive caused by non-specific amplification in the traditional LAMP detection is effectively solved. In addition, detection can be completed within 30 minutes, the reaction time is shorter, and the detection result is accurate. The HiFi-LAMP detection technology provides an effective and reliable scheme for leprosy diagnosis, is beneficial to early discovery and timely treatment of leprosy, and further makes a contribution to elimination of global leprosy.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically designs a primer-probe combination, a kit, a method and an application technology for detecting Mycobacterium leprae. Background Art

[0002] Leprosy, also known as Hansen's disease, is a chronic infectious disease caused by infection with Mycobacterium leprae, which is mainly transmitted through the respiratory tract and frequent close contact with untreated leprosy patients. It mainly invades the skin and peripheral nerves. If not diagnosed and treated in time, it may lead to progressive and permanent disability.

[0003] The clinical manifestations of leprosy are diverse and can simulate a variety of dermatological diseases. The initial diagnosis is mainly based on the observation of symptoms such as skin lesions, loss of sensation, hair loss, and limb disability. It lacks specific manifestations. Tissue fluid acid-fast staining and tissue pathology examination are used as the gold standard for diagnosis. They have low sensitivity, are time-consuming, and are difficult to operate. Serological testing has low sensitivity for paucibacillary leprosy and cross-reacts with other mycobacteria, and cannot achieve early and accurate diagnosis of leprosy.

[0004] Since the implementation of the multidrug treatment program in 1981, leprosy has been effectively controlled worldwide, and the prevalence and number of new cases of leprosy have dropped significantly. From 2013 to 2022, the number of new cases worldwide dropped by 19.3%, and by 2019 it dropped by 6%, but the incidence rate is still high in some leprosy-endemic areas. In the "Global Leprosy Strategy 2021-2030", the World Health Organization called for the realization of the goal of zero leprosy (zero disease, zero disability, zero stigma and discrimination), with the goal of reducing new leprosy cases worldwide by 70% by 2030. To achieve this goal, it is particularly important to achieve early diagnosis and early treatment of leprosy patients.

[0005] With the continuous development of nucleic acid detection technology, a variety of nucleic acid detection technologies such as ordinary PCR, qPCR and nested PCR have been developed for different target genes of Mycobacterium leprae. qPCR is widely used in the detection of Mycobacterium leprae due to its high sensitivity and specificity, but its reaction time is relatively long and it needs to rely on thermal cyclers, professional PCR laboratories and professional personnel to operate, which limits its application in leprosy diagnosis and screening. Loop-mediated isothermal amplification (LAMP) is a new DNA amplification technology, which is characterized by designing 4 specific primers for 6 regions of the target gene. Under the action of strand displacement DNA polymerase (Bst DNA polymerase), the amplification is carried out at a constant temperature of 60℃ to 65℃, and 10 can be achieved in about 15 to 60 minutes. 9 ~10 10The nucleic acid amplification can be accelerated by introducing two loop primers, which can increase the reaction speed, shorten the detection time, and improve the detection efficiency. It is simple to operate, has low requirements for instruments and equipment, and is simple to interpret the results. It is suitable for rapid diagnosis at the grassroots level. However, the problem of non-specific amplification limits the application of LAMP in microbial detection. Although several LAMP tests for Mycobacterium leprae have been established, they mainly use dye methods and pH-sensitive indicators as observation results, and non-specific amplification may cause false positives. Therefore, based on the relatively long reaction time of qPCR technology, its dependence on thermal cyclers, the need for professionals and professional laboratories, and the possible false positive problems of traditional LAMP, it is urgent to develop a set of primer-probe combinations for Mycobacterium leprae detection to achieve early, immediate, rapid, and accurate detection of Mycobacterium leprae. Summary of the invention

[0006] The present invention is to solve the above-mentioned problems and defects, and provides a primer-probe combination, kit, method and application for detecting Mycobacterium leprae. The present invention aims to design specific LAMP primers and probes for the RLEP gene of Mycobacterium leprae, and establish a high-fidelity DNA polymerase-mediated probe method LAMP (HiFi-LAMP) detection technology based on this. This technology aims to improve the sensitivity and specificity of Mycobacterium leprae detection, while shortening the reaction time, and providing an effective solution for early, rapid, accurate and immediate detection of leprosy.

[0007] The present invention is implemented by the following technical solution.

[0008] A primer-probe combination for detecting Mycobacterium leprae, wherein the primer-probe combination comprises: an upstream outer primer F3, a downstream outer primer B3, an upstream inner primer FIP, and a downstream inner primer BIP; Upstream outer primer F3: GCGGGGTTTTTGTTGGTG; Downstream outer primer B3: TCCTCACACTCACGCCTG; Upstream internal primer FIP: CGCGCTAATCGTGTCCACTGC-GGCTGACTGCCTGCTTTC; Downstream inner primer BiP: GTCGGTGGTGGATGCTGCTT-CGATATCGCCTTCAGCACAG; The upstream outer primer F3 is shown in SEQ ID NO.1; Downstream outer primer B3 is shown in SEQ ID NO.2; The upstream inner primer FIP is shown in SEQ ID NO.3; The downstream inner primer is BIP as shown in SEQ ID NO.4.

[0009] Furthermore, the primer-probe combination of the present invention comprises: an upstream loop primer LF: AAAGCACACGAAGCCTCATC, a downstream loop primer LB: TGTTGATGATGCCAGGGGC; The upstream loop primer LF is shown in SEQ ID NO.5; The downstream loop primer LB is shown as SEQ ID NO.6.

[0010] Furthermore, the primer-probe combination of the present invention includes: fluorescent probe HFman-probe: BHQ2-TGTTGATGATGCCAGGGGC-CY5, and the fluorescent probe HFman-probe is shown in SEQ ID NO.7.

[0011] A kit comprises the above-mentioned primers and fluorescent probes.

[0012] The present invention protects the application of the primer-probe combination in the specific detection of Mycobacterium leprae.

[0013] The method for detecting leprosy bacillus of the present invention comprises a HiFi-LAMP detection method performed at 64°C for 50 minutes, and comprises using a high-fidelity DNA polymerase and the primer-probe combination to detect leprosy bacillus. The method for determining the detection result of the method described above is as follows: the HiFi-LAMP reaction result is monitored by a real-time fluorescence detection system, and a clear "S"-shaped curve is detected within 30 minutes, which is considered positive.

[0014] The beneficial effects of the present invention are: 1) High sensitivity and specificity: By designing LAMP primers and probes targeting Mycobacterium leprae RLEP and combining them with high-fidelity DNA polymerase, HiFi-LAMP technology significantly improves the sensitivity and specificity of detection, effectively solving the false positive problem caused by nonspecific amplification in traditional LAMP detection.

[0015] 2) Rapid detection: HiFi-LAMP technology can complete the detection within 30 minutes. Compared with qPCR technology, the reaction time is shorter and the detection results are more accurate.

[0016] 3) Easy to use: This technology does not rely on specific thermal cycling instruments, professional PCR laboratories, or professional operators, and is suitable for grassroots and instant testing scenarios.

[0017] 4) Application significance: The HiFi-LAMP detection technology of the present invention provides an effective and reliable solution for the diagnosis of leprosy, which is helpful for the early detection and timely treatment of leprosy, and further contributes to the elimination of leprosy worldwide.

[0018] The present invention is further explained below in conjunction with the accompanying drawings and specific embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 A diagram showing the sensitivity verification results of the three sets of primer probes designed for the present invention.

[0020] Figure 2 This is a comparison chart of the sensitivity and specificity test of the optimal RLEP primer set RLEP1 in the present invention using the dye method and the primer set in the prior art literature.

[0021] Figure 3 This is a diagram of the sensitivity detection results of HiFi-LAMP of the present invention.

[0022] Figure 4 This is a diagram of the specific detection results of HiFi-LAMP of the present invention.

[0023] Table 1 Figure 4 Description table DETAILED DESCRIPTION

[0024] The following examples are only a part of the technical solution of the present invention, and are not intended to limit the entire technical solution of the present invention. The examples of the present invention are provided to further explain and illustrate the details of the technical solution of the present invention.

[0025] Example 1 LAMP primer set design 1.1 LAMP primer design The leprae RLEP gene was downloaded from the NCBI database for comparison and determination of the conserved region (accession number GenBank: X17153.1). Three sets of specific LAMP primers, RLEP1, RLEP2, and RLEP3, were designed using the LAMP primer design software PrimerExplorer V5 (http: / / primerexplorer.jp / lampv5e / index.html), and each primer set was fluorescently labeled. The primers and fluorescently labeled probe sequences (5'→3') are shown in Table 2 below: Table 2. Primer and probe sets for detecting Mycobacterium leprae 1.2 LAMP primer probe screening The three primer probe sets designed in Table 2 were screened by comparing sensitivity and specificity. The specific method is as follows: according to the three sets of primer probes designed in Table 2, the isothermal amplification system was configured with the three sets of primer probes respectively, the plasmid PuC-57 containing the target RLEP gene (GenBank: X17153.1) was used as a DNA standard (synthesized by General Biotech), the concentration was determined using the NanoDrop One / OneC micro-nucleic acid protein concentration meter and gradient dilution was performed, 3uL of the template diluted to 10,000 copies / uL was added to the isothermal amplification system configured with the three sets of primer probes for reaction, and the amplification efficiency of each primer probe set was compared under the same conditions. The HiFi-LAMP isothermal amplification reaction system is shown in Table 3 below.

[0026] Table 3. HiFi-LAMP isothermal amplification reaction system HiFi-LAMP isothermal amplification reaction conditions: 64°C for 50 min.

[0027] The sensitivity verification results of the three primer sets are as follows Figure 1 ,Depend on Figure 1 It can be seen that under the same template concentration, RLEP3 has the shortest amplification time, and RLEP1 and RLEP2 have similar amplification times. However, no-template amplification can be seen in both RLEP2 and RLEP3 no-template control groups. Combining sensitivity and specificity, RLEP1 is the best primer probe set, and the following experiments all use the RLEP1 primer probe set.

[0028] Example 2 Comparison of sensitivity and specificity of the optimal RLEP primer set RLEP1 with the primer sets in the prior art literature using the dye method Because the existing literature LAMP detection is a dye method or pH-sensitive indicator as an observation result, and the probe method LAMP detection is not established, the dye method is used to compare the best primer set RLEP1 with the existing technical literature. The DNA standard is gradient diluted into a sample of 10,000 copies per microliter, and 10,000 copies per microliter is used as a template. Under the same reaction conditions, the LAMP primer set designed by the present invention is compared with the LAMP primer set reported in the prior art document 1 (Jiang H, Tsang L, Wang H, Liu C. Loop-mediated isothermal amplification (LAMP) assay targeting RLEP for detection ofMycobacterium leprae in leprosy patients. Int J Infect Dis. 2021 Jun;107:145-152.).

[0029] Test results such as Figure 2 As shown: under the same template concentration and reaction conditions, compared with the LAMP primer combination reported in the prior art literature, the LAMP primer group provided by the present invention has a shorter reaction time, and the amplification of the NTC group occurs later, and after the introduction of the probe, no amplification is observed in the NTC group (see Example 1). Therefore, the HiFi-LAMP detection method of the present invention has a shorter reaction time and higher specificity for detecting Mycobacterium leprae.

[0030] Example 3 HiFi-LAMP sensitivity test results The DNA standard was diluted in a 10-fold gradient to 10000 copies / μL, 1000 copies / μL, 100 copies / μL, 10 copies / μL, and 1 copy / μL. 3uL of each sample at all dilution multiples was added to the template, and amplification was performed using the HiFi-LAMP detection kit of the present invention (the isothermal amplification method is as described in Example 1).

[0031] Test results such as Figure 3 As shown: there is no amplification in the NTC group, and the concentration gradients of 10000 copies / μL, 1000 copies / μL, 100 copies / μL, 10 copies / μL, and 1 copy / μL of the present invention are all detected. According to the conversion of 3 μL sample volume, concentrations above 3 copies / reaction can be stably detected.

[0032] Example 4 HiFi-LAMP specificity test results Twelve common respiratory pathogens (including bacteria, fungi, and viruses) were used as templates and amplified using the HiFi-LAMP detection kit of the present invention (the isothermal amplification method is as described in Example 1).

[0033] Test results such as Figure 4 As shown: except for the positive control group which showed obvious amplification, no amplification was observed in 12 common respiratory pathogens and NTC, indicating that the HiFi-LAMP detection kit of the present invention has good specificity.

[0034] Example 5 HiFi-LAMP clinical sample validation results 18 nasal or oral swabs were collected from patients before and during treatment and tested using both the HiFi-LAMP detection kit and the qPCR detection kit.

[0035] The test results are shown in Table 4: The HiFi-LAMP detection kit detected 11 positive samples out of 18 clinical samples, while the qPCR detection kit detected 9 positive samples, indicating that the detection rate of the HiFi-LAMP detection kit was higher than that of the qPCR detection kit, and when comparing the HiFi-LAMP detection Tt value and the qPCR detection Ct value, the Tt value was significantly lower than the Ct value, indicating that the HiFi-LAMP detection had a faster reaction speed and higher reaction efficiency.

[0036] Table 4. Clinical sample validation and Tt and Ct value comparison of HiFi-LAMP kit and qPCR kit method Positive (copies) Negative (copies) Average Tt / Ct value HiFi-LAMP 11 / 18 7 / 18 8.54min qPCR 9 / 18 9 / 18 35.40 cycles In summary, the primer probe set, HiFi-LAMP detection kit and detection method of the Mycobacterium leprae RLEP gene provided by the present invention have high sensitivity, strong specificity, short required time, fast detection speed, simple operation, and can be widely used in the rapid diagnosis of Mycobacterium leprae.

[0037] The above description is only a preferred embodiment of the present invention and does not limit the present invention in any way. Any simple modification, change and equivalent structural change made to the above embodiment based on the technical essence of the present invention still falls within the protection scope of the technical solution of the present invention.

[0038] Features of the present invention: 1. High sensitivity: The LAMP primer-probe combination targets the RLEP gene of Mycobacterium leprae and has high sensitivity. It can detect 3 copies / μL of Mycobacterium leprae. When the HiFi-LAMP kit and qPCR kit are used to test clinical samples at the same time, the detection rate is higher than that of the qPCR kit.

[0039] 2. Strong specificity: The use of high-fidelity DNA polymerase-mediated probe-based LAMP detection improves the specificity of LAMP amplification and solves the problem of non-specific amplification of traditional LAMP. There is no non-specific amplification in 12 common respiratory pathogens; 3. Rapid detection method: HiFi-LAMP reaction can be completed within 30 minutes, significantly shortening the detection time and is suitable for rapid diagnosis.

[0040] 4. Composition and formula of the kit: It contains complete detection components and is easy to use. Only DNA template needs to be added for detection.

[0041] 5. Instant detection: No need to rely on huge thermal cyclers, only portable fluorescence instruments are needed to achieve instant detection, which is suitable for grassroots level; 6. The HiFi-LAMP method of the present invention did not detect any fluorescence signal in the NTC group.

[0042] The above are only some specific embodiments of the present invention. The well-known specific contents or common sense in the scheme are not described in detail here (including but not limited to abbreviations, abbreviations, and units commonly used in the field). It should be pointed out that the above embodiments do not limit the present invention in any way. For those skilled in the art, all technical solutions obtained by equivalent replacement or equivalent transformation fall within the protection scope of the present invention. The protection scope required by the present invention shall be based on the content of its claims, and the specific implementation methods and other records in the specification can be used to interpret the content of the claims.

Claims

1. A primer-probe combination for detecting Mycobacterium leprae, characterized in that: The primer-probe combination comprises: Upstream outer primer F3, downstream outer primer B3, upstream inner primer FIP, downstream inner primer BIP; The upstream outer primer F3 is shown in SEQ ID NO.1; The downstream outer primer B3 is shown in SEQ ID NO.2; The upstream inner primer FIP is shown in SEQ ID NO.3; The downstream inner primer is BIP as shown in SEQ ID NO.

4.

2. The primer-probe combination according to claim 1, characterized in that: The primer-probe combination includes: an upstream loop primer LF and a downstream loop primer LB; The upstream loop primer LF is shown in SEQ ID NO.5; The downstream loop primer LB is shown as SEQ ID NO.

6.

3. The primer-probe combination according to claim 1, characterized in that: The primer-probe combination includes: fluorescent probe HFman-probe; The fluorescent probe HFman-probe is shown as SEQ ID NO.

7.

4. A kit, characterized in that: The kit comprises the primers according to claim 1 and claim 2 and the fluorescent probe according to claim 3.

5. Use of the primer-probe combination as claimed in claim 1, 2 or 3 in the specific detection of Mycobacterium leprae.

6. The method for detecting the application of Bacillin as claimed in claim 5, characterized in that: The HiFi-LAMP detection method was performed at 64°C for 50 minutes, including the use of a high-fidelity DNA polymerase and the above primer-probe combination to detect Mycobacterium leprae.

7. The method according to claim 6, characterized in that Method for determining test results: The HiFi-LAMP reaction results are monitored by a real-time fluorescence detection system, and a clear "S"-shaped curve is detected within 30 minutes, which is considered positive.

Images