KASP molecular marker closely linked with early fruiting property of larch and application of KASP molecular marker

Abstract

The invention discloses a KASP molecular marker closely linked with the early fruiting property of larch and application of the KASP molecular marker, and relates to the technical field of forest molecular marker-assisted breeding. The KASP molecular marker is characterized in that the basic group of G / A at the 1431418th site of a chromosome sca 1151: 1431418 is mutated; the nucleotide sequence of the KASP molecular marker is as shown in SEQ ID NO. 4. The KASP molecular marker primer disclosed by the invention can be used for rapidly identifying the premature fruit phenotype of the larch, has the advantages of accuracy, rapidness, low cost, short identification period, simplicity and convenience in operation and the like, can be used for assisting in new strain breeding of the larch, and has a wide application prospect.

Description

Technical Field

[0001] The invention belongs to the technical field of forest tree molecular marker assisted breeding, and particularly relates to a KASP molecular marker closely linked to the early fruiting property of larch and an application thereof. Background Art

[0002] Larix olgensis belongs to the genus Larix (Pinaceae). It has the characteristics of strong adaptability, early rapid growth, fast forestation, few diseases and pests, and excellent material quality. It is an important pulpwood and construction material species in Northeast, Northwest, North China and southern subalpine regions of my country, and is also the main afforestation species for returning farmland to forest and shelterbelt projects. Therefore, developing molecular markers closely linked to early fruiting and using molecular markers to assist in the selection of early fruiting in larch will effectively save breeding time and land, accelerate the breeding process, and have important practical significance for the selection and promotion of larch varieties. KASP (Kompetitive Allele-Specific PCR), that is, competitive allele-specific PCR, has the advantages of high throughput, low cost, high efficiency, and no need for electrophoresis detection compared with traditional PCR methods. Summary of the invention

[0003] The first object of the present invention is to provide a KASP molecular marker that is closely linked to the early fruiting of larch and a primer for detecting the KASP molecular marker.

[0004] The present invention also aims to provide a method for identifying the early fruiting of larch.

[0005] The last object of the present invention is to provide a reagent, primer or method for detecting the above KASP molecular marker and its application in identifying the early-fruiting phenotype of larch and in molecular marker-assisted breeding of larch.

[0006] The above-mentioned first object of the present invention can be achieved by the following technical scheme: a KASP molecular marker (nucleotide sequence is shown in SEQ ID NO.4) closely linked to the precociousness of larch, wherein the KASP molecular marker is designed according to a SNP site on the larch genome, wherein the SNP site has a G / A base mutation, and the corresponding genotypes include G:G, G:A and A:A, wherein the A:A and G:A genotypes show precocious genotypes, and the G:G genotype shows a non-precocious genotype, and the KASP molecular marker can be obtained by amplification of primers shown in SEQ ID NO.1 to SEQ ID NO.3.

[0007] The nucleotide sequence of the KASP molecular marker is as follows:

[0008] CACCTATGCATATGTTATATAAAAGGTTTTTCAAAGTTTTAAAAACTGATTTTGTC GCTTATTGCTTGGAGGAGAAGAAGTCGCGGGAAACACGTCGTTGTTGTCGTCAACTA GAACAGAAGTCAACAACCTCACTTCACAGGTATCTC(G / A)AAACCATCAGTGTTTAGA TTTTGTTTCCCAAATGGAGAAAACCCAAGACCTTCTTCCCTTCAATGAAAGTTCAGAT GAAAACAAGGAGCTTGTAGTTGACAGGGAAAGGGATATTTTTGACCCTGTTTTGTCTGTGTAGTATTTTGCAGT.

[0009] One SNP site of the present invention is A in early-bearing plants and is G in non-early-bearing plants.

[0010] The present invention also provides a set of primers for detecting a KASP molecular marker closely linked to the precociousness of larch, the set of primers comprising two specific upstream primers sca1151:1431418-F3 and sca1151:1431418-F4 and a universal downstream primer sca1151:1431418-R2, wherein the nucleotide sequence of the upstream primer sca1151:1431418-F3 is as shown in SEQ ID NO.1, the nucleotide sequence of the upstream primer sca1151:1431418-F4 is as shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer sca1151:1431418-R2 is as shown in SEQ ID As shown in NO.3, a FAM fluorescent label sequence is added to the 5' end of the upstream primer sca1151:1431418-F3, and a VIC fluorescent label sequence is added to the 5' end of the upstream primer sca1151:1431418-F4.

[0011] Specifically, the present invention provides a set of primers for detecting KASP molecular markers closely linked to the precociousness of larch, comprising three primers, two upstream primers sca1151:1431418-F3 and sca1151:1431418-F4 are specific primers designed according to the SNP site sca1151:1431418, and the downstream primer sca1151:1431418-R2 is a universal primer; the 3' end of the upstream primer is a variant base, and the 5' end is respectively connected to carboxyfluorescein FAM (GAAGGTGACCAAGTTCATGCT) and phosphoramidite fluorescein VIC (GAAGGTCGGAGTCAACGGATT) fluorescent signal label sequences, and the three primer sequences are as follows:

[0012] 1)sca1151:1431418-F3:

[0013] 5'- GAAGGTGACCAAGTTCATGCT AACAAAATCTAAACACTGATGGTTTT-3' (SEQ ID NO. 1), the underlined portion is the sequence of fluorescein FAM.

[0014] 2)sca1151:1431418-F4:

[0015] 5'- GAAGGTCGGAGTCAACGGATT AACAAAATCTAAACACTGATGGTTTC-3' (SEQ ID NO. 2), the underlined portion is the sequence of fluorescein VIC.

[0016] 3)sca1151:1431418-R2:

[0017] 5'-ACTAGAACAGAAGTCAACAACCTCAC-3' (SEQ ID NO. 3).

[0018] The primers are used for PCR amplification, the amplified products are subjected to fluorescence detection, and the fluorescence signals are combined with the marker information to complete the genotyping.

[0019] The last object of the present invention can be achieved by the following technical solution: use of a reagent for detecting the KASP molecular marker in identifying the early-bearing phenotype of larch.

[0020] The invention also provides application of a reagent for detecting the KASP molecular marker in larch molecular marker-assisted breeding.

[0021] The present invention also provides the use of the primers for detecting the KASP molecular marker in identifying the early-fruiting phenotype of larch and in molecular marker-assisted breeding of larch.

[0022] The present invention further provides application of the method in identifying the early-bearing phenotype of larch and application of the method in molecular marker-assisted breeding of larch.

[0023] Specifically, when the primers or method for detecting the KASP marker closely linked to the precocity of larch are used for assisted selection of precocity of larch, the precocity phenotype of individual plants in the population is consistent with the band pattern amplified by the primers of the molecular marker.

[0024] The present invention has the following advantages:

[0025] The KASP molecular marker primers of the present invention can quickly identify the early-bearing phenotype of larch, and have the advantages of accuracy, rapidity, low cost, short identification cycle, simple operation, etc., can assist in the breeding of new larch strains, and have broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 It is the genotyping diagram of the larch population using the KASP molecular marker primer sca1151:1431418 in Example 2. The genotype is G:G type, the fluorescent signal is blue, and the material is concentrated near the Y axis, which is determined to be non-precocious homozygous material; the genotype is G:A type, the fluorescent signal is green, and it is concentrated near the middle position, which is determined to be early-bearing heterozygous material; the genotype is A:A type, the fluorescent signal is red, and it is concentrated near the X axis, which is determined to be early-bearing homozygous material. DETAILED DESCRIPTION

[0027] In order to make the objectives, technical solutions and advantages of the embodiments of the present invention more clearly understood, the spirit of the contents disclosed by the present invention will be described in detail below. After understanding the embodiments of the contents of the present invention, any technician in the relevant technical field can change and modify them according to the techniques taught by the contents of the present invention without departing from the spirit and scope of the contents of the present invention.

[0028] The exemplary embodiments of the present invention and the description thereof are used to explain the present invention, but are not intended to limit the present invention.

[0029] Example 1

[0030] In this example, 310 hybrid larch plants from 39 populations were used as materials to construct a gene pool, and RAD-seq was performed to obtain SNP sites and conduct genome-wide association analysis with the early-bearing trait, and the SNP site sca1151:1431418 (such as Figure 1 shown).

[0031] According to the SNP site information, PrimerPicker Lite for KASPar Version 0.26 (https: / / www.biosearchtech.com / ) was used to develop KASP markers. One marker contains three primers, of which the two upstream primers sca1151:1431418-F3 and sca1151:1431418-F4 are specific primers designed according to the SNP site sca1151:1431418, and the downstream primer sca1151:1431418-R2 is a universal primer; the 3' end of the upstream primer is a variant base, and the 5' end is connected to the carboxyfluorescein FAM (GAAGGTGACCAAGTTCATGCT) and phosphoramidite fluorescein VIC (GAAGGTCGGAGTCAACGGATT) fluorescent signal tag sequences, respectively. The three primer sequences are as follows:

[0032] 1)sca1151:1431418-F3:

[0033] 5'-GAAGGTGACCAAGTTCATGCTAACAAAATCTAAACACTGATGGTTTT-3' (SEQ ID NO. 1), the underlined portion is the sequence of fluorescein FAM.

[0034] 2)sca1151:1431418-F4:

[0035] 5'-GAAGGTCGGAGTCAACGGATTAACAAAATCTAAACACTGATGGTTTC-3' (SEQ ID NO. 2), the underlined portion is the sequence of fluorescein VIC.

[0036] 3)sca1151:1431418-R2:

[0037] 5'-ACTAGAACAGAAGTCAACAACCTCAC-3' (SEQ ID NO. 3).

[0038] The primers can also be developed into a kit for use.

[0039] Example 2

[0040] The PCR amplification of larch single plants using the above-mentioned labeled primers and the detection of PCR products include the following steps:

[0041] (1) Larch DNA extraction

[0042] The experimental material is fresh leaves of a single larch plant, and the steps for extracting genomic DNA are as follows:

[0043] ① Take a small amount of fresh leaves and put them into a 2mL centrifuge tube, add steel balls, grind them on a grinder, shake 30 times per second for 2 minutes, add 800μL of 2% CTAB extract, mix well, and place in a 65℃ water bath for 1h (shake well every 10 minutes);

[0044] ② After standing to room temperature, add 800 μL of chloroform: isoamyl alcohol (volume ratio 24:1), mix gently for 10 minutes, and then centrifuge at 12000 rpm for 15 minutes. Transfer the supernatant (about 600 μL) to a new 1.5 mL centrifuge tube;

[0045] ③ Add 2 / 3 volume of isopropanol to the supernatant, mix gently and place at -20℃ for 30min~1h;

[0046] ④12000rmp, centrifuge for 10min, discard the supernatant;

[0047] ⑤ Add anhydrous ethanol to the centrifuge tube to wash the DNA precipitate once, then wash it once with 75% (volume percentage) ethanol, and blow dry it on the clean bench;

[0048] ⑥ Add 50 μL TE (or ddH2O) to dissolve and use as larch genomic DNA.

[0049] (2) Using larch genomic DNA as a template, PCR amplification was performed using the KASP molecular marker primers in Example 1.

[0050] PCR amplification was performed in the CFX fluorescence quantification instrument of BIO-RAD Company. The 5 μL reaction system included:

[0051] 1.25 μL of 100 ng / μL genomic DNA, 2.5 μL of HiGeno2×ProbeMixA, 0.25 μL of each upstream primer at a concentration of 10 mM, and 0.75 μL of each downstream primer at a concentration of 10 mM.

[0052] The PCR amplification program was as follows: pre-denaturation at 95°C for 10 min, denaturation at 95°C for 20 s, annealing at 61-55°C for 1 min, with the annealing temperature decreasing by 0.6°C per cycle for a total of 10 cycles, followed by denaturation at 95°C for 20 s and extension at 55°C for 1 min. After 27 cycles, the fluorescence signal was read at 25°C for 1 min.

[0053] (3) Amplification results:

[0054] This example uses the primers in Example 1 to perform PCR amplification, performs fluorescence detection on the amplified product, combines the fluorescence signal with the label information, completes the genotyping, and presents it in the form of a chart; Figure 1As shown, the figure is divided into X and Y axes, each data point represents an independent DNA sample, and samples with the same genotype are clustered together.

[0055] like Figure 1 After the PCR product was read by fluorescence, the genotype was C:C type (corresponding to G:G genotype), the fluorescence signal was blue, and the material was concentrated near the Y axis, which was determined to be non-precocious homozygous material; the genotype was C:T type (corresponding to G:A genotype), the fluorescence signal was green, and it was concentrated near the middle position, which was determined to be precocious heterozygous material; the genotype was T:T type (corresponding to A:A genotype), the fluorescence signal was red, and it was concentrated near the X axis, which was determined to be precocious homozygous material.

[0056] Since the KASP molecule marker is a G / A base mutation, but the primers were designed in reverse order, the genotypes of the PCR products after fluorescence detection were C / C, C / T, and TT.

[0057] This example uses KASP molecular markers to achieve assisted breeding of larch based on the screening of the early-bearing phenotype of larch.

[0058] Table 1

[0059] CHROM POS REF ALT sca1151 1431418 G A

Claims

1. An application of a KASP molecular marker closely linked to the early fruiting of larch, characterized in that The molecular marker is used to assist larch breeding; the KASP molecular marker has a G / A base mutation at position 1431418 of chromosome sca1151:1431418; the nucleotide sequence of the KASP molecular marker is shown in SEQ ID NO.

4.

2. The use according to claim 1, characterized in that The auxiliary larch breeding is achieved by screening larch based on the early-bearing phenotype of larch.

3. The use according to claim 1, characterized in that The G / A base mutation corresponds to genotypes including G:G, G:A and A:A; wherein the A:A and G:A genotypes are precocious genotypes, and the G:G genotype is a non-precocious genotype.

4. The use according to claim 1 or 2, characterized in that The auxiliary larch breeding is specifically carried out in the following manner: (1) extracting DNA from the larch to be tested; (2) performing PCR amplification using the primers to obtain a PCR product; (3) After fluorescence detection, the PCR products were genotyped: the blue fluorescent signal was recorded as the G:G genotype, the green fluorescent signal was recorded as the G:A genotype, and the red fluorescent signal was recorded as the A:A genotype; among them, the genotype of A:A type was determined to be a homozygous material with early fruiting; the genotype of G:A type was determined to be a heterozygous material with early fruiting; the genotype of G:G was determined to be a homozygous material without early fruiting.

5. The use according to claim 4, characterized in that The described primers are used for PCR amplification, wherein the primer sequences are as follows: sca1151:1431418-F3: 5’- GAAGGTGACCAAGTTCATGCT AACAAAATCTAAACACTGATGGTTTT-3’; sca1151:1431418-F4: 5’- GAAGGTCGGAGTCAACGGATT AACAAAATCTAAACACTGATGGTTTC-3’; sca1151:1431418-R2: 5'-ACTAGAACAGAAGTCAACAACCTCAC-3'.

6. A primer for detecting a KASP molecular marker closely linked to the early fruiting of larch, characterized in that The primers include three primers, two upstream primers sca1151:1431418-F3 and sca1151:1431418-F4; and a downstream primer sca1151:1431418-R2. The nucleotide sequences of sca1151:1431418-F3, sca1151:1431418-F4 and sca1151:1431418-R2 are shown in the sequence listing SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.

3.

7. A kit comprising the primers according to claim 6.

Images