Honeysuckle stem and red-white honeysuckle stem molecule identification method based on DNA bar code

Abstract

The invention discloses a DNA bar code-based honeysuckle stem and red-white honeysuckle stem molecular identification method, and belongs to the technical field of traditional Chinese medicine detection. DNA bar code genes for identifying honeysuckle stems and red and white honeysuckle stems are cell nucleus genes Lj7A621T37 with INDEL difference and / or chloroplast genes trnH-psbA with SNP (Single Nucleotide Polymorphism) difference; a PCR (Polymerase Chain Reaction) amplification upstream primer and a PCR amplification downstream primer of the nuclear gene Lj7A621T37 with INDEL difference are respectively as shown in SEQ ID NO. 1 and EQ ID NO. 2; a PCR (Polymerase Chain Reaction) amplification upstream primer and a PCR amplification downstream primer of the chloroplast gene trnH-psbA with SNP (Single Nucleotide Polymorphism) difference are respectively as shown in SEQ ID NO. 3 and SEQ ID NO. 4. The accurate identification result can be obtained by utilizing the two pairs of specific primers and the two specific sites, and the detection method is efficient and convenient and can be used for identifying the authenticity of the honeysuckle stem medicinal material.

Description

Technical Field

[0001] The invention belongs to the technical field of traditional Chinese medicine detection, and particularly relates to a molecular identification method of honeysuckle and red and white honeysuckle based on DNA barcodes. Background Art

[0002] Lonicera japonica Lonicera japonica The dried stems and branches of Thunb. are harvested in autumn and winter and dried in the sun. The medicinal material is long cylindrical, branched, and has a brownish red to dark brown surface, some are grayish green, smooth or covered with hairs. Honeysuckle vine has high medicinal value and has the effects of clearing away heat and detoxifying, dispersing wind and unblocking meridians. It is often used clinically for fever caused by febrile diseases, dysentery caused by heat toxins, carbuncle, sore, rheumatic heat arthralgia, and red, swollen, hot and painful joints.

[0003] Red and white honeysuckle Lonicera japonica var. chinensis is honeysuckle Lonicera japonica Thunb. is a natural variant, which is not a medicinal variety specified in the Pharmacopoeia of the People's Republic of China, and there are differences in the main active ingredients such as chlorogenic acid and luteolin. However, it is also cultivated in large quantities in actual production. In the autumn and winter harvest season, the stems and branches of red and white honeysuckle are often mixed with honeysuckle vines. After drying and processing, they become mixed counterfeit products of honeysuckle vine medicinal materials, which cannot be distinguished, affecting clinical use and efficacy. Therefore, it is urgent to establish a method for quickly and accurately identifying honeysuckle vines and their counterfeits, red and white honeysuckle vines.

[0004] DNA barcoding technology can achieve rapid identification of different varieties and evolutionary relationship analysis by analyzing the evolutionarily conserved mitochondrial genome, chloroplast genome and ribosome-related DNA sequences. It has the advantages of strong specificity, high accuracy and simple operation in the molecular analysis and identification of traditional Chinese medicine. Summary of the invention

[0005] In view of the problems existing in the prior art, the present invention provides a molecular identification method of honeysuckle and red and white honeysuckle based on DNA barcodes. The detection method is efficient and convenient, and can be used for authenticity identification of honeysuckle medicinal materials.

[0006] The present invention is achieved through the following technical solutions: A molecular identification method for honeysuckle and red and white honeysuckle based on DNA barcodes, wherein the DNA barcode genes for identifying honeysuckle and red and white honeysuckle are the nuclear gene Lj7A621T37 with INDEL differences and / or the chloroplast gene trnH-psbA with SNP differences; The upstream primer and downstream primer for PCR amplification of the nuclear gene Lj7A621T37 with INDEL differences are shown in SEQ ID NO.1 and SEQ ID NO.2 respectively; The upstream primer and downstream primer for PCR amplification of the chloroplast gene trnH-psbA with SNP differences are shown in SEQ ID NO.3 and SEQ ID NO.4 respectively.

[0007] Furthermore, the molecular identification method of honeysuckle and red and white honeysuckle based on DNA barcodes includes the following steps: (1) Extract DNA from the sample to be tested; (2) Using the DNA as a template, PCR amplification was performed using upstream and downstream primers corresponding to the nuclear gene Lj7A621T37 with INDEL differences and / or the chloroplast gene trnH-psbA with SNP differences; (3) The gene fragments amplified in step (2) are separated by agarose gel electrophoresis, and the single bright portion of the band is selected for sequencing analysis and sequence peak analysis to determine whether the sample to be tested is Lonicera japonica or Lonicera rubra.

[0008] Furthermore, the system for PCR amplification in step (2) is: DDW 20µL, Takar premix Tap dye 25µL, forward primer 2µL, reverse primer 2µL, template 1µL.

[0009] Furthermore, the PCR amplification program in step (2) is: 95°C for 180s; 98°C for 10s, 57°C for 30s, 72°C for 45s, 28 cycles; 72°C for 5min.

[0010] Furthermore, after amplification of the nuclear gene Lj7A621T37 with INDEL differences in step (3), the tandem repeat sequence GGAGAA sequence isolated was judged to be Lonicera japonica if there were 4 copies of the sequence, and it was judged to be Lonicera japonica if there were 3 copies of the sequence but the 219th to 224th bases (GGAGAA) were missing.

[0011] Furthermore, in step (3), the chloroplast gene trnH-psbA with SNP difference was amplified and separated. The 331st base sequence of the sequence was G, which was determined to be Lonicera japonica. The 331st base sequence was A, which was determined to be Lonicera japonica.

[0012] The beneficial effects achieved by the present invention are: The present invention uses specific primers of the nuclear gene Lj7A621T37 with INDEL differences and the chloroplast gene trnH-psbA with SNP differences to perform PCR amplification and sequencing detection, and distinguishes Lonicera japonica and red and white Lonicera japonica according to the different base conditions of the sites. Using two pairs of specific primers and two specific sites, accurate identification results can be obtained. The detection method is efficient and convenient, and can be used for authenticity identification of Lonicera japonica medicinal materials. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 This is the gel electrophoresis diagram of the amplified product of the nuclear gene Lj7A621T37 with INDEL differences in Example 2; Figure 2 This is a comparative analysis diagram of the amplified product sequences of the nuclear gene Lj7A621T37 with INDEL differences between honeysuckle and red and white honeysuckle in Example 2; Figure 3 This is a peak analysis diagram of the amplification product of the nuclear gene Lj7A621T37 with INDEL differences between honeysuckle and red and white honeysuckle in Example 2; Figure 4 The gel electrophoresis diagram of the amplified product of the chloroplast gene trnH-psbA with SNP difference in Example 3; Figure 5 This is a comparative analysis diagram of the amplified product sequences of the chloroplast gene trnH-psbA with SNP differences between Honeysuckle and Red and White Honeysuckle in Example 3; Figure 6 This is a peak analysis diagram of the amplified products of the chloroplast gene trnH-psbA in which SNP differences exist between Honeysuckle and Red and White Honeysuckle in Example 3. DETAILED DESCRIPTION

[0014] The present invention is further explained below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not used to limit the scope of the present invention. After reading the present invention, various equivalent modifications of the present invention by those skilled in the art all fall within the scope defined by the claims attached to this application.

[0015] The honeysuckle nuclear gene Lj7A621T37 with INDEL differences and / or the chloroplast gene trnH-psbA with SNP differences were used as DNA barcode genes (Lj7A621T37 encodes a phosphoglyceride transfer family protein, and trnH-psbA is a plant chloroplast photosynthesis-related gene). The upstream primer and downstream primer for PCR amplification of the nuclear gene Lj7A621T37 with INDEL differences are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively; the upstream primer and downstream primer for PCR amplification of the chloroplast gene trnH-psbA with SNP differences are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively.

[0016] SEQ ID NO.1 (Lj7A621T37-F): 5'-AGTGTCGGAGAGTCTCAAGC-3'; SEQ ID NO.2 (Lj7A621T37-R): 5'-TTGTCTCCTCGATTGCTTCGA-3'; SEQ ID NO.3 (trnH-psbA-F): 5'-ACGGGAATTGAACCCGCGCA -3'; SEQ ID NO. 4 (trnH-psbA-R): 5'-CGCGCATGGTGGATTCACAATCC-3'.

[0017] In the following examples, the honeysuckle and red and white honeysuckle samples (to be detected) were taken from the nursery of Shandong Institute of Traditional Chinese Medicine.

[0018] Example 1 (1) Extract DNA from the sample to be tested: 1) Disinfect the centrifuge tubes, tweezers, and scissors used in advance; 2) Use Nobel DNA extraction kit to extract total DNA, select 100 mg of fresh honeysuckle vine and put it into a centrifuge tube containing steel beads for sampling; 3) At room temperature, add 700 µl of buffer ATS to each centrifuge tube, vortex to mix, and let stand for 10 minutes, inverting and mixing 3 times; 4) Centrifuge at 12,000 rpm for 5 minutes and transfer the supernatant to a clean new centrifuge tube; 5) Add 0.5 times the volume of isopropanol, mix thoroughly, transfer all the liquid to the adsorption column AC, centrifuge at 12000rpm for 1 minute, and discard the waste liquid in the collection tube; 6) Add 600 µl of WB2 to the adsorption column, centrifuge at 12,000 rpm for 1 minute, and discard the waste liquid; 7) Repeat step 6 above); 8) Place the adsorption column AC back into the collection tube, centrifuge at 12000 rpm for 2 minutes, and leave at room temperature for 5 minutes; 9) Place the adsorption column AC in a new centrifuge tube and add 30µl of eluent EB to the adsorption column. Place the column at room temperature for 3 minutes and centrifuge.

[0019] (2) DNA barcode PCR amplification: using the DNA extracted in step (1) as a template, PCR amplification was performed using upstream and downstream primers corresponding to the nuclear gene Lj7A621T37 and / or the chloroplast gene trnH-psbA with INDEL differences; The composition of the PCR amplification system is as shown in Table 1: Table 1 The PCR amplification program is shown in Table 2 below: Table 2 (3) The gene fragments amplified in step (2) are separated by agarose gel electrophoresis, and the single bright part of the band is selected for sequencing analysis and sequence peak analysis to determine whether the sample to be tested is honeysuckle or red and white honeysuckle; the tandem repeat sequence GGAGAA sequence separated after amplification of the nuclear gene Lj7A621T37 is judged to be honeysuckle if there are 4 such repeats, and red and white honeysuckle if there are 3 such repeats and the 219th to 224th bases (GGAGAA) are missing; the sequence separated after amplification of the chloroplast gene trnH-psbA is judged to be honeysuckle if the 331st base sequence is G, and red and white honeysuckle if the 331st base sequence is A.

[0020] Example 2 (1) Extracting DNA from Lonicera japonica and Lonicera rubra respectively, the extraction method is the same as that in Example 1; (2) using the DNA extracted in step (1) as a template, PCR amplification was performed using the upstream primer (SEQ ID NO. 1) and the downstream primer (SEQ ID NO. 2) for PCR amplification of the nuclear gene Lj7A621T37. The amplification system and amplification procedure are shown in Tables 1 and 2 of Example 1. (3) 4 µl of PCR product was subjected to agarose gel electrophoresis. The agarose gel electrophoresis diagram of PCR identification is shown in the figure below. Figure 1 As shown, band 1 is honeysuckle, band 2 is red and white honeysuckle, and band 3 is sterile water. The single bright band was selected for subsequent sequencing analysis. The DNA sequence isolated after amplification of the honeysuckle cell nuclear gene Lj7A621T37 is: CGGGGAAGGAAGTGAGACGAGATCGGCTTCCTTCAAAGAGGAAACAAACGTTGTTGGTGAGCTTCCTGACCCACAGAAGAAGGCCTTGGACGAACTCAAAGTTATTGTTCAAGAAGCTCTCAACAAGCATG AGTTTACTGTTCTACCTCCACCTCCACCGCCGGCCAAAGAAGAAGACAAGCCCGTCCTCGACGACAAGGAGAAGGAAGGAGAAGGAGAAAGAGAAAGAGAAAGAAATTGAAAAAGAATCCAAGCCTGA; The DNA sequence isolated after amplification of the nuclear gene Lj7A621T37 of honeysuckle was: GGGCCGGGAGGGAGAGACGAGATCGGCTTCCTTCAAAGAGGAAACAAACGTTGTTGGTGAGCTTCCTGACCCACAGAAGAAGGCCTTGGACGAACTCAAAGTTATTGTTCAAGAAGCTCTCAACAAGCATGAGTTTACTGTTCTACCTCCACCTCCACCGCCGGCCAAAGAAGAAGACAAGCCCGTCCTCGACGACAAGGAGAAGGAGAAGGAGAAAGAGAAAGAAATTGAAATTGAATCCAAAT; The sequence comparison analysis of honeysuckle and red and white honeysuckle was carried out using online sequence analysis software. The results are as follows Figure 2 As shown in Figure 2, there are INDEL base differences between honeysuckle and red and white honeysuckle at positions 219 to 224. The results of DNA peak analysis (sequence peak analysis using Snap gene software) are as follows Figure 3 As shown: It was found that the peak graph of the difference site from 219 to 224 was single, which was a homozygous INDEL difference site, so the INDEL difference from 219 to 224 was used as the core site for distinguishing honeysuckle and red and white honeysuckle. Therefore, the tandem repeat sequence GGAGAA sequence isolated after amplification of the nuclear gene Lj7A621T37 was judged to be honeysuckle if there were 4 repeats of this sequence, and if there were 3 repeats of this sequence and the 219th to 224th bases (GGAGAA) were missing, it was red and white honeysuckle.

[0021] Example 3 (1) Extracting DNA from Lonicera japonica and Lonicera rubra respectively, the extraction method is the same as that in Example 1; (2) Using the DNA extracted in step (1) as a template, PCR amplification was performed using the upstream primer (SEQ ID NO. 3) and the downstream primer (SEQ ID NO. 4) for PCR amplification of the chloroplast gene trnH-psbA. The amplification system and amplification procedure are shown in Tables 1 and 2 of Example 1. (3) 4 µl of PCR product was subjected to agarose gel electrophoresis. The agarose gel electrophoresis diagram of PCR identification is shown in the figure below. Figure 4 As shown, band 1 is honeysuckle, band 2 is red and white honeysuckle, and band 3 is sterile water. The single bright band was selected for subsequent sequencing analysis. The DNA sequence isolated after amplification of the honeysuckle chloroplast gene trnH-psbA is: AGCAAGCTCCATCTACAAATGGATAAGACCCGGTCTTAGTGTATACGAGTTTTAAAAAAGAAAAAGGAGCAATAATCCCCCTCTTGTTTTATCAAGAGGGCACCATTGCTTCTTTTTTTATTTAACTTAACAGTTACCTATTTTCTTTCAAGAAAAATAGTAAATCTTCTTATTTTTAGGGGCGGGTCCTGATTGTATTTTGGGCTTTCA TTTTTGATTCTGTATGAAAAATCTTTATATCCTCTAAAATAAAAGTAAAATAAAAGAAAAACTGTTGGAATTTTTTTGCTGACTTATCTATAATTGTACTTGAGAAAAAAGAAAGAAAAATAATGAATGGCTTAACTAGGAACTAATAGGTAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCACCCATGCGCGA; The DNA sequence isolated after amplification of the red and white honeysuckle chloroplast gene trnH-psbA is: CTAGAGCTCTTGAGCTCCATCTACAAATGGATAAGACCCGGTCTTAGTGTATACGAGTTTTAAAAAAGAAAAAGGAGCAATAATCCCCCTCTTGTTTTATCAAGAGGGCACCATTGCTTCTTTTTTTATTTAACTTAACAGTTACCTATTTTCTTTCAAGAAAAATAGTAAATCTTCTTATTTTTAGGGGCGGG TCCTGATTGTATTTTGGGCTTTCATTTTTGATTCTGTATGAAAAATCTTTATATCCTCTAAAATAAAAGTAAAATAAAAGAAAAACTGTTGGAATTTTTTTGCTGACTTATCTATAATTGTACTTGAGAAAAAAAGAAAAATAATGAATGGCTTAACTAGGAACTAATAGGTAGGGGGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCACCCC; The sequence comparison analysis of honeysuckle and red and white honeysuckle was carried out using online sequence analysis software. The results are as follows Figure 5As shown in Figure 2, there are two base differences between honeysuckle and red and white honeysuckle at position 331. Honeysuckle has base G, while red and white honeysuckle has base A. The results of DNA peak analysis (sequence peak analysis using Snap gene software) are shown in Figure 2. Figure 6 As shown: It was found that the peak graph of the differential site was single, which was a homozygous SNP differential site, so the SNP differential site at position 331 was used as the core site for distinguishing Lonicera japonica from red and white Lonicera japonica. Therefore, the 331st base sequence of the sequence isolated after amplification of the chloroplast gene trnH-psbA was G, which was judged to be Lonicera japonica, and the 331st base sequence was A, which was judged to be red and white Lonicera japonica.

Claims

1. A molecular identification method of honeysuckle and red and white honeysuckle based on DNA barcodes, characterized in that: The DNA barcode genes for identifying Lonicera japonica and Lonicera rubra are the nuclear gene Lj7A621T37 with INDEL differences and / or the chloroplast gene trnH-psbA with SNP differences; The upstream primer and downstream primer for PCR amplification of the nuclear gene Lj7A621T37 with INDEL differences are shown in SEQ ID NO.1 and SEQ ID NO.2 respectively; The upstream primer and downstream primer for PCR amplification of the chloroplast gene trnH-psbA with SNP differences are shown in SEQ ID NO.3 and SEQ ID NO.4 respectively.

2. The method for molecular identification of Lonicera japonica and Lonicera rubra based on DNA barcodes according to claim 1, characterized in that: The molecular identification method of honeysuckle and red and white honeysuckle based on DNA barcodes includes the following steps: (1) Extract DNA from the sample to be tested; (2) Using the DNA as a template, PCR amplification was performed using upstream and downstream primers corresponding to the nuclear gene Lj7A621T37 with INDEL differences and / or the chloroplast gene trnH-psbA with SNP differences; (3) The gene fragments amplified in step (2) are separated by agarose gel electrophoresis, and the single bright portion of the band is selected for sequencing analysis and sequence peak analysis to determine whether the sample to be tested is Lonicera japonica or Lonicera rubra.

3. The method for molecular identification of Lonicera japonica and Lonicera rubra based on DNA barcodes according to claim 2, characterized in that: The PCR amplification system in step (2) is: DDW 20µL, Takar premix Tap dye 25µL, forward primer 2µL, reverse primer 2µL, template 1µL.

4. The method for molecular identification of Lonicera japonica and Lonicera rubra based on DNA barcodes according to claim 2, characterized in that: The PCR amplification program in step (2) is: 95°C for 180s; 98°C for 10s, 57°C for 30s, 72°C for 45s, 28 cycles; 72°C for 5min.

5. The method for molecular identification of Lonicera japonica and Lonicera rubra based on DNA barcodes according to claim 2, characterized in that: In step (3), the tandem repeat sequence GGAGAA sequence isolated after amplification of the nuclear gene Lj7A621T37 with INDEL differences was judged to be Lonicera japonica if there were 4 copies of the sequence, and Lonicera japonica if there were 3 copies of the sequence but the 219th to 224th bases GGAGAA were missing.

6. The method for molecular identification of Lonicera japonica and Lonicera rubra based on DNA barcodes according to claim 2, characterized in that: In step (3), after amplification of the chloroplast gene trnH-psbA with SNP differences, the sequence separated has a base sequence of G at the 331st position, which is judged to be Lonicera japonica, and has a base sequence of A at the 331st position, which is judged to be Lonicera japonica.

Images