Application of carnosic acid in long-term anti-vascular aging and inhibition of ubiquitination level of TP53

Abstract

The invention discloses application of carnosic acid in resisting vascular aging for a long time and inhibiting the ubiquitination level of TP53, the carnosic acid acts on TP53 protein to inhibit the ubiquitination level and nuclear translocation of K63 of the TP53 protein, so that the proliferation time of vascular endothelial cells in the replication and aging process is prolonged, the damage repair capacity of the vascular endothelial cells is improved, and the application of the carnosic acid in resisting vascular aging for a long time and inhibiting the ubiquitination level of the TP53 protein is realized. The damage repair capability comprises proliferation activity, migration capability and angiogenesis capability. According to the application disclosed by the invention, the direct action target TP53 of CA for resisting vascular senescence is defined for the first time, and the application has profound significance on research on vascular senescence and TP53 protein and provides a new scheme for treatment of vascular senescence.

Description

Technical Field

[0001] The present invention belongs to the field of life science technology, and relates to the application of carnosic acid in long-term anti-vascular aging and inhibition of TP53 ubiquitination level, and specifically relates to the application of carnosic acid, a small molecule drug of medicinal and edible homology, in exerting anti-vascular aging effect by targeted inhibition of TP53 protein K63 ubiquitination level. Background Art

[0002] Carnosic acid (CA), a small molecule with both medicinal and edible properties, is a phenolic diterpenoid compound found in rosemary and other Lamiaceae plants. It has antioxidant and antibacterial properties and is widely used in the food, nutrition, health care and cosmetics industries. Current studies suggest that CA activates the NRF2 / HO-1 antioxidant signaling pathway by targeting KEAP1, exerting anti-inflammatory and antioxidant effects, thereby inhibiting the progression of aging-related diseases such as brain degenerative diseases and cardiovascular diseases.

[0003] The previous study of the present invention found that CA can significantly improve the vascular aging phenotype of mice, such as improving aortic compliance, reducing stiffness, inhibiting the progression of atherosclerotic plaques, etc. However, in the process of vascular aging, simple anti-inflammatory or antioxidant treatment cannot effectively delay vascular aging and reduce the risk of cardiovascular disease, suggesting that CA has other targets in the process of vascular aging.

[0004] Tumor protein p53 plays a crucial role in the regulation of the cell cycle. TP53 protein can respond to cell stress or DNA damage and activate multiple transcriptional targets. It plays a tumor suppressor role in various tumor types, inducing growth arrest or apoptosis depending on the physiological environment and cell type. At present, the remaining functions of this protein still need to be further explored. Summary of the invention

[0005] The first objective of the present invention is to provide the use of carnosic acid in the preparation of long-term anti-vascular aging drugs in view of the deficiencies in the prior art.

[0006] Preferably, carnosic acid acts on TP53 protein.

[0007] Preferably, carnosic acid prolongs the proliferation time of vascular endothelial cells during replicative senescence.

[0008] Preferably, carnosic acid improves the damage-repairing ability of vascular endothelial cells, which includes proliferation activity, migration ability and angiogenesis ability.

[0009] Preferably, carnosic acid improves the vascular aging phenotype of mice, including increasing aortic compliance, reducing stiffness, inhibiting the progression of atherosclerotic plaques, etc.

[0010] The second object of the present invention is to provide the use of carnosic acid in the preparation of a drug for inhibiting the ubiquitination level of TP53 protein.

[0011] Preferably, the type of ubiquitination is K63 ubiquitination.

[0012] Preferably, carnosic acid inhibits the K63 ubiquitination level and nuclear translocation of TP53 by targeting TP53.

[0013] The third object of the present invention is to provide a method for inhibiting the ubiquitination level of TP53 protein, specifically by targeting carnosic acid to bind to TP53 protein.

[0014] Preferably, the type of ubiquitination is K63 ubiquitination.

[0015] The present invention discloses that long-term CA treatment can significantly improve the vascular aging phenotype of mice; prolong the proliferation time of vascular endothelial cells during replicative aging, and improve the damage repair ability of vascular endothelial cells, such as proliferation activity, migration ability and angiogenesis ability. However, short-term CA administration (2 days) has no significant effect on the aging phenotype and proliferation and migration function of vascular endothelial cells.

[0016] Specifically, TP53 is a tumor suppressor protein that responds to different cellular stresses and regulates the expression of target genes after entering the nucleus. It can directly induce P21 expression and cell cycle arrest, promote γH2AX-mediated DNA damage repair and the expression of aging-related secretory genes such as ICAM1, VCAM1, IL1β and IL6. The nuclear translocation of TP53 protein is mainly regulated by post-translational modifications, including phosphorylation, acetylation and ubiquitination. Ubiquitination modification mainly includes two types, namely K48 ubiquitination and K63 ubiquitination. K48 ubiquitination usually mediates target protein degradation, and K63 ubiquitination mediates a variety of signal transduction functions including promoting TP53 protein nuclear translocation. The present study shows that short-term CA treatment does not affect the expression of TP53 protein and RNA levels, but can significantly affect the nuclear localization of TP53. Based on in vitro and in vivo experiments, the present invention proposes for the first time that CA inhibits its K63 ubiquitination level and nuclear translocation by targeting TP53, thereby inhibiting P21 / γH2AX-mediated cell cycle arrest and DNA damage repair, alleviating the aging-related secretory phenotype, and thus maintaining the proliferation potential of endothelial cells.

[0017] Compared with the prior art, the present invention has the following beneficial effects: The present invention discloses for the first time the direct target of CA for anti-vascular aging, TP53, through bioinformatics prediction, molecular docking and molecular biology experimental verification. In the process of vascular and endothelial cell aging, CA targeted binding to TP53 can inhibit its K63 ubiquitination level and nuclear translocation, thereby inhibiting cell cycle arrest, maintaining the proliferation potential of vascular endothelial cells, and delaying vascular aging. The present invention discloses for the first time the dosing regimen and mechanism of action of CA in anti-vascular endothelial cell aging. The mouse vascular premature aging model induced by glucose and lipid metabolism disorders is used on animals, and the human umbilical vein endothelial cell model of natural aging and induced aging is used on cells. The CA dosing regimen is optimized. It is found that CA targeted inhibition of TP53K63 ubiquitination level and nuclear localization is found at both the animal and cell levels, improving the DNA damage repair mediated by P21 / γH2AX, and inhibiting aging-related secretory genes, thereby delaying the aging of blood vessels and endothelial cells. In addition, the present invention is also meaningful for the study of TP53 protein ubiquitination. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 is the effect of CA on the body weight and liver and kidney function of mice with premature vascular aging, where A is ApoE - / - The scheme for constructing the mouse vascular premature aging model, B is the effect of CA on the body weight of mice, C is the effect of CA on the liver function of mice, and D is the effect of CA on the renal function of mice.

[0019] Figure 2 Figure 3 shows the effects of CA on cardiovascular function, blood lipids and blood sugar in mice with premature vascular aging. A and B show the carotid artery compliance (strain) and vascular stiffness (PWV) detected by vascular ultrasound. C shows the left ventricular ejection fraction (LvEF) and fractional shortening (FS) detected by cardiac ultrasound. D shows the effects of CA on blood lipids, blood sugar and lactate dehydrogenase (LDH) in the serum of mice.

[0020] Figure 3 The effect of CA on the treatment of vascular aging in a mouse model of premature vascular aging. A is the aorta SA-β-gal staining and statistical results, B is the aorta Oil Red O staining and statistical results, C is the aorta section EVG staining, and D is the aorta section Masson staining.

[0021] Figure 4 Figure 3 shows the effect of CA on delaying the replicative senescence of vascular endothelial cells. A shows the effect of CA on the proliferation curve of human umbilical vein endothelial cells (HUVEC). B shows the changes in the proliferation activity of HUVEC cells after CA treatment for different time periods. C shows the SA-β-gal staining and statistical results of HUVEC cells.

[0022] Figure 5Figure 3 shows the effects of CA on the migration and angiogenesis of endothelial cells. A shows the scratch test and Matrigel angiogenesis test. B and C show the statistical results.

[0023] Figure 6 is the effect of CA on the RNA levels of TP53 and its downstream aging-related genes, where AF are TP53, P21, P16 and aging-related secretory genes IL6, ICAM1, and VCAM1, respectively.

[0024] Figure 7 Figure 3 shows the effects of CA on TP53 protein level and nuclear distribution. A shows the effects of CA on TP53 and downstream P21 / γH2AX protein expression levels in endothelial cells detected by Western blot in the HUVEC replicative aging model. B shows the immunofluorescence staining of TP53 and γH2AX proteins in the mouse aorta in the vascular aging mouse model. C shows the effects of CA on TP53 and downstream P21 / ICAM1 / VCAM1 protein levels in the HUVEC aging model. D shows the effects of CA on TP53 nuclear localization in the HUVEC aging model.

[0025] Figure 8 The molecular docking results and binding region predictions of CA and TP53 proteins, A is the molecular docking result of CA and TP53 proteins, and B is the prediction of the active region of CA binding to TP53.

[0026] Fig. 9 To use surface plasmon resonance (SPR) technology to determine the interaction between TP53 protein and CA, A is the kinetic fitting result of the interaction between CA and TP53, and B is the curve diagram of the interaction between different concentrations of CA and TP53.

[0027] Fig.10 CA targets TP53 protein and inhibits its K63 ubiquitination level and nuclear distribution. A is the PLA fluorescence staining of TP53 protein and ubiquitinated protein Ub in situ. B is the effect of CA on K48 ubiquitination and K63 ubiquitination types of TP53 protein after TP53 mutation in HEK293T cells.

[0028] Fig.11 Figure 3 shows that CA affects the aging-related secretory phenotype of endothelial cells by regulating TP53. A shows the effect of CA on the expression levels of TP53 and downstream P21 / γH2AX proteins in endothelial cells after siRNA knockdown of TP53. B shows the effect of CA on the RNA expression levels of aging-related secretory genes IL1β, IL6, ICAM1 and VCAM1 detected by real-time fluorescence quantitative PCR.

[0029] Fig.12 is the in vivo and in vitro dosing regimen of CA, A is ApoE- / - A is the dosing regimen and survival curve of CA in mice, and B is the safety assessment of CA dosing in HUVEC cells. DETAILED DESCRIPTION

[0030] The present invention is further described below with reference to the embodiments and drawings, but is not intended to limit the present invention.

[0031] Example 1. The therapeutic effect of CA in a mouse model of premature vascular aging: 3-month-old male APOE - / - Mice (Hunan Slake Jingda Experimental Animal Co., Ltd.) were given a high-fat and high-sugar diet (HFHS), which contains 58% fat and 18% sugar (Cat#D09071702, Research diets), which can effectively induce vascular sclerosis and aging. After 1 month of HFHS diet, CA (Cat#HY-N0644, MCE) was injected intraperitoneally to treat vascular aging. The mice were divided into the following groups: 1) Control group, i.e. solvent control group 2) CA group, which was injected with CA (15 mg / kg) continuously for 1 week and then stopped for 3 weeks, for a total of 4 weeks. ( Figure 1 ).

[0032] Vevo 2100 mouse ultrasound imaging system was used to evaluate the arterial stiffness and cardiac function of experimental mice. Vascular aging indicators: The mouse aortic arch section was collected in B mode, and the proximal and distal blood flow peaks of the aortic arch were obtained in PW Doppler mode. The PWV was calculated based on the time difference between the cardiac R wave and the blood flow entering the proximal / distal end of the aorta. The calculation formula is: PWV = aortic arch length / (distal time difference-proximal time difference); in M ​​mode, the mouse abdominal aorta and left common carotid LCA images were obtained, and the systolic inner diameter (Ds), diastolic inner diameter (Dd) and vascular wall thickness of the blood vessels were measured, and the vascular compliance index was calculated: circumferential cyclic strain = (Dd–Ds) / Dd. Cardiac function indicators: The short axis of the mouse heart was displayed in B mode, and the left ventricular wall thickness was displayed in M ​​mode. The left ventricular ejection fraction (LvEF) and shortening fraction (FS) were calculated based on the systolic and diastolic diameters. CA can significantly improve vascular sclerosis and improve cardiac contractile function ( Figure 2 ).

[0033] SA-β-gal staining was used to evaluate aortic aging; Oil Red O staining was used to evaluate aortic plaque burden; Masson staining was used to evaluate aortic collagen deposition; EVG staining was used to evaluate the integrity of the aortic elastic lamina ( Figure 3 ).

[0034] Example 2: Therapeutic effects of CA in HUVEC replica aging model and induced aging model: Replicative aging model: full-term umbilical cords without microbial infection were selected from donors, and umbilical veins were perfused with 0.1% collagenase I solution to isolate vascular endothelial cells (HUVECs); ECM culture medium was used for passage according to the method of calculating population doublings (PDLs), that is, PDL=Log2(Ch / Cs), Ch is the initial inoculation number, Cs is the terminal cell number, and the passage is generally 1:4, and PDL increases by 2 each generation; according to the proliferation curve, HUVECs <PDL20 are defined as young cells, and HUVECs PDL44 after proliferation arrest are defined as senescent endothelial cells; the experiments involved in the patent of this invention all use mixed strains of HUVECs from 5 donors. 2 μM CA was added to the culture medium of PDL12 HUVEC cells, and an equal amount of solvent DMSO was added to the control group, and the cells were cultured for a long time until the cell cycle was arrested, and the cell growth curve was drawn; SA-β-gal staining was used to evaluate the proportion of endothelial cell senescence ( Figure 4 ).

[0035] Induced senescence model: PDL12 HUVEC cells were pretreated with 2 μM CA for 4 h, treated with 200 μM hydrogen peroxide (H2O2) for 1 h, and then cultured with CA-containing medium for 48 h ( Figure 7 ).

[0036] Example 3: Effect of CA on the repair ability of endothelial cells: The MTT method was used to detect the effect of CA on the proliferation activity of vascular endothelial cells; the scratch test was used to detect the effect of CA on the migration ability of endothelial cells; Matrigel was used to detect the effect of CA on the angiogenesis ability of endothelial cells ( Figure 5 ).

[0037] Example 4: Effects of CA on endothelial cell TP53 and downstream gene expression levels: Real-time fluorescence quantitative PCR was used to detect the effects of CA on the RNA levels of TP53 and its downstream aging-related genes, including P21, P16, IL6, ICAM1, and VCAM1. Figure 6 , Fig.11 As shown; wherein, the primer sequences of each gene are as follows: Primer Name Sequence (5' to 3') TP53-F CGTGTGGAGTATTTGGATGACAGA TP53-R GGAGTCTTCCAGTGTGATGATGGT P21-F GAGCAGGCTGAAGGGTCCCCAGGT P21-R GCTTCCTGTGGGCGGATTAGGGCT P16-F CGGAAGGTCCCTCAGACATC P16-R CCCTGTAGGACCTTCGGTGA IL1β-F CGCCAGTGAAATGATGGCTTAT IL1β-R CTGGAAGGAGCACTTCATCTGT IL6-F CACTGGCAGAAAACAACCTGAA IL6-R ACCAGGCAAGTCTCCTCATTGA ICAM1-F CACCTATGGCAACGACTC ICAM1-R GCTGTAGATGGTCACTGTCT VCAM1-F GGAGACAGGAGACACAGT VCAM1-R GCAGGTATTATTAAGGAGGATG Western blot and immunofluorescence were used to detect the effects of CA on TP53, P21, P16, ICAM1, and VCAM1 protein levels. TP53 and phosphorylation antibodies were purchased from Wuhan Mitaka Pharmaceuticals, P21 and P16 antibodies were purchased from CST, and ICAM1 and VCAM1 were purchased from Abcam. Figure 7 A, Fig.10 ).

[0038] Example 5: CA binding target TP53 in vascular endothelial cells: The three-dimensional structure file (PDB format) of human TP53 protein (UniProt ID: P04637) predicted by Alphafold was obtained from the UniPort database (https: / / www.uniprot.org / ). The CA structure file (SDF format) was downloaded from the PubChem database, and the structural energy was minimized using ChemOffice software 20.0 and converted into a three-dimensional structure. The three-dimensional structure was then hydrogenated using AutoDock Tools 1.5.7 software and saved as a pdbqt file. Subsequently, a docking grid box was constructed in the structural center of each target protein in AutoDockTools 1.5.7 and saved in pdbqt format. AutoDock Vina was used to infer molecular docking of targets and active compounds and to evaluate free binding energy. PyMOL 2.5.4 and LigPlus2.2.8 were used to visualize and analyze the interactions and binding modes of active compounds. CA has a good binding effect with TP53 protein, with a binding affinity of -7.7 kcal / mol ( Figure 8 ).

[0039] Example 6: Detection of the interaction between TP53 protein and CA using surface plasmon resonance (SPR) technology: SPR is a biophysical technology developed based on the principles of physical optics to detect molecular interactions. This method can detect intermolecular interactions in real time, with high sensitivity and without labeling. SPR uses light to generate evanescent waves in different media and then resonate with plasma waves, thereby constructing a biosensing analysis technology for biomolecular interactions to detect the interaction between the ligand TP53 and the analyte CA on the biosensor chip. Both CA and human TP53 recombinant protein were purchased from MCE. In this experiment, the Biacore instrument (GE Healthcare) was used to fix the TP53 protein on the chip surface, and different concentrations of CA flowed through the chip surface in a flowing manner. The analyte CA interacts with the ligand TP53. When the molecules bind and dissociate, the change in the mass of the chip surface causes the resonance angle to change. The sensor graph will record the signal value RU under the interaction in real time. According to this change curve, the dissociation constant KD value of the intermolecular interaction can be obtained (reference value 10 -3 ~10 -6 , the smaller the value, the stronger the affinity between the two), the binding rate constant Ka (reference value 10 3 ~10 6, the larger the value, the faster the two bind) and the dissociation rate constant Kd (the larger the value, the faster the two dissociate) Fig. 9 ).

[0040] Example 7: Effects of CA on different ubiquitination types of TP53: MOE v2022.02 was further used to predict the active region of TP53 protein and CA binding, and the top 3 binding models were selected to mutate the TP53 protein. We constructed the pcDNA3.1-TP53-FLAG wild-type vector and three candidate amino acid residue mutation vectors: ① pcDNA3.1-TP53-FLAG-mut1 mutated Lys291, Glu326, Tyr327, Asn345, Glu349, and Asp352 to Ala; ② pcDNA3.1-TP53-FLAG-mut2 mutated Arg174, Gln192, His193, Leu194, Ile195, Tyr205, Arg213, His214, Ser215, and Val216 to Ala; ③ pcDNA3.1-TP53-FLAG-mut3 Asn239, Ser240, Ser241, Arg248, Arg273, Val274, Cys275, Cys277, Arg280, and Asp281 were mutated to Ala.

[0041] HEK293T cells were transfected with TP53 vector, K63-Ub or K48-Ub vector and given 2 μM CA at the same time. 10 μM proteasome inhibitor MG132 (Cat#HY-13259, MCE) was added 6 h before collection to inhibit protein ubiquitination degradation. Approximately 1×10 7 cells, antigen samples were prepared using non-denaturing tissue / cell lysate, TP53 immunoprecipitation was performed using agarose gel beads Protein A / G (Cat#sc-2003, Santa Cruz), and TP53 ubiquitination levels were detected by Western blot ( Fig.10 ).

[0042] Example 8: CA regulates endothelial cell senescence-related secretory phenotype via TP53: TP53 siRNA was designed and prepared, with the sequence of 5' CCACUGGAUGGAGAAUAUUTT 3'. HUVEC transfection with TP53 siRNA significantly reduced the expression level of TP53 and aging-related secretory genes. On the basis of knocking down TP53, CA treatment had no significant effect on the expression of endothelial aging-related secretory genes ( Fig.11 ).

[0043] Example 9: Determine CA in vivo and in vitro dosing regimen: In vivo administration: 3-month-old male APOE - / - Mice were given HFHS diet for 1 month and then intraperitoneally injected with different doses of CA to treat vascular aging. The groups were divided into the following groups: 1) 30 mg / kg / d group; 2) 15 mg / kg / d group; 3) 15 mg / kg-ID intermittent administration group, one cycle was continuous injection of CA for 1 week and then 3 weeks of drug withdrawal, for a total of 4 cycles; 4) Solvent control group, i.e. solvent control group. The concentration of CA mother solution was 180 mg / mL (DMSO dissolved), and the solvent formula was 5% DMSO + 5% PEG300 +5% Tween-80 +85% saline. The survival curve was drawn according to the survival time of mice after CA administration ( Fig.12 A).

[0044] In vitro administration: PDL12 HUVEC cells were cultured at 1×10 4 The cells were seeded at a density of 1 / well in a 96-well plate, with 8 wells in each group, and different concentrations of CA were administered: 0, 0.001, 0.01, 0.1, 1, 10, 100, and 1000 μM. After culturing for 12 h, the cell viability was detected by MTT assay, and the most suitable concentration range for CA administration in vitro was determined to be 1-10 μM. Subsequently, the optimal therapeutic concentration of CA for HUVEC was further explored by setting a concentration gradient of 0, 1, 2, 5, and 10 μM ( Fig.12 B).

Claims

1. The use of carnosic acid in the preparation of long-term anti-vascular aging drugs, characterized in that: Carnosic acid acts on TP53 protein, targeting TP53 to inhibit its K63 ubiquitination level and nuclear translocation, thereby inhibiting P21 / γH2AX-mediated cell cycle arrest and DNA damage repair, alleviating aging-related secretory phenotypes, and achieving long-term anti-vascular aging effects.

2. The use according to claim 1, characterized in that: Carnosic acid prolongs the proliferation time of vascular endothelial cells during replicative senescence.

3. The use according to claim 1, characterized in that: Carnosic acid improves the damage-repairing ability of vascular endothelial cells, including proliferation activity, migration ability and angiogenesis ability.

4. The use according to claim 1, characterized in that: Carnosic acid improves aortic compliance, reduces stiffness, and inhibits the progression of atherosclerotic plaques.

5. Application of carnosic acid in the preparation of drugs for inhibiting the ubiquitination level of TP53 protein.

6. The use according to claim 5, characterized in that: The type of ubiquitination is K63 ubiquitination.

7. The use according to claim 6, characterized in that: Carnosic acid inhibits the K63 ubiquitination level and nuclear translocation of TP53 protein by targeting TP53 protein.

8. A method for inhibiting the ubiquitination level of TP53 protein, characterized in that: The method specifically involves targeting carnosic acid to bind to the TP53 protein.

9. The method according to claim 8, characterized in that The type of ubiquitination is K63 ubiquitination.

Images