Bacillus amyloliquefaciens MRS-N7-2 and application thereof

Abstract

The invention discloses bacillus amyloliquefaciens MRS-N7-2, and belongs to the field of degrading bacterium screening, the bacillus amyloliquefaciens MRS-N7-2 has been preserved in China General Microbiological Culture Collection Center on May 8, 2024, the preservation number is CGMCC No.30523, and the preservation address is No.3, Yard 1, Beichen West Road, Chaoyang District, Beijing; the bacillus amyloliquefaciens is classified and named as bacillus amyloliquefaciens, and the bacillus amyloliquefaciens is named as bacillus amyloliquefaciens. The strain is obtained from grape branch compost through screening, purification, identification and other technologies, researches on strain characteristics, fermentation conditions and cellulase activity of the strain show that the enzyme activity of the strain is 418.53 U / g under the conditions that the temperature is 30 DEG C and the pH value is 7, and when 5% of casein is added as a protective agent, the effective viable count of the bacillus amyloliquefaciens MRS-N7-2 is the highest, and the bacillus amyloliquefaciens MRS-N7-2 can be used as a microbial inoculant. And the content can reach 6.47 * 10 < 15 > cfu / g.

Description

Technical Field

[0001] The invention relates to the technical field of screening and application of degradation bacteria, and more specifically to Bacillus amyloliquefaciens MRS-N7-2 and application thereof. Background Art

[0002] Grapes are one of the main fruit trees in my country, with a large planting area. According to data released by the International Organization of Vine and Wine (OIV), China's grape planting area in 2020 is about 785,000 hm2. 2 , the amount of discarded grape branches will reach 9.42 million to 11.775 million tons. Composting is a common means of resource utilization of branches. By crushing the branches and composting them, organic fertilizer is made and applied as base fertilizer. Composting is mainly a physiological and biochemical process in which the compost matrix is ​​dominated by microbial activities. It is also an effective way to achieve harmlessness, reduction and resource utilization of grape branches. The composting process is a process in which microorganisms act on organic matter. The process can be divided into mineralization and humification. Mineralization is the decomposition of macromolecular organic matter into simple substances; humification is the generation of more complex humus through microbial activities. After composting, organic waste can be used as organic fertilizer in agricultural production to improve the physical and chemical properties of soil and promote plant growth.

[0003] However, grape branches contain a large amount of cellulose and lignin, which are difficult to decompose and take a long time to mature. The key to the degradation of grape branches is the degradation of cellulose and lignin. Microorganisms play an important role in branch composting. In the composting and fermentation of waste such as grape branches, by adding microbial agents, cellulase and lignin degradation enzymes can be produced, which can promote the rapid start of composting, accelerate the process, and significantly improve the quality of organic fertilizer. Therefore, bacterial strains play an important role in the fermentation of grape branches, especially in finding a microbial strain that can efficiently degrade cellulose and lignin.

[0004] Therefore, how to provide a microbial strain that can efficiently degrade cellulose and apply it to branch composting is an urgent problem that those skilled in the art need to solve. Summary of the invention

[0005] In view of this, the present invention provides a Bacillus amyloliquefaciens MRS-N7-2 and applications thereof.

[0006] In order to achieve the above object, the present invention adopts the following technical solution:

[0007] A Bacillus amyloliquefaciens MRS-N7-2, wherein the Bacillus amyloliquefaciens MRS-N7-2 has been deposited in the General Microbiological Center of China Microorganism Culture Collection Committee on May 8, 2024, with a deposit number of CGMCC No.30523, and a deposit address of No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing; the classification name is Bacillus amyloliquefaciens.

[0008] Preferably, the 16S rDNA sequence of the Bacillus amyloliquefaciens MRS-N7-2 is as shown in SEQ ID No.1.

[0009] As an inventive concept identical to the above technical solution, the present invention also requests protection for the use of the Bacillus amyloliquefaciens MRS-N7-2 in the degradation and treatment of cellulose.

[0010] Preferably, the Bacillus amyloliquefaciens MRS-N7-2 is used to degrade cellulose in branch composting.

[0011] As an inventive concept identical to the above technical solution, the present invention also requests protection for the use of the Bacillus amyloliquefaciens MRS-N7-2 in the production of cellulase.

[0012] As the same inventive concept as the above technical solution, the present invention also claims a fermentation method of Bacillus amyloliquefaciens MRS-N7-2, comprising the following steps:

[0013] (3) The MRS-N7-2 strain was streaked onto LB medium and cultured at 30°C to obtain a single colony;

[0014] (4) inoculating a single bacterial colony into LB liquid culture medium, and culturing at 30° C. and 180 rpm for 24 h to obtain a culture solution;

[0015] (3) The culture solution was inoculated into a sterilized solid culture medium and fermented in a constant temperature incubator at 30°C.

[0016] Preferably, the optimal culture medium composition for the strain in step (3) is: 8% molasses, 9% yeast powder, 1.5% urea, and 0.5% potassium dihydrogen phosphate.

[0017] As an inventive concept identical to the above technical solution, the present invention also seeks protection for a microbial agent comprising Bacillus amyloliquefaciens MRS-N7-2.

[0018] Preferably, the bacterial agent also includes a protective agent, and the protective agent is trehalose.

[0019] As an inventive concept identical to the above technical solution, the present invention also requests protection for the use of the above bacterial agent in degrading cellulose.

[0020] It can be seen from the above technical solutions that, compared with the prior art, the technical effects achieved by the present invention are:

[0021] The present invention screened and obtained a strain of Bacillus amyloliquefaciens MRS-N7-2 from grape branch compost, identified its species by 16S rRNA gene sequence analysis, determined the bacterial function by cellulase activity, and determined the characteristics of the strain by screening the optimal temperature, pH, viable bacteria count and enzyme activity at different transfer times. The enzyme activity of the strain was 418.53 U / g at 30°C and pH=7, and the viable bacteria count could reach 1.88×10 after 14 transfers. 10 cfu / mL, and the enzyme activity reached 588.23U / g after three transfers.

[0022] After orthogonal optimization of fermentation conditions, it was found that the cellulase activity of Bacillus amyloliquefaciens MRS-N7-2 was highest when 8% honey, 9% yeast, 1.5% urea and 0.5% potassium dihydrogen phosphate were added to the solid culture medium. In addition, when 5% trehalose was added as a protective agent, the effective viable count of Bacillus amyloliquefaciens MRS-N7-2 was the highest, reaching 6.47×10 15 cfu / g. DETAILED DESCRIPTION

[0023] The following will be described clearly and completely in conjunction with the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0024] The samples and culture medium used in the examples are as follows:

[0025] Test samples

[0026] It was collected from grape branch compost at the Hot Spring Base of the Chinese Academy of Agricultural Sciences in 2021.

[0027] Test medium

[0028] LB medium: 10 g of peptone, 5 g of yeast powder, 10 g of sodium chloride, dilute to 1 L, pH 7, sterilize with high-pressure steam at 121°C for 20 min for use.

[0029] Cellulose selection medium: 15 g sodium carboxymethyl cellulose, 5 g sodium chloride, 1 g dipotassium hydrogen phosphate, 0.2 g magnesium sulfate, 10 g tryptone, 5 g yeast powder, 20 g agar, dilute to 1 L, pH 7.2, sterilize with high-pressure steam at 121°C for 20 min for use.

[0030] Rice straw powder solid culture medium: 200g alkali-treated rice straw powder, 800g bran, 50g glucose, 20g trypsin, 15g ammonium nitrate, 10g potassium dihydrogen phosphate, 1500g water, sterilize with high-pressure steam at 121°C for 20min and set aside.

[0031] Example 1 Screening and identification of Bacillus amyloliquefaciens MRS-N7-2

[0032] 1. Screening of Bacillus amyloliquefaciens MRS-N7-2

[0033] (1) Weigh 5 g of sample and place it in a sterilized 50 mL centrifuge tube. Add 45 mL of sterile water and shake at 180 rpm for 30 min. Pipette 1 mL of the mixture and add 9 mL of sterile water to dilute the bacterial solution in a gradient manner. Pipette and dilute to 10 -4 , 10 -5 , 10 -6 100 μL of the concentrated bacterial solution was spread on the LB medium plate and placed in an incubator at 30°C for inversion. After 3 days, colonies of different morphologies were picked and streaked for purification. The purification method was to pick colonies with an inoculation needle and streak them on four non-overlapping areas of the LB plate. When colonies grew on the plate, the morphology of the colonies was observed. If they were all colonies with the same morphology, it meant that the colonies had been purified.

[0034] (2) The purified strain was inoculated into a cellulose selective medium and cultured for 3 days. The strain was stained with 1 mg / mL Congo red solution for 1 h, the solution was discarded, and the strain was decolorized with 1 mol / L NaCl solution. The presence of a hyaline zone was observed, and the length and width of the hyaline zone were measured. The ratio of the hyaline zone area to the colony area was calculated, and the strains with hyaline zones were preserved.

[0035] 2. Identification of Bacillus amyloliquefaciens MRS-N7-2

[0036] DNA was extracted from MRS-N7-2, and the purity and integrity of the DNA were detected by agarose gel electrophoresis and absorbance determination; then the DNA of MRS-N7-2 was used as a template, 341F (5'-CGCC CGCCGCGCCCCGCGCCCGGCCCGCCGCCCCCGCCTACGGGAGGC AGCAG-3') and 907R (5'-CCGTCAATTCCTTTGAGTTT-3') were used as primers for PCR amplification, and the target band was sent to the company for sequencing, and the measured DNA sequence was compared in the NCBI database; the results are as follows, and the PCR amplification products were compared in the NCBI database. The comparison results show that MRS-N7-2 has 100% similarity with Bacillus amyloliquefaciens and is identified as Bacillus amyloliquefaciens. The 16SrDNA sequence of the strain is shown in SEQ ID No.1.

[0037] , as shown in SEQ ID NO.1.

[0038] Example 2 Determination of cellulase activity of Bacillus amyloliquefaciens MRS-N7-2

[0039] Bacillus amyloliquefaciens MRS-N7-2 was inoculated into LB liquid culture medium, cultured at 30°C and 180 r / min for 24 h, then transferred to straw powder solid culture medium, fermented in a constant temperature incubator at 30°C for 7 days, and cellulase activity was determined at the end of fermentation, according to the method in "Organic Material Composting Agents" (2002).

[0040] The results of enzyme activity determination showed that the cellulase activity of Bacillus amyloliquefaciens MRS-N7-2 was 674.68 U / g.

[0041] Example 3 Determination of strain characteristics of Bacillus amyloliquefaciens MRS-N7-2

[0042] A single factor experiment was used to investigate the effects of temperature, pH value and transfer times on the cellulase production of Bacillus amyloliquefaciens MRS-N7-2 and to determine the strain characteristics.

[0043] (1) Effects of different temperatures on cellulase activity of Bacillus amyloliquefaciens MRS-N7-2

[0044] Bacillus amyloliquefaciens MRS-N7-2 cultured for 24 h was inoculated into rice straw powder solid culture medium with natural pH and cultured at different temperatures of 20, 30, 40, 50, 60 and 70°C. The cellulase activity was measured after 7 days. The results are shown in Table 1.

[0045] Table 1 Effects of different temperatures on cellulase activity of Bacillus amyloliquefaciens MRS-N7-2

[0046]

[0047] As shown in Table 1, the growth and cellulase activity of the strains are different under different temperature environments. Bacillus amyloliquefaciens MRS-N7-2 can produce cellulase at 20-70°C, and with the increase of culture temperature, the cellulase activity shows a trend of first increasing and then decreasing. When the temperature is 30°C, the cellulase activity of Bacillus amyloliquefaciens MRS-N7-2 reaches a high level of 626.11U / g; it can be seen that the most suitable temperature for Bacillus amyloliquefaciens MRS-N7-2 to produce cellulase is 30°C.

[0048] (2) Effects of different pH conditions on cellulase activity of Bacillus amyloliquefaciens MRS-N7-2

[0049] The Bacillus amyloliquefaciens MRS-N7-2 cultured for 24 h was inoculated into rice straw powder solid culture medium with pH values ​​of 5, 6, 7, 8, and 9, respectively, and cultured at 30°C. The cellulase activity was measured after 7 days. The results are shown in Table 2.

[0050] Table 2 Effect of different pH conditions on cellulase activity of Bacillus amyloliquefaciens MRS-N7-2

[0051]

[0052] As shown in Table 2, the growth and cellulase activity of the strains are different under different pH conditions. Bacillus amyloliquefaciens MRS-N7-2 can produce cellulase in the range of pH 5 to 9, and with the increase of pH, the cellulase activity shows a trend of first increasing and then decreasing. When the pH is 7, the cellulase production capacity of Bacillus amyloliquefaciens MRS-N7-2 reaches a high level of 418.53U / g; it can be seen that the most suitable pH for Bacillus amyloliquefaciens MRS-N7-2 to produce cellulase is 7.

[0053] (3) Effects of different transfer times on the effective viable count and cellulase activity of Bacillus amyloliquefaciens MRS-N7-2

[0054] Bacillus amyloliquefaciens MRS-N7-2 was inoculated into LB liquid medium and cultured at 180 rpm and 30 °C. After 24 h of culture, the number of viable bacteria was determined. The results are shown in Table 3. At the same time, it was transferred to a new LB medium with an inoculum size of 1×10 7 cfu / mL, and the number of transfers was recorded; at the same time of each transfer, the bacterial solution cultured for 24 hours was inoculated into the straw powder solid culture medium, and cultured in a constant temperature incubator at 30°C for 7 days, and the cellulase activity was measured. The results are shown in Table 4.

[0055] Table 3 Effect of different transfer times on the effective viable count of Bacillus amyloliquefaciens MRS-N7-2

[0056]

[0057]

[0058] Table 4 Effects of different transfer times on cellulase activity of Bacillus amyloliquefaciens MRS-N7-2

[0059]

[0060] As shown in Tables 3 and 4, the growth, effective viable count and cellulase activity of the strains were different at different transfer times, and the differences were quite large. When the transfer times was 14, the effective viable count of Bacillus amyloliquefaciens MRS-N7-2 reached the highest, which was 1.88×10 10 cfu / mL; when the number of transfers was 3, the cellulase production capacity of Bacillus amyloliquefaciens MRS-N7-2 reached a high level of 588.23U / g.

[0061] Example 4 Optimization of fermentation conditions of Bacillus amyloliquefaciens MRS-N7-2

[0062] The fermentation conditions were optimized using rice straw powder solid culture medium, and single-factor and orthogonal experiments were used to investigate the effects of carbon source, nitrogen source (slow-acting nitrogen source and fast-acting nitrogen source) and inorganic salts on the production of cellulase by Bacillus amyloliquefaciens MRS-N7-2 to determine the optimal fermentation conditions.

[0063] 1. Single factor experiment to determine the types of carbon source, nitrogen source (slow-acting nitrogen source and fast-acting nitrogen source) and inorganic salts

[0064] (1) Fermentation medium carbon source

[0065] The carbon sources were set as 8 treatments, namely fructose, glucose, mannitol, sucrose, lactose, maltose, starch and molasses, to replace the glucose in the straw powder solid culture medium; then the culture medium was prepared according to the proportion and sterilized at 121°C for 20 min. After the culture medium was cooled, 1 mL of Bacillus amyloliquefaciens MRS-N7-2 culture liquid activated for 18 h was inoculated and cultured at 30°C. The cellulase activity was measured after 7 days. The results are shown in Table 5.

[0066] Table 5 Effects of different carbon sources on cellulase activity of Bacillus amyloliquefaciens MRS-N7-2

[0067]

[0068]

[0069] As shown in Table 5, adding different carbon sources to the culture medium will affect the growth of the strain. When the carbon source is molasses, the cellulase activity of Bacillus amyloliquefaciens MRS-N7-2 is the highest, up to 767.99 U / g. Therefore, molasses is selected as the optimal carbon source for culturing Bacillus amyloliquefaciens MRS-N7-2.

[0070] (2) Slow-acting nitrogen source and fast-acting nitrogen source in fermentation medium

[0071] The slow-acting nitrogen sources were set as 9 treatments, including casein, yeast powder, trypsin, corn flour, corn steep liquor, casein, soy peptone, peanut cake powder and soybean powder, to replace the peptone in the straw powder solid culture medium; then they were prepared into the corresponding culture medium and sterilized at 121°C for 20 min. After the culture medium was cooled, 1 mL of Bacillus amyloliquefaciens MRS-N7-2 culture liquid activated for 18 h was inoculated and cultured at 30°C. The cellulase activity was measured after 7 days. The results are shown in Table 6.

[0072] The quick-acting nitrogen sources were set as ammonium chloride, ammonium sulfate, urea, ammonium nitrate, and diammonium phosphate to replace the ammonium nitrate in the rice straw powder solid culture medium; then the culture medium was prepared into the corresponding culture medium, sterilized and cooled, and inoculated with 1 mL of Bacillus amyloliquefaciens MRS-N7-2 culture liquid activated for 18 hours, cultured at 30°C, and the cellulase activity was measured after 7 days. The results are shown in Table 7.

[0073] Table 6 Effects of different slow-release nitrogen sources on cellulase activity of Bacillus amyloliquefaciens MRS-N7-2

[0074]

[0075] Table 7 Effects of different available nitrogen sources on cellulase activity of Bacillus amyloliquefaciens MRS-N7-2

[0076]

[0077] It can be seen from Tables 6 and 7 that when the slow-acting nitrogen source is yeast powder, the cellulase activity of Bacillus amyloliquefaciens MRS-N7-2 is the highest, up to 654.68U / g, significantly higher than peptone; when the fast-acting nitrogen source is urea, the cellulase activity of Bacillus amyloliquefaciens MRS-N7-2 is the highest, up to 1391.22U / g, significantly higher than ammonium nitrate. Therefore, yeast powder and urea are selected as the optimal slow-acting nitrogen source and fast-acting nitrogen source for culturing Bacillus amyloliquefaciens MRS-N7-2.

[0078] (3) Fermentation medium inorganic salts

[0079] The inorganic salts were set to 10 treatments including calcium carbonate, zinc sulfate, dipotassium hydrogen phosphate, manganese sulfate, potassium chloride, potassium sulfate, magnesium sulfate, potassium dihydrogen phosphate, sodium chloride, and calcium chloride to replace the potassium dihydrogen phosphate in the rice straw powder solid culture medium; then the culture medium was prepared into the corresponding culture medium, sterilized and cooled, and inoculated with 1 mL of Bacillus amyloliquefaciens MRS-N7-2 bacterial solution activated for 18 hours, cultured at 30°C, and the cellulase activity was measured after 7 days. The results are shown in Table 8.

[0080] Table 8 Effects of different inorganic salts on cellulase activity of Bacillus amyloliquefaciens MRS-N7-2

[0081]

[0082] It can be seen from Table 8 that when the inorganic salt is potassium dihydrogen phosphate, the cellulase activity of Bacillus amyloliquefaciens MRS-N7-2 is the highest, up to 1069.12 U / g. Therefore, potassium dihydrogen phosphate is selected as the optimal inorganic salt for culturing Bacillus amyloliquefaciens MRS-N7-2.

[0083] 2. Orthogonal test to determine the content of nutrients in the culture medium

[0084] Based on orthogonal experimental design, the molasses content, yeast powder content, urea content and potassium dihydrogen phosphate content in the solid culture medium of Bacillus amyloliquefaciens MRS-N7-2 were optimized, and 3 gradients were set for each substance, as shown in Table 9; Bacillus amyloliquefaciens MRS-N7-2 was inoculated into the culture medium with corresponding contents for culture, and its cellulase activity was measured after 7 days. The measurement results are shown in Table 10.

[0085] Table 9 Nutrient gradient settings

[0086]

[0087]

[0088] Table 10 Results of orthogonal test of nutrient content

[0089]

[0090] The orthogonal test results of the nutrient content of Bacillus amyloliquefaciens MRS-N7-2 are shown in Table 7. When the solid fermentation conditions of Bacillus amyloliquefaciens MRS-N7-2 are 8% molasses, 9% yeast powder, 1.5% urea and 0.5% potassium dihydrogen phosphate, the cellulase production activity of Bacillus amyloliquefaciens MRS-N7-2 is the highest, up to 169.77 U / g, which is significantly higher than that of other treatment groups.

[0091] Example 5 Effects of different protective agents on Bacillus amyloliquefaciens MRS-N7-2

[0092] Bacillus amyloliquefaciens MRS-N7-2 was inoculated into a solid culture medium of rice straw powder and cultured in a constant temperature incubator at 30°C for 7 days. Then, casein, mannitol, fulvic acid, trehalose and chitosan were selected as protective agents, respectively, and the protective agents were added to the solid culture medium containing Bacillus amyloliquefaciens MRS-N7-2 at a content of 5%. Then, the culture medium was placed in an oven at 30°C and dried to a moisture content of 5%. Then, the culture medium was crushed and stored in a sealed bag at room temperature and away from light. After 12 months, the effective viable count, foreign bacteria count and cellulase activity were determined in accordance with the "Agricultural Microbial Agent" standard (2006). The determination results are shown in Table 11.

[0093] Table 11 Effects of different protective agents on Bacillus amyloliquefaciens MRS-N7-2

[0094]

[0095]

[0096] As can be seen from Table 11, in terms of the number of effective viable bacteria, when 5% trehalose was used as a protective agent, the number of effective viable bacteria of Bacillus amyloliquefaciens MRS-N7-2 was the highest, reaching 6.47×10 15 cfu / g, which are significantly higher than other ingredients; at the same time, when mannitol is used as a protective agent, the cellulase activity of the prepared bacterial agent is 12.91U / g, which is also higher than other protective agents. Therefore, the present invention uses 5% trehalose as a protective agent, which can not only increase the effective viable bacteria count of the bacterial agent, facilitate the preservation of Bacillus amyloliquefaciens MRS-N7-2, but also maintain the cellulase activity of the strain.

[0097] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.

[0098] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A Bacillus amyloliquefaciens MRS-N7-2, characterized in that The Bacillus amyloliquefaciens MRS-N7-2 was deposited in the General Microbiology Center of the China Microbiological Culture Collection Administration on May 8, 2024, with a deposit number of CGMCC No. 30523, and a deposit address of No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing; the classification name is Bacillus amyloliquefaciens.

2. The Bacillus amyloliquefaciens MRS-N7-2 according to claim 1, characterized in that The 16S rDNA sequence of the Bacillus amyloliquefaciens MRS-N7-2 is shown in SEQ ID No.

1.

3. Use of the Bacillus amyloliquefaciens MRS-N7-2 according to claim 1 in the degradation and treatment of cellulose.

4. Use of the Bacillus amyloliquefaciens MRS-N7-2 according to claim 1 in producing cellulase.

5. A fermentation method of Bacillus amyloliquefaciens MRS-N7-2, characterized in that: The following steps are involved: (1) The MRS-N7-2 strain was streaked onto LB medium and cultured at 30°C to obtain a single colony; (2) inoculating a single bacterial colony into LB liquid culture medium, and culturing at 30° C. and 180 rpm for 24 h to obtain a culture solution; (3) The culture solution was inoculated into a sterilized solid culture medium and fermented in a constant temperature incubator at 30°C.

6. The fermentation method of Bacillus amyloliquefaciens MRS-N7-2 according to claim 5, characterized in that: The optimal culture medium composition for the strain in step (3) is: 8% molasses, 9% yeast powder, 1.5% urea, and 0.5% potassium dihydrogen phosphate.

7. A microbial agent, characterized in that: The bacterial agent includes Bacillus amyloliquefaciens MRS-N7-2.

8. A microbial agent according to claim 7, characterized in that: The invention also comprises a protective agent, which is trehalose.

9. Use of the microbial agent according to any one of claims 7-8 in the degradation and treatment of cellulose.

Images