Culture method in circulating tumor cell library building process and library building method of circulating tumor cells

Abstract

The invention relates to a culture method in a circulating tumor cell library building process, which comprises the following steps: culturing circulating tumor cells obtained by sorting in an anoxic incubator, and controlling the oxygen concentration at 4-5%; the culture temperature is 37 + / -0.5 DEG C, and the culture solution is a double-resistant composition formed by adding a nerve growth factor FGF, an epidermal growth factor EGF, a B27 supplement, L-glutamine and an antibiotic / antifungal agent into a basic culture medium; the basic culture medium is an RPMI 1640 culture medium; the culture time is 3-10 days, the growth condition of the cells is continuously observed during the culture period, and once the cells are aged, the cells are immediately picked out for library building operation. According to the method, the circulating tumor cells can be cultured in vitro, so that the sorted CTCs can be detected after state recovery or even proliferation for a period of time, the detection result can better reflect the real state of the CTCs, more detection samples can be obtained, and the library building success rate and quality are improved.

Description

Technical Field

[0001] The present invention relates to the technical field of cell tissue bank construction, and in particular to a circulating tumor cell culture method in the process of bank construction and a circulating tumor cell bank construction method. Background Art

[0002] Circulating tumor cells (CTCs) refer to tumor cells that fall off from primary tumors or metastatic lesions and enter the peripheral blood circulation. These cells may reach other parts of the body through the blood circulation and form new tumors, i.e. metastases, there. The number of CTCs is extremely small. The content of circulating tumor cells in the blood is extremely small, about 1-10 circulating tumor cells per 10 ml of blood, or even 10-20 circulating tumor cells per 10 ml of blood. 7 There is only one circulating tumor cell in each blood cell. The importance of CTCs lies in their close relationship with the progression and prognosis of tumors. CTCs that can successfully enter the blood circulation and survive often have high vitality and metastatic potential. Due to these characteristics, CTCs have become one of the key targets for studying tumor biology and developing new diagnostic tools. The capture and analysis of CTCs helps to understand the heterogeneity of tumors, metastatic mechanisms, and the development of drug resistance, and provide information for the development of new treatments. Since the number of CTCs is very rare, usually only a few to dozens per milliliter of blood, its detection is a technical challenge, but it also provides a valuable liquid biopsy method for clinical use, that is, information about tumors can be obtained without invasively obtaining tissue samples. By constructing a library and performing gene expression analysis or genomic variation analysis, the heterogeneity and complexity of cells can be revealed.

[0003] However, the large-scale full-length library construction and sequencing of circulating tumor cells is still in a relatively immature stage. Few circulating tumor cells can be captured and successfully library-constructed and sequenced. There are also the following problems: (1) At present, researchers generally use microfluidic devices to perform negative or positive screening on circulating tumor cells in the blood. After screening, the cells are sorted using flow cytometry and other equipment for subsequent experiments. Positive screening generally uses Epcam positive to sort circulating tumor cells, but a large number of literature studies have shown that circulating tumor cells are highly heterogeneous and some circulating tumor cells are not Epcam positive, which leads to the loss of circulating tumor cells during the sorting process, low accuracy, and the inability to solve the problem of Epcam positive recognition escape. Negative screening will lead to more white blood cells and other cells participating in interference, making screening difficult. How to efficiently and quickly separate the sorted cells and culture and library construction is still a difficult problem. (2) At present, most studies conduct monitoring and library construction experiments immediately after circulating tumor cells are sorted from the blood. At this time, circulating tumor cells are severely damaged during the sorting process and even their RNA is degraded. At this time, sequencing cannot reflect the true state of circulating tumor cells. However, those skilled in the art are often unaware of the impact of the timing of circulating tumor cell sequencing on the sequencing results. Even if they are aware of this problem, they have to conduct relevant experiments immediately after obtaining the CTCs because the sorted CTCs are in extremely poor condition and difficult to survive. Summary of the invention

[0004] 1. Technical issues to be resolved

[0005] In view of the above-mentioned shortcomings and deficiencies of the prior art, the present invention provides a method for culturing circulating tumor cells in the process of establishing a library and a method for establishing a library of circulating tumor cells; on the one hand, the present invention provides a method for culturing CTCs, which can culture circulating tumor cells in vitro, so that the sorted CTCs can be detected after a period of state recovery or even proliferation, so that the detection results can better reflect the true state of CTCs and obtain more detection samples; on the other hand, the present invention further optimizes the processes of sorting CTCs and purification and fragmentation of samples after amplification, saving cell selection costs and improving sorting accuracy and success rate, improving sample purity, making sample fragmentation more uniform, and improving the data quality of subsequent sequencing.

[0006] (II) Technical solution

[0007] In a first aspect, the present invention provides a culture method in the process of establishing a circulating tumor cell library, which comprises: placing the sorted circulating tumor cells in an anoxic incubator for culture, and controlling the oxygen concentration at 4-5%; the culture temperature is 37±0.5°C, and the culture medium adopts a basic culture medium with added nerve growth factor FGF, epidermal growth factor EGF, B27 supplement, L-glutamine and a dual-antibody composition of antibiotics / antifungal agents; the basic culture medium is RPMI 1640 culture medium; the culture time is 3-10 days, and the growth of the cells is continuously observed during the culture period. Once the cells appear to be aged, the cells are immediately picked out for library construction.

[0008] According to a preferred embodiment of the present invention, the dual antibiotic combination of antibiotics / antifungal agents is penicillin / streptomycin or amphotericin B.

[0009] According to a preferred embodiment of the present invention, the method for preparing the culture solution is: adding 4-6 mL of L-glutamine, 9-12 mL of B27 supplement, 2.5-3 μg of FGF, 2.5-3 μg of EGF, and 10 mL-12 mL of the dual antibody composition to every 500 mL of RPMI 1640 culture medium.

[0010] According to a preferred embodiment of the present invention, the method for judging cell senescence is: the cell nucleus color deepens or the cell morphology deforms, which indicates that the cell begins to age. At this time, the cells are picked out to ensure that the cells are in a good growth state and have more RNA for transcription and library construction.

[0011] In the second aspect, the present invention provides a method for building a library of circulating tumor cells, which includes: sorting circulating tumor cells from blood, in vitro culture, single cell selection, library building and sequencing; the in vitro culture adopts the culture method described in any of the above embodiments. After in vitro culture, the circulating tumor cells sorted from the blood can be restored to their state and proliferate, which can reduce the degradation of circulating tumor cell RNA on the one hand, and increase the number of circulating tumor cells on the other hand, making it easier to obtain more cell samples.

[0012] According to a preferred embodiment of the present invention, a cell elutriator is used to separate circulating tumor cells from blood.

[0013] According to a preferred embodiment of the present invention, the single cell selection is to manually pick the circulating tumor cells cultured in vitro using a glass needle; the specific operation is: using alcohol-sterilized capillary as the raw material, heating and softening it to obtain a glass needle with a tube center of 0.2mm±0.05mm; pouring liquid nitrogen into a thermos cup in advance, selecting cells with a diameter of about 20μm±2μm from the culture medium under a 10× microscope, inserting the glass needle into the joint of the mouth pipette, using the mouth pipette to provide negative pressure, sucking the cells and 1-2μL of culture medium, transferring the cells into the glass needle and then blowing the cells into a centrifuge tube containing 3μL of lysis solution, placing the centrifuge tube into a thermos cup filled with liquid nitrogen, and storing it in a -80℃ refrigerator.

[0014] According to a preferred embodiment of the present invention, the process of library construction and sequencing comprises the following steps:

[0015] (1) Lysis and reverse transcription: Place the centrifuge tube containing cells and lysis solution under heating conditions to lyse the cells to obtain cell lysis solution, prepare reverse transcription solution, mix the reverse transcription solution with the cell lysis solution, and incubate in a thermal cycler;

[0016] The sequence of the oligonucleotide Smartseq3_Oli godT30VN added to the lysate is / 5Biosg / ACGAGCATCAGCAGCATACGATTTTTTTTTTTTTTTTTTTTTT T TTTTTTTVN; the sequence of the oligonucleotide Smartseq3_N 8_TSO added to the reverse transcription solution is / 5Biosg / AGAGACAGATTGCGCAAT GNNNNNNNNrGrGrG;

[0017] (2) Pre-amplification:

[0018] Prepare a preamplification system, add the preamplification system to the centrifuge tube treated in step (1), mix well, and place the centrifuge tube in a thermal cycler for preamplification; the forward amplification primer Fwd is TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGATTGCGCAA*T*G; the reverse amplification primer Rev is ACGAGCATCAGCAGCATAC*G*A;

[0019] (3) Purification: After the pre-amplification is completed, ultrapure water is added to the centrifuge tube of the pre-amplification sample for dilution, and then DNA purification magnetic beads are added. The volume ratio of the added DNA purification magnetic beads to the volume of the liquid in the centrifuge tube before addition is 35:50, and the cDNA is eluted with ultrapure water;

[0020] (4) cDNA quality check: The cDNA library quality was tested using the Qubit dsDNA HS assay kit, and the DNA fragment size was measured using a standard clamp, retaining fragments with a size of 900-1100 kb;

[0021] (5) cDNA fragmentation: 1 μL Amplicon Tagmentation Mix (Tn5) was added to every 1 ng of cDNA to obtain a fragmentation mixture, which was placed in a thermostatic metal bath at 55°C for 5 min; then 0.2% SDS was added at room temperature and the mixture was placed in a thermostatic metal bath at 55°C for 5 min;

[0022] (6) Purification: DNA purification magnetic beads were added to the mixed solution of step (5) at a volume ratio of 62.5:50 of the total sample volume for purification, and then the DNA was eluted with ultrapure water;

[0023] (7) Sample amplification: using the DNA obtained in step (6) and Nextera Index primers to prepare a sample amplification system, incubating the sample in a thermal cycler;

[0024] (8) Purification: DNA purification magnetic beads were added at a volume ratio of 0.8:1, and the sample was eluted with ultrapure water. The quality of the cDNA library was tested using the Qubit dsDNA HS detection kit, and the cDNA fragment size was measured using a standard cartridge (C105101), retaining fragments with a distribution of 300-500 kb;

[0025] (9) Sequence the DNA on an Illumina-compatible sequencer and organize the data.

[0026] (III) Beneficial effects

[0027] (1) The present invention designs culture conditions and culture fluids suitable for the growth of circulating tumor cells, so that the sorted circulating tumor cells are first cultured for a short period of time to restore the state of the circulating tumor cells, reduce the degree of RNA degradation, and restore cell viability, and then undergo lysis, reverse transcription, amplification, sequencing and other processes, which is conducive to obtaining more accurate circulating tumor cell detection data; for some circulating tumor cells with a higher degree of malignancy, the number of cells can be increased after culture, thereby increasing the number of available samples.

[0028] (2) The present invention uses a cell elutriator for sorting and culturing, and then uses a glass needle for manual picking. The identification of circulating tumor cells mainly relies on manual picking. Compared with the prior art using Epcam positive sorting technology, it is not only low-cost and high-accuracy, but also not prone to the loss of circulating tumor cells, and will not cause interference problems such as a large number of white blood cells caused by negative screening. Since the number of circulating tumor cells is extremely small, according to international standards, there are about 7 circulating tumor cells in 10mL, so manual picking does not increase too much labor cost, and can significantly reduce costs and improve the success rate of obtaining circulating tumor cells compared to the prior art.

[0029] (3) Compared with the existing smartseq3 experimental scheme, the present invention further optimizes the operation and conditions of sample purification, optimizes the mixed liquid system of DNA fragmentation, improves the purity of the final DNA obtained, makes the DNA fragments more uniform, and improves the efficiency and data quality of subsequent sequencing. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 This is the proliferation of the sorted colorectal cancer circulating tumor cells cultured in vitro in Example 1.

[0031] Figure 2 This is Example 2, in which the selected choriocarcinoma circulating tumor cells are cultured in vitro to produce proliferation. DETAILED DESCRIPTION

[0032] In order to better explain the present invention and facilitate understanding, the present invention is described in detail below in conjunction with the accompanying drawings through specific embodiments. In the following embodiments, concentration % refers to mass percentage concentration unless otherwise specified.

[0033] Example 1

[0034] This embodiment provides a culture method in the process of building a circulating tumor cell library, which includes: placing the sorted colorectal cancer circulating tumor cells in an anoxic incubator for culture, and the oxygen concentration is controlled at 4-5%; the culture temperature is 37±0.5°C. The culture fluid is prepared using RPMI 1640 culture medium, and the preparation method is: add 5mL of L-glutamine, 10mL of B27 supplement, 3μg of FGF, 3μg of EGF, and 10mL of penicillin / streptomycin (mixed in a 1:1 volume ratio) to each 500mL of RPMI 1640 culture medium. The culture time is 7 days.

[0035] like Figure 1(A) shows the microscopic observation of the colorectal cancer circulating tumor cells obtained by sorting on day 0, (B) shows the microscopic observation of the colorectal cancer circulating tumor cells cultured by the above method on day 4, and (C) shows the microscopic observation of the colorectal cancer circulating tumor cells cultured by the above method on day 7. Figure 1 It can be seen that under the above culture conditions, colorectal cancer circulating tumor cells do proliferate. Initially, the colorectal cancer circulating tumor cells are single circulating tumor cells, and as the culture time increases, the cells grow in "clusters". This shows that under the culture conditions of this example, colorectal cancer circulating tumor cells have good proliferation activity.

[0036] Example 2

[0037] In this embodiment, the selected choriocarcinoma circulating tumor cells were cultured for 7 days under the following culture conditions: cultured in an anoxic incubator with an oxygen concentration controlled at 4-5%; and cultured at 37±0.5° C. The culture medium was prepared using RPMI 1640 culture medium, and the preparation method thereof was as follows: 6 mL of L-glutamine, 10.8 mL of B27 supplement, 2.8 μg of FGF, 2.9 μg of EGF, and 10.5 mL of penicillin / streptomycin (volume ratio 1:1) were added to each 500 mL of RPMI 1640 culture medium.

[0038] Depend on Figure 2 It can be seen that under the above culture conditions, choriocarcinoma circulating tumor cells did proliferate (GTD22 is the donor number). Initially, the choriocarcinoma circulating tumor cells were single circulating tumor cells. As the culture time increased, the cells began to grow in "clusters". This shows that under the culture conditions of this example, choriocarcinoma circulating tumor cells have good proliferation activity. Since choriocarcinoma circulating tumor cells differentiate and proliferate, this provides a basis for successfully picking circulating tumor cells and obtaining more cell samples.

[0039] CTCs are prone to death due to mechanical stress of blood flow, attack of immune system, lack of growth factors and adhesion matrix, and CTCs are traumatized by external forces during sorting, so the newly sorted CTCs are in extremely poor cell state and difficult to culture. Most researchers start monitoring CTCs as soon as they process blood to obtain them because they are worried about CTCs cell death. The present invention not only cultivates CTCs cells to restore their state, but also proliferates the number of cells, provides more available single cell samples, and improves the success rate of library construction.

[0040] After the CTCs cells proliferate in culture, cells suspected of circulating tumor cells are directly selected using a capillary glass needle and transferred to a centrifuge tube containing lysis buffer for library construction. Compared with Epcam positive or negative screening, manual selection can accurately select circulating tumor cells, greatly increasing the probability of successfully capturing circulating tumor cells.

[0041] Example 3

[0042] This embodiment provides a method for building a circulating tumor cell library, and the operation steps are as follows:

[0043] 1. Sorting: Use the cell elutriation machine of Shenzhen Genliu Technology Co., Ltd. to sort out choriocarcinoma circulating tumor cells from the blood. The device has a fast separation speed and low cost in separating circulating tumor cells. 10mL of blood can be processed in about 7 minutes.

[0044] 2. Observe circulating tumor cells under a microscope.

[0045] 3. Pull the glass needle: Soak the capillary tube with the specification of 1.5*0.9*100mm in alcohol for disinfection, and heat it under the outer flame of the alcohol lamp for 15s. When heating, you need to hold the glass tube with both hands and rotate it continuously to ensure that the glass tube is heated evenly. When the glass tube becomes soft, move the glass tube out of the flame, pull the glass tube with both hands in parallel, and when the center of the glass tube is about 0.2mm, you will get the glass needle, and keep it for use.

[0046] 4. In vitro culture: The sorted colorectal cancer circulating tumor cells are placed in an oxygen incubator for culture, and the oxygen concentration is controlled at 4-5%; the culture temperature is 37±0.5℃. The culture medium is prepared using RPMI 1640 medium, and the culture medium is prepared using RPMI 1640 medium. The preparation method is: add 5mL of L-glutamine, 10mL of B27 supplement, 3μg of FGF, 3μg of EGF, and 10mL of penicillin / streptomycin (volume ratio 1:1) to each 500mL of RPMI 1640 medium. Culture for 3-10 days, and observe the growth of cells continuously during the period. Once the cells show aging phenomena such as darkening of the nucleus color or cell deformation, immediately pick the cells for transcription and library construction. Through in vitro culture, the circulating tumor cells can be revitalized, RNA degradation can be avoided, and the transcription and library construction can be carried out when more RNA is provided, and some circulating tumor cells proliferate, so more circulating tumor cell samples can be obtained.

[0047] The picking method is as follows: pour liquid nitrogen into the thermos cup in advance, select cells with a diameter of about 20μm under a 10× microscope, insert the glass syringe into the joint of the mouth pipette, use the mouth pipette to give the cells appropriate negative pressure, draw 1-2μL of culture medium and cells, draw the cells into the glass syringe and then blow them into a centrifuge tube containing 3μL of lysis solution, put the centrifuge tube directly into the thermos cup filled with liquid nitrogen, and store it in a -80℃ refrigerator.

[0048] 5. Single cell library construction, sequencing, and analysis

[0049] (1) Cell lysis: Prepare cell lysis solution according to Table 1 (the composition of the lysis solution in the centrifuge tube is the same), and heat the sample at 72°C for 10 min to lyse the cells.

[0050] Table 1: Lysis buffer preparation table

[0051]

[0052] (2) Reverse transcription: prepare the reverse transcription system according to Table 2, add the reverse transcription system to the reaction system in the previous step, and incubate in a thermal cycler according to the procedure in Table 3.

[0053] Table 2: Reverse transcription system preparation table

[0054]

[0055]

[0056] Table 3: Thermal cycler incubation program

[0057] temperature time cycle 42℃ 90 points 1 50℃ 2 points 42℃ 2 points 10 85℃ 5 points 1

[0058] (3) Pre-amplification: Prepare the pre-amplification system according to Table 4, add it to the tube in the previous step, mix well, place the tube in a thermal cycler, and perform amplification according to the program in Table 5.

[0059] Table 4: Pre-amplification system

[0060] Reagents μL (per reaction) KAPA High Fidelity Hot Start Buffer (2X) 3 Fwd_PCR_primer primer (10μM) 0.5 Rev_PCR_primer (10 μM) 0.1 Nuclease-free water 2.4 Total volume 6μL

[0061] Table 5: Pre-amplification procedures

[0062]

[0063] (4) Purification after pre-amplification: After pre-amplification, the total volume of the sample is 10 μL. First, 40 μL of ultrapure water is added to the sample, and then 35 μL of DNA purification magnetic beads (N411-03) from Novozymes is added. Finally, cDNA is eluted with 12.5 μL of ultrapure water, and fragments with a size of 1 kbp are retained for later use. Compared with the purification operation of the current smartseq3 technology, the present invention optimizes the purification system, does not need to prepare a 22% PEG purification microsphere solution and a resuspension of mcSCRB-seq magnetic beads, and simplifies the operation steps.

[0064] (5) DNA concentration measurement: The quality of the cDNA library was detected using the Qubit dsDNA HS Assay Kit (Q32854). The process is described below or in the reagent manual. The measured DNA concentration was greater than 0.3 ng / UL, which met the requirements for library construction.

[0065] ①Through dsDNA kit by diluting 20×TE buffer or preparing 1×TE buffer by preparing a solution of 10mM Tris-HCl, 0.1mM EDTA, pH 8. ② Dilute 1:400 in 1×TE buffer dsDNA dye and mix. ③ Dispense 49μL / 99μL of the prepared Quantiflour dye mixture into 384 / 96 black flat-bottom well plates respectively. ④ Add 1μL of cDNA to each well, mix well, and incubate at room temperature for 5min. ⑤ Measure fluorescence using an ELISA reader (504nM excitation / 531nM emission). ⑥ Calculate the cDNA concentration.

[0066] (6) DNA quality check: Use standard cassette (C105101) to measure the size of DNA fragments. The process is the same as the reagent instructions. The fragments are distributed around 1000 kbp.

[0067] (7) DNA fragmentation

[0068] ① Prepare 2×TD buffer system, the composition of which is shown in Table 6.

[0069] Table 6: 2×TD buffer system

[0070] Reagents Volume (μL) 2X buffer concentration Tris-HCL pH 7.5 (1M) 20 20mM Magnesium chloride (100 mM) 100 10mM Dimethylformamide (DMF) 100 10％ Ultrapure water 780 -- Total volume 1000 --

[0071] ② Prepare a fragmentation mixed liquid system. The fragmentation mixed system is shown in Table 7.

[0072] Table 7: Fragmentation mixture system

[0073]

[0074]

[0075] By using 2×TD solution, compared with the 4×TD solution used in smartseq3 technology, the amplification effect of 2×TD solution is better, and the amplification of the target gene is more specific and larger.

[0076] As shown in the table above, 1 μL Amplicon Tagmentation Mix (Tn5) was added to every 1 ng of cDNA, and then placed in a constant temperature metal bath at 55°C for 5 minutes. Next, 12.5 μL of 0.2% SDS was added at room temperature, and then placed in a constant temperature metal bath at 55°C for 5 minutes to fragment the DNA. Compared with the current smartseq3 technology, the present invention optimizes the composition of the fragmentation mixture system, increases the amount of TD solution and Amplicon Tagmentation Mix reagent relative to cDNA, is simpler to operate, has a better DNA fragmentation effect, and is easier to amplify the target fragment in the next step.

[0077] (8) Purification after fragmentation: After the fragmentation treatment, the total sample volume was 62.5 μL, 50 μL of DNA purification magnetic beads (N411-03) from Novozymes was added, and then the DNA was eluted with 20 μL of ultrapure water. The purification process was the same as the reagent instructions.

[0078] (9) Amplification: Add Nextera Index primers for sample amplification. The sample amplification system is shown in Table 8, and the thermal cycler program is shown in Table 9.

[0079] Table 8: Sample amplification system

[0080] Reagents μL / each reaction KAPA High Fidelity Hot Start Buffer (2X) 25 DNA 20 Custom S50X index prime(10μM) 5 Custom N70X index prime(10μM) 5 Total volume 50μL

[0081] Table 9: Sample Amplification Thermal Cycler Program

[0082] temperature time cycle 72℃ 3 minutes 1 98℃ 3 minutes 1 98℃ 10 seconds 55℃ 30 seconds 12 72℃ 30 seconds 72℃ 5 minutes 1 4℃ -- --

[0083] Compared with the existing smartseq3 technology, the present invention increases the primer concentration and dosage in the sample amplification system, optimizes the amplification system, and uses KAPA high-fidelity hot start buffer (2X) instead of "Phusion HF buffer (5X) and Phusion HF", which can obtain better amplification effects and subsequently obtain more target fragments for library construction.

[0084] (10) Purification after amplification: Add Novozyme DNA purification magnetic beads (N411-03) at a volume ratio of 0.8:1, and finally elute the sample with 20 μL ultrapure water. Keep for later use.

[0085] Compared with the existing smartseq3 technology, the present invention increases the addition ratio of DNA purification magnetic beads and does not use 22% PEG microsphere purification technology, which not only simplifies the purification operation, but also improves the purification effect of the sample. After the sample is added with DNA magnetic beads, the purification step is simple, and 70-80% of the target fragment is retained after purification.

[0086] (11) DNA concentration measurement: The quality of the cDNA library was detected using the Qubit dsDNA HS detection kit (Q32854). The process was the same as the reagent instructions, and the measured DNA concentration was greater than 0.3 ng / uL.

[0087] (12) DNA quality check: The DNA fragment size was measured using a standard cassette (C105101) and the process was the same as the reagent instructions. The fragment size distribution was 300-500 kb, and the RSD% of the final fragment size did not exceed 20%, indicating that the fragment size distribution was uniform.

[0088] (13) Sequencing: Sequencing was performed on an Illumina-compatible sequencer, with 0.5G sequencing for each sample.

[0089] (14) Data processing: After sequencing was successfully completed, the binary base call file (BCL) was converted to fastq using bcl2fastq in its latest version (bcl2fastq v2.20).

[0090] The oligonucleotide primer sequences used in Table 1, Table 2 and Table 4 are shown in Table 10.

[0091] Table 10: Oligonucleotide primer sequence list

[0092]

[0093]

[0094] Note: * indicates that the preceding base position is biotinylated.

[0095] The tumor cell library construction method of the present invention uses a microfluidic sorting device (cell elutriation machine of Shenzhen Genliu Technology Co., Ltd.), which has a fast separation speed and low cost in separating circulating tumor cells; an in vitro culture technology for the sorted circulating tumor cells is added, and after culture, some circulating tumor cells may increase in value, which can provide more circulating tumor cells. The improved circulating tumor cell selection technology greatly increases the probability of successfully capturing circulating weight cells, optimizes the smartseq3 cell library construction process, and significantly improves the cDNA concentration of the sample and the concentration of the final product.

[0096] After several days of in vitro culture, Figure 1-2It can be seen that circulating tumor cells are in a proliferative state. At the same time, the sequencing results show that the single cells sorted, cultured in vitro, selected, and banked in this embodiment are circulating tumor cells, and data analysis can be performed. In view of the current situation that large-scale full-length library sequencing of circulating tumor cells is still relatively immature, based on the method of the present invention, the inventor team has completed the library construction of more than 1,000 circulating tumor cells.

[0097] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for cultivating circulating tumor cells in the process of establishing a library, characterized in that: include: The sorted circulating tumor cells were placed in a hypoxic incubator for culture, and the oxygen concentration was controlled at 4-5%; the culture temperature was 37±0.5°C, and the culture medium used a dual-antibody composition of a basic culture medium supplemented with nerve growth factor FGF, epidermal growth factor EGF, B27 supplement, L-glutamine and antibiotics / antifungal agents; the basic culture medium was RPMI 1640 culture medium; the culture time was 3-10 days, and the growth of the cells was continuously observed during the culture period. Once the cells showed signs of aging, they were immediately picked out for library construction.

2. The culture method according to claim 1, characterized in that The antibiotic / antifungal combination is penicillin / streptomycin or amphotericin B.

3. The culture method according to claim 1, characterized in that The preparation method of the culture solution is as follows: 4-6 mL of L-glutamine, 9-12 mL of B27 supplement, 2.5-3 μg of FGF, 2.5-3 μg of EGF, and 10 mL-12 mL of the dual antibody composition are added to each 500 mL of RPMI 1640 culture medium.

4. The culture method according to claim 1, characterized in that The method to judge cell aging is: the darkening of the cell nucleus color or the deformation of the cell morphology indicates that the cell is beginning to age.

5. A method for building a circulating tumor cell library, characterized in that: include: Isolation of circulating tumor cells from blood, in vitro culture, single cell selection, library construction and sequencing; The in vitro culture adopts the culture method according to any one of claims 1 to 4.

6. The library construction method according to claim 5, characterized in that: Circulating tumor cells were isolated from the blood using a cell elutriator.

7. The library construction method according to claim 5, characterized in that: The single cell selection is to manually pick circulating tumor cells cultured in vitro using a glass needle; the specific operation is: using alcohol-disinfected capillaries as raw materials, heating and softening them to obtain glass needles with a tube center of 0.2mm±0.05mm; pouring liquid nitrogen into a thermos cup in advance, selecting cells with a diameter of about 20μm±2μm from the culture medium under a 10× microscope, inserting the glass needle into the joint of the mouth pipette, using the mouth pipette to provide negative pressure, sucking cells and 1-2μL of culture medium, transferring the cells into the glass needle, and then blowing the cells into a centrifuge tube containing 3μL of lysis solution, placing the centrifuge tube into a thermos cup filled with liquid nitrogen, and storing it in a -80℃ refrigerator.

8. The library construction method according to claim 5, characterized in that: The process of library construction and sequencing includes the following steps: (1) Lysis and reverse transcription: Place the centrifuge tube containing cells and lysis solution under heating conditions to lyse the cells to obtain cell lysis solution, prepare reverse transcription solution, mix the reverse transcription solution with the cell lysis solution, and incubate in a thermal cycler; The sequence of the oligonucleotide Smartseq3_Oli godT30VN added to the lysate was / 5Biosg / ACGAGCATCAGCAGCATACGATTTTTTTTTTTTTTTTTTTT T TTTTTTTVN; the sequence of the oligonucleotide Smartseq3_N8_TSO added to the reverse transcription solution was / 5Biosg / AGAGACAGATTGCGCAAT GNNNNNNNNrGrGrG; (2) Pre-amplification: Prepare a preamplification system, add the preamplification system to the centrifuge tube treated in step (1), mix well, and place the centrifuge tube in a thermal cycler for preamplification; the forward amplification primer Fwd is TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGATTGCGCAA*T*G; the reverse amplification primer Rev is ACGAGCATCAGCAGCATAC*G*A; (3) Purification: After the pre-amplification is completed, ultrapure water is added to the centrifuge tube of the pre-amplification sample for dilution, and then DNA purification magnetic beads are added. The volume ratio of the added DNA purification magnetic beads to the volume of the liquid in the centrifuge tube before addition is 35:50, and the cDNA is eluted with ultrapure water; (4) cDNA quality check: The cDNA library quality was tested using the Qubit dsDNA HS assay kit, and the DNA fragment size was measured using a standard clamp, retaining fragments with a size of 900-1100 kb; (5) cDNA fragmentation: 1 μL Amplicon Tagmentation Mix (Tn5) was added to every 1 ng of cDNA to obtain a fragmentation mixture, which was placed in a thermostatic metal bath at 55°C for 5 min; then 0.2% SDS was added at room temperature and the mixture was placed in a thermostatic metal bath at 55°C for 5 min; (6) Purification: DNA purification magnetic beads were added to the mixed solution of step (5) at a volume ratio of 62.5:50 of the total sample volume for purification, and then the DNA was eluted with ultrapure water; (7) Sample amplification: using the DNA obtained in step (6) and Nextera Index primers to prepare a sample amplification system, incubating the sample in a thermal cycler; (8) Purification: DNA purification magnetic beads were added at a volume ratio of 0.8:1, and the sample was eluted with ultrapure water. The quality of the cDNA library was tested using the Qubit dsDNA HS detection kit, and the size of the cDNA fragments was measured using a standard clamp, retaining fragments with a distribution of 300-500 kb; (9) Sequence the DNA on an Illumina-compatible sequencer and organize the data.

Images